ID: 1161106568

View in Genome Browser
Species Human (GRCh38)
Location 19:2446491-2446513
Sequence GCCTCTGCACGCGCCAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161106561_1161106568 -9 Left 1161106561 19:2446477-2446499 CCGCCACCTGCCCGGCCTCTGCA 0: 1
1: 0
2: 4
3: 83
4: 639
Right 1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 249
1161106560_1161106568 -3 Left 1161106560 19:2446471-2446493 CCACAGCCGCCACCTGCCCGGCC 0: 1
1: 0
2: 5
3: 89
4: 893
Right 1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 249
1161106557_1161106568 16 Left 1161106557 19:2446452-2446474 CCTACTAATCCTGCTGCAACCAC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 249
1161106556_1161106568 27 Left 1161106556 19:2446441-2446463 CCTCTTCACTTCCTACTAATCCT No data
Right 1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 249
1161106558_1161106568 7 Left 1161106558 19:2446461-2446483 CCTGCTGCAACCACAGCCGCCAC 0: 1
1: 1
2: 1
3: 35
4: 331
Right 1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161106568 Original CRISPR GCCTCTGCACGCGCCAGCTG GGG Intronic
900487285 1:2929175-2929197 GCCCATCCACGGGCCAGCTGTGG - Intergenic
900960111 1:5913643-5913665 GCCTCTGCACTCGCCTGGAGGGG + Intronic
902772195 1:18651838-18651860 GCCTCTTCATGCACCTGCTGAGG + Intronic
903619388 1:24686876-24686898 GCCACTGCACACGCCAGCCTGGG - Intergenic
904049095 1:27627313-27627335 GCCTGTGCATGAGGCAGCTGAGG - Intronic
908975123 1:69888090-69888112 GCCTCTGTAGGCGCCACCTCTGG - Intronic
910969952 1:92845952-92845974 GCCACTGCACACTCCAGCTTGGG + Intronic
915565688 1:156711389-156711411 TCCCCTGCAGGCGCCAGCTCTGG + Intergenic
920394183 1:205631853-205631875 GCCCCCGCACGCGGCAGCGGCGG + Exonic
921368003 1:214393061-214393083 GCCCCAGCACGCTCCATCTGAGG + Intronic
921588576 1:216977576-216977598 GCCCCGGCACCTGCCAGCTGAGG - Intronic
923490387 1:234478809-234478831 CCCTCAGCACGCGCCGGCGGTGG + Exonic
923694029 1:236228758-236228780 TCCTCTCCACGCTCCAGATGAGG + Intronic
1064196390 10:13247224-13247246 ACCTCTCCAGGCGCCAGCTCAGG - Intergenic
1065230665 10:23595381-23595403 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1066366419 10:34781251-34781273 CCCTCTGCAGGAGGCAGCTGCGG + Intronic
1066664212 10:37766156-37766178 GCCTCTGTAGGCTCCACCTGTGG + Intergenic
1066786042 10:39005229-39005251 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1066981889 10:42424054-42424076 GCCACTGCACGCTCCAGCCTGGG + Intergenic
1067688273 10:48480973-48480995 GCCTCCCCACGGGCCCGCTGTGG - Intronic
1067835677 10:49639191-49639213 GCCACTGCACTCTCCAGCTTGGG + Intronic
1069676948 10:70255188-70255210 GCCTCTGCCCGCGCCCGTCGGGG - Exonic
1069901816 10:71710811-71710833 GCCACTCCATGGGCCAGCTGCGG - Intronic
1073667572 10:105550737-105550759 GCCTCTGTACGCTCCACCTCTGG + Intergenic
1074078802 10:110151849-110151871 ACCTCTGCCCACTCCAGCTGTGG + Intergenic
1077124992 11:929490-929512 GCCCCTTCAAGCGTCAGCTGAGG - Intronic
1077335197 11:2000332-2000354 GCCTGAGCCCGCCCCAGCTGGGG - Intergenic
1077406066 11:2383079-2383101 CCCTCTGGCCCCGCCAGCTGGGG - Intronic
1080245937 11:30178966-30178988 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1080579409 11:33630252-33630274 GCCTCTGCAGGCTCCACCTCTGG - Intronic
1080810945 11:35703301-35703323 GCCTCTGTAGGCTCCACCTGTGG + Intronic
1083524521 11:63349883-63349905 GCCTCTGCAGGCTCCACCTCTGG - Intronic
1083655914 11:64229603-64229625 GCCTCTGCAGGCCCCAGCCCTGG - Intronic
