ID: 1161105923

View in Genome Browser
Species Human (GRCh38)
Location 19:2444005-2444027
Sequence CACAGGGAAATGCCTACGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105916_1161105923 -2 Left 1161105916 19:2443984-2444006 CCGGCACCAAGAACATCCAACCA 0: 1
1: 0
2: 1
3: 10
4: 157
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105914_1161105923 0 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105910_1161105923 27 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105909_1161105923 28 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105911_1161105923 19 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105919_1161105923 -8 Left 1161105919 19:2443990-2444012 CCAAGAACATCCAACCACAGGGA 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105912_1161105923 18 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105915_1161105923 -1 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105923 Original CRISPR CACAGGGAAATGCCTACGAT GGG Intronic
901174468 1:7288889-7288911 TACAGAGAAATGCCTGAGATTGG + Intronic
904948960 1:34220583-34220605 CACATGGAAATGCCTGCCAAAGG + Intergenic
906806948 1:48788300-48788322 CACAGGGTAATGACAAGGATGGG + Intronic
911989360 1:104672899-104672921 CATAGAGAAATGCCCACTATAGG + Intergenic
916972674 1:170041540-170041562 CACAGGCAGATGCCTACGAGGGG - Intronic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1067549429 10:47223447-47223469 CCCTGGGAGATGCCTACCATAGG - Intergenic
1080386608 11:31814340-31814362 CACAGGGGAATGCCAGGGATCGG - Intronic
1082225018 11:49694851-49694873 CACAGTGAAATGCTTACTATAGG + Intergenic
1083610963 11:64004104-64004126 AGCAGGGAGATGCCTAAGATGGG - Intronic
1085487341 11:76876557-76876579 CATAGGTAAATGCTTAGGATTGG + Intronic
1085840620 11:80007866-80007888 GACAGGGAAATTCCTAGGGTGGG - Intergenic
1105280734 13:18961138-18961160 CAGAGGGAAGTGCCCAGGATGGG - Intergenic
1105291345 13:19055661-19055683 AACAGGGAAATGCCCAGGACAGG - Intergenic
1107688641 13:42929526-42929548 CAAAGGAAAATGCATACCATAGG - Intronic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1127372184 15:58351812-58351834 GCCAGGGAAATGCTTATGATAGG - Intronic
1131768873 15:95712827-95712849 CACAGGGAAATGGGGAGGATGGG - Intergenic
1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG + Intergenic
1137032711 16:35538992-35539014 GACAGGGAAATGGCTAAAATAGG + Intergenic
1138015156 16:53421286-53421308 CACAGGGAAATGCAGGCAATCGG - Intergenic
1141613142 16:85195070-85195092 CAGAGGTACATGCCTGCGATTGG - Intergenic
1141983926 16:87567297-87567319 CACAGGTAAAAGCCGACGAGGGG - Intergenic
1148979307 17:51558127-51558149 CACAGGGAATTGACTAGGGTTGG - Intergenic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1159026468 18:63187015-63187037 AACAGGGAAATGCTTAAGGTTGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
926641921 2:15246216-15246238 CACAGGCAAAGGCCTAAGAAAGG - Intronic
930613596 2:53570585-53570607 CATAGGTAAATACCTAGGATTGG + Intronic
933040338 2:77457166-77457188 CTCTGGGAAATGACTAGGATTGG - Intronic
934858945 2:97748184-97748206 CACAGGGCAATGGCTACATTAGG + Intergenic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
944139199 2:196436782-196436804 CACAGGGAAAGGGCTATGTTAGG - Intronic
944286588 2:197957035-197957057 CACAAGCAAATGCCTATGAAGGG - Intronic
946816696 2:223586004-223586026 CACTGTGCAATGCCTACGAATGG + Intergenic
1172950623 20:38721247-38721269 CACAAGAAAAAGCCTGCGATTGG - Intergenic
1173838429 20:46140394-46140416 CAGAGGGGAAAGCCTAGGATGGG + Intergenic
1174706919 20:52666353-52666375 CACAGTGAAATGATTACTATGGG + Intergenic
1182042014 22:27245455-27245477 CAATGGGAAATGCCTACTCTTGG + Intergenic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
955484041 3:59417893-59417915 CCCAGGGAAATGCAGACAATAGG + Intergenic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
964442169 3:156723243-156723265 CACTGGGAAAGGCCTACACTTGG + Intergenic
964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG + Intronic
966176991 3:177149141-177149163 CACCGGGAAATGGCTAGCATTGG - Intronic
969666665 4:8561262-8561284 CACAGGAAAGTGCCTAGGCTGGG + Intronic
969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG + Intronic
972969962 4:44561978-44562000 TACAGGGAAAGGCCTTTGATTGG - Intergenic
979879956 4:125942744-125942766 CACAGTGAAATGGCCAAGATTGG + Intergenic
983689257 4:170448293-170448315 CACAGAGAAATGGCTACGTGAGG - Intergenic
987685775 5:21198998-21199020 CACAAGGAAATACCTGGGATTGG + Intergenic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
1000223142 5:159233569-159233591 CACAGGTAAAGTCCCACGATAGG + Intergenic
1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG + Intergenic
1026012924 7:66650971-66650993 CACAGGGACATGCCGAGGCTCGG - Intronic
1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG + Intergenic
1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG + Intergenic
1040945610 8:52881725-52881747 AACAGGGAAATGCCCACAAGGGG + Intergenic
1043774177 8:84243894-84243916 CAAAGGGAAATGCCAAAGAGAGG - Intronic
1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG + Intronic
1049394837 8:142395159-142395181 CACAGGAAAATGCCCACAGTGGG - Intronic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1050541430 9:6673805-6673827 GAGAGGGAAATGCCTACAAAAGG - Intergenic
1059421346 9:114194429-114194451 CACCAGGAAAGGCCCACGATGGG + Exonic
1060009150 9:120028136-120028158 CAAAGGAAAATGCATACCATGGG + Intergenic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1199412225 X:147537422-147537444 AACAGGGAAGTACCTACGTTGGG - Intergenic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic