ID: 1161105919

View in Genome Browser
Species Human (GRCh38)
Location 19:2443990-2444012
Sequence TCCCTGTGGTTGGATGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105919_1161105923 -8 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105919_1161105930 28 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105930 19:2444041-2444063 CGCGTCTCACGGTGTCCACTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1161105919_1161105928 17 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105928 19:2444030-2444052 CTGAGGTCAAACGCGTCTCACGG 0: 1
1: 0
2: 0
3: 4
4: 51
1161105919_1161105922 -9 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105919_1161105924 -7 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1161105919_1161105929 27 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105929 19:2444040-2444062 ACGCGTCTCACGGTGTCCACTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1161105919_1161105925 0 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105925 19:2444013-2444035 AATGCCTACGATGGGGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105919 Original CRISPR TCCCTGTGGTTGGATGTTCT TGG (reversed) Intronic
901147923 1:7080213-7080235 TCCCTTTGGTTGTATGATTTGGG - Intronic
901877243 1:12173889-12173911 TCACTGTGGTTTGAGGTACTTGG + Intronic
902065021 1:13678300-13678322 TTCCTGGGATTGGATGTTCTGGG + Intergenic
903121763 1:21220809-21220831 TCCCTGGTGTTGTATTTTCTGGG - Intronic
904599713 1:31666698-31666720 TCCCTGTGGCTGTCTGTACTGGG - Intronic
905399716 1:37692433-37692455 TGCTTGTGATTGGATGTTGTGGG + Exonic
907591209 1:55673351-55673373 TCACTGTGGTTGCATGTGTTTGG + Intergenic
908058196 1:60315584-60315606 TTCTTGTTGTTGGCTGTTCTTGG + Intergenic
908100230 1:60783368-60783390 TCCATTTGGTTGGTTGTTTTTGG + Intergenic
908909466 1:69056265-69056287 TCCCTGTGGATGAATATTTTAGG + Intergenic
910342070 1:86199843-86199865 TCCTTGTGGTTTGATGGGCTAGG - Intergenic
910954849 1:92691014-92691036 TCCTTCAGGTTGGATATTCTCGG + Intronic
911754929 1:101542950-101542972 TCCCTCTGGATGGTTGTTATTGG + Intergenic
911781861 1:101889992-101890014 TCCCTGTGGCTGAATTTTTTGGG - Intronic
913072287 1:115310642-115310664 TCCCTGTAATTGGAAGTTCTTGG + Intronic
915294851 1:154912768-154912790 TGCCTTTGGCTGGATGTTCCTGG + Intergenic
921069458 1:211646960-211646982 TGCCTGTGGTTGCAGGTACTTGG - Intergenic
921127148 1:212188046-212188068 TCCCTTTGGGAAGATGTTCTTGG + Intergenic
921995460 1:221413338-221413360 TCCATGTGGAAGGAAGTTCTGGG + Intergenic
922741085 1:228014612-228014634 TCCCTGTGGATGGAAGCTCAGGG - Intronic
924666402 1:246077341-246077363 TGCCTGAGGTTGGATTTTGTGGG - Intronic
924747956 1:246855454-246855476 TCCCTGCCGTTTGATCTTCTTGG - Intronic
1063120150 10:3100173-3100195 TCTCTTTGGTTGGAGTTTCTGGG + Intronic
1065462290 10:25981853-25981875 TTCCTGTGGTAGGTAGTTCTTGG - Intronic
1070321917 10:75360756-75360778 TCTCTGTGCTTGGATGCTGTAGG - Intergenic
1073103058 10:101016921-101016943 GCCCTGGGGTGGGATGTTCTGGG - Intronic
1073170420 10:101502333-101502355 TCCCTGAAGTTGGGTGTTATGGG + Intronic
1073482154 10:103792854-103792876 TCCCTGGGGTTGGTTGTAATGGG + Intronic
1074442963 10:113494870-113494892 CCTCTGTGGGTGGATGTCCTCGG + Intergenic
1074779439 10:116790495-116790517 GCCCTGGGGCTGGATGTTCGGGG - Intergenic
1075241902 10:120786723-120786745 TCCCCTTGGGTGGATGTCCTAGG - Intergenic
1076536918 10:131184581-131184603 TACCTGAGGTTGGATGTGCCAGG - Intronic
1078254200 11:9643411-9643433 TCTCTGTGGTTTGATGTGTTAGG - Intergenic
1078938424 11:15973678-15973700 TCCCTGTGGAAGGATCATCTTGG + Intronic
1079958278 11:26890555-26890577 GCCCTGAGCTTGGATGTTATTGG - Intergenic
1081461965 11:43280279-43280301 ACCCTTGGGGTGGATGTTCTGGG - Intergenic
1081684225 11:45030247-45030269 TCCCTCTGCTGGGATGTTCTTGG + Intergenic
1081736736 11:45409604-45409626 TCCCTGAGCTGGGATGTGCTTGG - Intergenic
1084919748 11:72459384-72459406 GCCCCGCGGTTGGATATTCTTGG + Intergenic
1090915845 11:131161347-131161369 TCCCTGTTGCTGGATGATCTCGG - Intergenic
1092193847 12:6537470-6537492 ACCCTGGGGTTGGGGGTTCTGGG + Intronic
1093479561 12:19590690-19590712 TCCTTCTGGTTGGAGGATCTGGG - Intronic
1093841691 12:23910401-23910423 TCCACATGGTTTGATGTTCTTGG - Intronic
1093880161 12:24395157-24395179 TCCCTGTGGTAGGACATTTTAGG - Intergenic
1094027197 12:25971187-25971209 TCCTTGCTGCTGGATGTTCTAGG + Intronic
1096226460 12:49869592-49869614 GCCCTCCGGCTGGATGTTCTGGG - Exonic
1104357830 12:128103765-128103787 TTCCTATGGTTGGATATTCTTGG + Intergenic
1113069541 13:106407180-106407202 TTCCTGTGGTGGGGTGTTTTTGG - Intergenic
1115732084 14:36281586-36281608 TCACTGTGGTTGGATCTGTTAGG - Intergenic
1116713815 14:48402931-48402953 TTCCTGTGCCTGAATGTTCTTGG - Intergenic
1119171772 14:72541079-72541101 TCCCTCTGGTTTGATGTTCATGG - Intronic
1119178544 14:72587906-72587928 TCCCTGTTGTTGGAAGCTTTTGG - Intergenic
1123630396 15:22256945-22256967 CCCCTGTGTTTGCATTTTCTCGG + Intergenic
1125759904 15:42089228-42089250 TGCATGTGGTTGGAAGTTCTCGG + Intronic
1125859598 15:42986724-42986746 CCACTGTGGGTGGATGTGCTTGG - Intronic
1127265005 15:57354035-57354057 TTCCTACGGTTGGAGGTTCTGGG - Intergenic
1127276390 15:57448955-57448977 TCTATATGGTTGGTTGTTCTAGG + Intronic
1129069060 15:72936171-72936193 TCCCTTTGGTTGTGTGTACTGGG + Intergenic
1131119393 15:89813575-89813597 TCCCTGTGGGAGGGTGTGCTGGG - Intronic
1131950349 15:97674605-97674627 CCACAGTGCTTGGATGTTCTAGG + Intergenic
1132869067 16:2107558-2107580 TCCCTGTTGCTGGATGTGGTGGG - Intronic
1133092329 16:3414023-3414045 GCCCTGTGGCCGGATGTTCCAGG + Intronic
1134550121 16:15134955-15134977 TCCCTGTTGCTGGATGTGGTGGG - Intronic
1134718348 16:16368040-16368062 TCCCTGTTGCTGGATGTGGTGGG + Intergenic
1134956404 16:18384119-18384141 TCCCTGTTGCTGGATGTGGTGGG - Intergenic
1135170240 16:20177515-20177537 TCACTGGGGATGGATGTGCTGGG - Intergenic
1138297207 16:55897176-55897198 ACCCTGGGGTTGGATGCTCTTGG - Intronic
1139606084 16:68019721-68019743 TCTCTTTGGTAGGAAGTTCTTGG - Intronic
1140919143 16:79520702-79520724 ACCCTGTGCTTGGGTGGTCTTGG + Intergenic
1141003225 16:80327688-80327710 TCCCTGAGGAGGGATGGTCTGGG - Intergenic
1141182954 16:81766790-81766812 TCCCTGTGATTGTACCTTCTTGG - Intronic
1141746277 16:85928718-85928740 TCCCTGTGGGTGGAACTGCTGGG + Intergenic
1141914549 16:87086177-87086199 TCCTTGGGCTTGGATGCTCTGGG - Intronic
1144484073 17:15650713-15650735 TCCCTGTGGCTGGATCTGCATGG - Intronic
1144568660 17:16381131-16381153 TCCCTGTGGGTGGACGTGGTTGG + Exonic
1144671971 17:17138056-17138078 TACCTGTGGTTGGGGGTGCTGGG - Exonic
1146053757 17:29571195-29571217 GCCCTGTATTTGGATGCTCTTGG + Intronic
1148862455 17:50611734-50611756 GCCCTGTGCTAGGATGTTTTGGG - Intronic
1152178971 17:78806093-78806115 TCCCTGTGGTTGCGTGTGCTTGG - Intronic
1153169690 18:2301674-2301696 TGCCTGTGGGGGAATGTTCTGGG - Intergenic
1155677822 18:28450865-28450887 TCACTGTGGTGGGTTGTTGTGGG + Intergenic
1158411208 18:57207649-57207671 GCCCTGATGTTGGATGTTGTGGG + Intergenic
1158608314 18:58915782-58915804 TTCATGTGGTTGTATGTTCTGGG + Intronic
1159130860 18:64278765-64278787 TCCCTGTGGTGGGACGTGCAGGG + Intergenic
1161105919 19:2443990-2444012 TCCCTGTGGTTGGATGTTCTTGG - Intronic
1161474325 19:4475692-4475714 TCCCTGTGGTGGGGCATTCTGGG + Intronic
1162459246 19:10804343-10804365 TTCTTGTGCTTGAATGTTCTGGG + Intronic
1162543911 19:11316465-11316487 TTTCTCTGGATGGATGTTCTTGG - Intronic
1162992109 19:14310187-14310209 TCACTGTGGTTGGCAGTTGTGGG - Intergenic
1165476567 19:36034084-36034106 TCCCTGTGGCTGCATGTTGGAGG - Intergenic
1166524545 19:43502800-43502822 TCCGTGTGGTTGGGTGGTCACGG - Intronic
1167243461 19:48359375-48359397 TGCCTGGGGGAGGATGTTCTTGG - Intronic
925924347 2:8659604-8659626 TCCCTGTGGTTGGTTGATATTGG + Intergenic
926381620 2:12296265-12296287 TCCCTGTGCTTGTAGCTTCTGGG - Intergenic
927860260 2:26556259-26556281 CCCCAGTGGTTGCATGTGCTGGG + Intronic
928080669 2:28309717-28309739 CCCCTGTGGTTGTATCTTCTTGG + Intronic
933358575 2:81247628-81247650 TTCCTGAGGTTGGATGTGCATGG + Intergenic
933408839 2:81898774-81898796 CCACTGTTTTTGGATGTTCTGGG - Intergenic
933851900 2:86374305-86374327 TCACTGTGGATGGATGCTCTAGG - Intergenic
937439562 2:121904550-121904572 TGACTGCGGTTGGATGCTCTGGG + Intergenic
937923295 2:127147289-127147311 TCCCTGTGGCTGCACGTCCTGGG + Intergenic
944063512 2:195594706-195594728 TGTCTGAGGTTGAATGTTCTGGG + Intronic
944701228 2:202248117-202248139 TCCCTGTTGTAGGATGTCCTCGG + Intergenic
946428337 2:219611772-219611794 TGCCTGAGGTGGGCTGTTCTTGG - Exonic
947696333 2:232193051-232193073 TCCCTTTGGTTGGATGGGCCCGG - Intronic
948904514 2:240972259-240972281 TCCCTGTGGCTGCAGGATCTTGG - Intronic
1170403738 20:16014449-16014471 TCCCTGTGGATTTATGATCTTGG - Intronic
1173361818 20:42351358-42351380 CCCCTGTGGTTGGATATATTTGG - Intronic
1174487315 20:50869528-50869550 TTTATGTGGTTGGCTGTTCTTGG - Intronic
1175380029 20:58556590-58556612 GCCCTGTGGTAGAATATTCTGGG - Intergenic
1175749067 20:61482661-61482683 CCCATGTGGTTGGATGCTCCTGG + Intronic
1175838060 20:62008844-62008866 TTCCTGGGGCTGGGTGTTCTGGG - Intronic