1084321064 11:68373623-68373645 GGCTCTGCACTCGACTGCTGGGG - Intronic
1084473537 11:69376532-69376554 GCCTCTGCAGGCCCTATCTGGGG + Intergenic
1085527913 11:77174769-77174791 ACCTGTGCGTGCGCCAGCTGCGG + Exonic
1088645521 11:111913496-111913518 GCCTCGGGCCGCCCCAGCTGGGG + Exonic
1090106223 11:123855457-123855479 GCATCTGCAGGAGGCAGCTGGGG - Intergenic
1090880271 11:130826667-130826689 GCCTCTCCACGTGGCAGCTCTGG - Intergenic
1091276960 11:134359190-134359212 GGCTGTGCACGCTCCCGCTGTGG + Intronic
1091348908 11:134877007-134877029 GCCAGTGCAAGGGCCAGCTGAGG - Intergenic
1091358322 11:134955305-134955327 GGCTCTGCAGGCTCCAGCAGAGG - Intergenic
1202818180 11_KI270721v1_random:55514-55536 GCCTGAGCCCGCCCCAGCTGGGG - Intergenic
1091623350 12:2105969-2105991 GCTTCAGGACGCCCCAGCTGAGG - Intronic
1091623369 12:2106023-2106045 GCTTCAGGACGCCCCAGCTGAGG - Intronic
1091623562 12:2106662-2106684 GCTTCAGGACGCCCCAGCTGAGG - Intronic
1091623643 12:2106928-2106950 GCTTCAGGACGCCCCAGCTGAGG - Intronic
1093781880 12:23146377-23146399 GCCTCTGTAGGCGCCACCTCTGG + Intergenic
1095591324 12:43907015-43907037 GCCTCTGTAGGCTCCACCTGTGG + Intronic
1095976185 12:47942463-47942485 TTCTCTGACCGCGCCAGCTGCGG + Intronic
1096154971 12:49336671-49336693 GCCTCTGCGGGCTCCAGCCGCGG + Exonic
1096959220 12:55560962-55560984 GCCTCTGTAGGCTCCACCTGTGG + Intergenic
1097321619 12:58232532-58232554 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1098430527 12:70414563-70414585 TCCTCTGCACTGGCCAGCTCAGG - Intronic
1100963095 12:99984826-99984848 CCCTCGGCACGCGCCCGCTGCGG - Intergenic
1101297080 12:103434920-103434942 GCCTCTGCAGGCTCCACCTCGGG + Intronic
1103465862 12:121141452-121141474 GCCACTGTACCGGCCAGCTGTGG - Intronic
1105006029 12:132721125-132721147 CCCTCAGCACGGGTCAGCTGTGG - Exonic
1105645354 13:22312143-22312165 GCCTCTCCCAGTGCCAGCTGAGG - Intergenic
1110232789 13:73183903-73183925 GCCACTGCACCCGGCAGATGTGG + Intergenic
1113368392 13:109699942-109699964 AGCGCTGCACGCGCCTGCTGGGG - Intergenic
1114945309 14:27673592-27673614 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1121311108 14:92935558-92935580 GCCTCTGCATGGCCCAGCTCAGG - Intergenic
1122530339 14:102420929-102420951 GCATCTGGAAGCGCCATCTGAGG - Intronic
1122973428 14:105161564-105161586 GCCTCACCGCCCGCCAGCTGGGG + Intronic
1202883307 14_KI270722v1_random:81984-82006 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1202893705 14_KI270722v1_random:183464-183486 GCCTCTGCTCCCACCAACTGTGG - Intergenic
1125228775 15:37427683-37427705 GCCTCTGTAGGCTCCACCTGTGG + Intergenic
1127545767 15:59993482-59993504 GCCGCAGCCCGCGCAAGCTGAGG - Intergenic
1128416744 15:67453816-67453838 GCCTCTGTAGGCGCCACCTCTGG - Intronic
1129050866 15:72780734-72780756 GCCACTGCACACGCCAGCCTGGG + Intronic
1129106239 15:73309265-73309287 GCCTTTGCACTGGCCTGCTGGGG - Intergenic
1129932709 15:79425700-79425722 GCCTCTTCATTCGACAGCTGAGG + Intronic
1130056223 15:80528204-80528226 GCGTCCCCACCCGCCAGCTGTGG - Intronic
1132332498 15:101022520-101022542 GCCTCTCCATGCACCACCTGGGG - Exonic
1132806453 16:1777298-1777320 GCCACCGCCTGCGCCAGCTGCGG - Exonic
1132875472 16:2135228-2135250 GGCTCTGCAGACGCCAGCGGGGG - Intronic
1135268365 16:21048148-21048170 GCCTCTGCAGGCTCCACCTCTGG - Intronic
1138530676 16:57632690-57632712 GCCTGCGCAGGCGCCAGCTCGGG - Intronic
1139467958 16:67164278-67164300 GCCTCTGGACGACACAGCTGCGG + Intronic
1139563061 16:67756005-67756027 GCATCTGCACTGGCCACCTGGGG - Intronic
1142105951 16:88302868-88302890 CCCTCTGCCCTGGCCAGCTGTGG + Intergenic
1143920542 17:10328011-10328033 GCCTCTGCACTCTTCAGCAGGGG + Exonic
1145955991 17:28855043-28855065 GCCTAGCCCCGCGCCAGCTGGGG - Exonic
1147025964 17:37583733-37583755 GCCACTGCCCGCTCCAGCTTAGG - Intronic
1148147338 17:45374015-45374037 GCCTCTGCCTGCGCAAGCTGGGG + Intergenic
1149059837 17:52409311-52409333 GCCTCTGTACGCTCCACCTCTGG - Intergenic
1149567286 17:57649090-57649112 GCCTCTGGCAGCCCCAGCTGGGG + Intronic
1149600292 17:57889083-57889105 GCCTCCGCACTCCCCAGCTGTGG + Intronic
1150254733 17:63735112-63735134 GCCATTGCACACGCCAGCTTGGG + Intronic
1151724860 17:75877988-75878010 GCCTGTGCCCGCGCCACCTACGG - Exonic
1152508883 17:80771860-80771882 GCCTCGCTACGCACCAGCTGGGG - Intronic
1152652196 17:81499843-81499865 GCCAATGCATGCCCCAGCTGTGG - Intergenic
1155460728 18:26079621-26079643 GCCACTGCACGCTCCAGCCTGGG - Intronic
1158102228 18:53842208-53842230 GCCTCTGCACTCTCCAGCTTGGG + Intergenic
1159376882 18:67604164-67604186 GCCTCTGTACGCTCCACCTCTGG + Intergenic
1159466508 18:68790302-68790324 GCCTCTGTACGCTCCACCTCTGG - Intronic
1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG + Intronic
1161327306 19:3670043-3670065 GCCTCTGCAGGCGGCAGGTGGGG + Intronic
1161327336 19:3670126-3670148 GCCTCTGCAGGCGGCAGGTGGGG + Intronic
1161999267 19:7732552-7732574 GCCTCTGCAGGCACCTGCAGGGG - Intronic
1162540140 19:11290668-11290690 GCCACTGCACACGCCAGCCTCGG - Intergenic
1162767344 19:12927979-12928001 GCCACTGCACACTCCAGCTTGGG + Intronic
1163292285 19:16386745-16386767 GCCTCTGCACACGCAAGCCTGGG + Intronic
1163710574 19:18844362-18844384 GCCACTGCACGCTCCACCTTGGG - Intronic
1164703843 19:30304805-30304827 GCCGCTGCAGGCACCATCTGGGG + Intronic
1165549599 19:36573149-36573171 GCCTCTGTACGCGGGAGCTGCGG - Exonic
1165942687 19:39423145-39423167 GCCTCTGCAGGAACCAGCTGAGG + Exonic
1166176463 19:41075213-41075235 GCCACTGCACACTCCAGCTTGGG - Intergenic
1166560675 19:43730602-43730624 GCCACTGCACTCTCCAGCTTGGG - Exonic
1166646842 19:44538587-44538609 GCCTCTGCCTCCCCCAGCTGTGG + Intergenic
1166687474 19:44804204-44804226 GTCTCTGCACTGGCCAGCTTGGG + Intergenic
1166869729 19:45864149-45864171 GCCCCAGGACGCGACAGCTGGGG - Intronic
1168437953 19:56337175-56337197 GCCTCTGTAGGCTCCACCTGTGG - Intronic
1202653415 1_KI270707v1_random:26618-26640 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1202658719 1_KI270708v1_random:49128-49150 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
925199517 2:1955098-1955120 GCCACTGCACACTCCAGCTTGGG + Intronic
925431634 2:3799840-3799862 GCCTCTGCAGGCTCCACCTCTGG - Intronic
928381667 2:30823473-30823495 ACCTCTGCAGGCGTCATCTGTGG - Intergenic
934685940 2:96321796-96321818 GCCTGTGCACGCGCCTGCGGAGG - Intergenic
936845933 2:116833210-116833232 GCCTCTGCAACTGGCAGCTGGGG + Intergenic
941564271 2:167087414-167087436 GCCTCTGTAGGCTCCACCTGTGG - Intronic
945162641 2:206908556-206908578 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
946129782 2:217597765-217597787 ACCACTGCACGTGCCAGCTGTGG - Intronic
946782531 2:223205882-223205904 GCCTGTGCAGGCACCAGCAGTGG - Intergenic
947832511 2:233151563-233151585 GACTCTGCAGGCCCCAGCTCGGG + Intronic
948664098 2:239523798-239523820 GCGTCTGCACCCACCACCTGGGG - Intergenic
948686818 2:239675257-239675279 GCCTCCCCAGGCCCCAGCTGTGG - Intergenic