1175970502 20:62684486-62684508 CCCCAGTGGATAGATGTTCTGGG - Intronic
1175984313 20:62756320-62756342 GCCCTGTGGTGGGAGGTGCTTGG + Intronic
1175993017 20:62798793-62798815 TACCTGTGCTTGGGTGGTCTTGG + Intronic
1177882975 21:26716133-26716155 TCCCTGTGCTAGGAAGTTATAGG + Intergenic
1179495644 21:41769695-41769717 TCCCTGCGGTAGGATGTTAAAGG - Intergenic
1179939959 21:44630939-44630961 TCCCTGTGGTTTGCTGTTGCTGG - Intronic
1183648639 22:39141159-39141181 TTCCTGTTGTTGGGTGATCTCGG - Intronic
1184587192 22:45455864-45455886 ACCCTGTGGTTGTAAGTTGTTGG - Intergenic
950863713 3:16172454-16172476 GCCCTGGGGTGGGCTGTTCTTGG + Intergenic
951704227 3:25527616-25527638 ACCCTGTGCTTGGATGGTTTGGG - Intronic
951895048 3:27602328-27602350 ACTCTGTAGTTGGATGTCCTGGG + Intergenic
953604073 3:44397441-44397463 TCCATGTGGTTGCATGTATTGGG + Intronic
954471357 3:50698495-50698517 TCTCTGTGGATGTATGTTTTTGG + Intronic
957920427 3:86741161-86741183 TCCCTGTAGTTGAATTCTCTAGG - Intergenic
959260282 3:104070460-104070482 TGGATGTGGTTGGATTTTCTAGG - Intergenic
959574589 3:107920970-107920992 ATCCTGTGGTTGGATGGTCTTGG + Intergenic
966435689 3:179881385-179881407 TCACAGTGGTTGGATGTTGTTGG + Intronic
971735573 4:30445288-30445310 GCCCTGTGGTTGTATTTCCTTGG + Intergenic
972821375 4:42705801-42705823 CACCTGTGGTTGGAAGTTCGAGG - Intergenic
975353775 4:73375408-73375430 TCCCTGTGGTTAGAATTTCATGG + Intergenic
976222918 4:82772566-82772588 TCGCTATGGCTGGATGGTCTAGG + Intronic
978752368 4:112264690-112264712 TCCAGTTGGTTGGAAGTTCTTGG + Intronic
978793733 4:112688637-112688659 TGCCTGTGGTTCCATCTTCTTGG + Intergenic
986242150 5:5970749-5970771 TCCCTGTGCCTGGATGATCTCGG - Intergenic
986580312 5:9258946-9258968 CCCCTGTGGTTGCAGGTACTTGG - Intronic
986626831 5:9730540-9730562 TCCCTGTGCCTGGGTGCTCTGGG - Intergenic
986813467 5:11384061-11384083 TACCTGTCATTGGATGTACTTGG - Intronic
987015530 5:13814846-13814868 TCCCTTTGGTGGGGTATTCTAGG - Exonic
988372503 5:30389344-30389366 TCCCTTTGGTTTGAGGTGCTAGG - Intergenic
991488242 5:67159991-67160013 TCCCAGTGGCTGGCTGCTCTTGG - Intronic
994495152 5:100502630-100502652 TCCATTTGGATGGATGTTGTTGG + Intergenic
997365510 5:133322797-133322819 TGCCTGGGATTGGATGCTCTTGG + Intronic
999205035 5:149841706-149841728 TCCCTCTGCTAGGCTGTTCTGGG + Intronic
1001099654 5:168803871-168803893 TCACTGTGGCTGGATGTTGAGGG + Intronic
1002976484 6:2083299-2083321 TTGCTGTTGTTGGATGGTCTGGG - Intronic
1003816600 6:9848343-9848365 ACCCTGTGAATGTATGTTCTAGG - Intronic
1005030648 6:21505644-21505666 TTCCTGTAGTTGGTTGTTTTAGG + Intergenic
1008133658 6:47747252-47747274 TTCCTGTGGTAGAAAGTTCTGGG + Intergenic
1010943839 6:81951643-81951665 TCCCTGTGGTTGAAAGGACTAGG - Intergenic
1013237000 6:108205971-108205993 TCCCAGTTTTTGGATGGTCTGGG + Intergenic
1016351998 6:143178237-143178259 TCCCTCTGGGTGGATGTGGTGGG + Intronic
1019649883 7:2151079-2151101 TCCCTGAGGTTGGAAGCTTTGGG - Intronic
1019845080 7:3490837-3490859 TCCCTTTTCTTGGGTGTTCTTGG + Intronic
1022210835 7:28207651-28207673 TTCCTGTGGTTGGTTATTTTTGG + Intergenic
1022666191 7:32413408-32413430 TCTGTGTGGTAGGATGTGCTAGG - Intergenic
1023546174 7:41319660-41319682 TCCATCTGGGTGGATGTTTTAGG - Intergenic
1024830340 7:53446747-53446769 TCCCTGTGACAGGAGGTTCTAGG + Intergenic
1025223504 7:57136466-57136488 TCCCTCTTGTTTTATGTTCTTGG + Intronic
1025634307 7:63308096-63308118 TCCCTCTTGTTTTATGTTCTTGG + Intergenic
1025648391 7:63440079-63440101 TCCCTCTTGTTTTATGTTCTTGG - Intergenic
1025740922 7:64194766-64194788 TCCCTCTTGTTTTATGTTCTTGG + Intronic
1025741704 7:64203029-64203051 TCCCTCTTGTTTTATGTTCTTGG - Intronic
1026429290 7:70327652-70327674 TCCATGGATTTGGATGTTCTGGG + Intronic
1029151072 7:98480915-98480937 TCCCTGTGGGTGGCTGGGCTGGG - Intergenic
1030641448 7:112010996-112011018 TCCCTGTGGCTGGGAGTGCTGGG + Intronic
1033223073 7:139541647-139541669 GCCCACTGGTTGGATGATCTGGG - Intronic
1033452332 7:141473000-141473022 TCCCTGTGTGTGGGTGTGCTGGG + Exonic
1033651324 7:143346055-143346077 TACCAGTTGGTGGATGTTCTGGG - Intronic
1034715732 7:153239542-153239564 TGCCTGTGGGAGGATGTTATTGG + Intergenic
1035473679 7:159127992-159128014 GCGCTGTGGATGTATGTTCTGGG - Intronic
1036495465 8:9266371-9266393 TCCCTGTGGCTGCAAATTCTAGG + Intergenic
1037722335 8:21455458-21455480 TCCCTGTTGTGGGATATCCTAGG + Intergenic
1038044885 8:23757877-23757899 TCCTTGAGGATGCATGTTCTTGG + Intergenic
1038046152 8:23767159-23767181 TCCCTGTGCTTGGAGTTTCCTGG + Intergenic
1038700192 8:29842707-29842729 TCCCTGTGATTGGAGATTCTGGG + Intergenic
1043943111 8:86218872-86218894 TCCCTGGGGGTAGATGTCCTTGG + Intronic
1045256021 8:100522820-100522842 GCCCTGTGGTTTTATGTTTTTGG - Intronic
1047193289 8:122698360-122698382 TCCCTGTTGTCTGGTGTTCTTGG - Intergenic
1056275728 9:84992378-84992400 TGCCAGAGGTTGGATGTTCTCGG + Intronic
1057959458 9:99440474-99440496 TTCCTGTGGTGTGATGTTGTTGG + Intergenic
1060252089 9:121994814-121994836 CCCAAGTGGTTGGATGGTCTGGG + Intronic
1186289787 X:8084025-8084047 TGCCTGTGGTGGGATTTTCTGGG - Intergenic
1186512359 X:10139291-10139313 TGACTGTGGTTGGTTCTTCTGGG + Intronic
1187476613 X:19616764-19616786 TTCCTGTGGCTGGCTTTTCTGGG + Intronic
1189955395 X:46272312-46272334 TCTCTGGGGTTGGATCTTTTGGG - Intergenic
1191090794 X:56618492-56618514 TCCCAGTGGCTGGATATTCAAGG + Intergenic
1191900959 X:66040198-66040220 TCCTTGGGGTTGGAGGTTCCAGG + Intergenic
1192246389 X:69375421-69375443 TCCCTGGGGTTTGCTGTTCTTGG - Intergenic
1192686491 X:73311544-73311566 TACCTGTGGTTTTATTTTCTAGG - Intergenic
1194916757 X:99717516-99717538 TCCCTGTGGGCTGAGGTTCTAGG + Intergenic
1195844877 X:109215773-109215795 TCCCTGTGGTTGACTCTACTTGG - Intergenic
1198287210 X:135202920-135202942 TTCCTGGGGCTGGATGTTGTAGG - Intergenic
1200287488 X:154837622-154837644 GCCCTGAGGATGGAGGTTCTGGG - Exonic
1200928912 Y:8679402-8679424 TCCCTGAGGTTGGGAGATCTTGG - Intergenic
1202180162 Y:22132971-22132993 TCCCTGAGGTTGGGAGTTTTAGG - Intergenic
1202211198 Y:22453428-22453450 TCCCTGAGGTTGGGAGTTTTAGG + Intergenic