1172525670 20:35599598-35599620 TGCTCTGCAGGCGCCAGGTGTGG + Intergenic
1175256739 20:57652407-57652429 GCCCCTGCACCCTCCAGCTTCGG - Exonic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1176598747 21:8773037-8773059 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1176644666 21:9339313-9339335 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1178320393 21:31600734-31600756 GCCTCTGGAGGAGCCAGCTTGGG + Intergenic
1179795238 21:43778701-43778723 GGCTCTGCCCCCGCCTGCTGAGG - Intergenic
1180326187 22:11432647-11432669 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1180419694 22:12801869-12801891 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1181944783 22:26508065-26508087 GCCACTGCACACTCCAGCTTGGG + Intronic
1182345505 22:29661162-29661184 GCTACTGTAAGCGCCAGCTGAGG - Intronic
1182584660 22:31337492-31337514 GCCTTTGTAAGCTCCAGCTGAGG - Intronic
1183191966 22:36327364-36327386 GACTCTGCAAGCCCCAGTTGTGG + Intronic
1183442855 22:37833079-37833101 GCCCCTGCAGGTACCAGCTGAGG + Exonic
1183598824 22:38828344-38828366 GCCTCTGCCGGCGGCTGCTGTGG + Exonic
1183898785 22:40990063-40990085 GCCACTGCACGCACCAGCCTGGG + Intergenic
1184200035 22:42962409-42962431 GGCTCTCCTTGCGCCAGCTGTGG - Intronic
1184240210 22:43207849-43207871 GCCTCTGCAGGCTTCAGCTGAGG - Intronic
1185322038 22:50205920-50205942 GCCCCGGTACGGGCCAGCTGAGG - Intronic
950502492 3:13373182-13373204 GCCTCTGCCAGCCCCACCTGTGG - Intronic
950671000 3:14525392-14525414 GCCTCTGCACCCCCCTCCTGCGG + Intronic
953679964 3:45031599-45031621 GGCTCTGCACTAGCCAGCTGAGG + Intronic
955030259 3:55209665-55209687 GCCTCTGTACGCTCCACCTCTGG + Intergenic
961444613 3:126973309-126973331 GCCTGTGCAAGTCCCAGCTGAGG + Intergenic
963790926 3:149581800-149581822 GCCTCTGCCCTGGCCAGCTGTGG + Intronic
964765176 3:160172551-160172573 CCCTCTGCATGCGTCAGCTTAGG + Intergenic
967361489 3:188636575-188636597 GCCTCTGTAGGCTCCAGCTCTGG + Intronic
967890987 3:194364575-194364597 GAGTCTGCACTCCCCAGCTGGGG + Intronic
968084158 3:195867186-195867208 CCCTCTGCACGCTCCAGCCGTGG + Intronic
968334713 3:197903354-197903376 GCTTCTGCACAGGCCAGGTGTGG + Intronic
1202742224 3_GL000221v1_random:65755-65777 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
968833191 4:2943901-2943923 GCGTGTGCACGCGCCACATGGGG - Intronic
969637591 4:8378280-8378302 GCCCCGGCACGGGCGAGCTGGGG + Intronic
969697237 4:8741708-8741730 CCCTCTGCAGGCTCCAGCGGGGG - Intergenic
969714009 4:8859868-8859890 GCCACTGCCCGCGCCTGCTCTGG - Intronic
970623278 4:17849074-17849096 GCCTCTGCAGGCTCCACCTCTGG + Intronic
973124563 4:46567647-46567669 GCCTCTGTACGCTCCACCTCTGG + Intergenic
973362084 4:49175404-49175426 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
973399010 4:49621455-49621477 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
973984428 4:56336831-56336853 GCCTCTGTAGGCGCCACCTCTGG - Intergenic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
976179680 4:82387237-82387259 GCCACTGCACTCGCCAGCCTGGG - Intergenic
977292190 4:95176714-95176736 GCCTCTGCAGGCTCCACCTCTGG - Intronic
977333270 4:95664235-95664257 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
977932291 4:102761682-102761704 TCCTCTGCACTCACTAGCTGTGG + Intergenic
979561958 4:122110627-122110649 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
980974911 4:139601220-139601242 CCCTCTGCACGCCCAAGCAGCGG - Intronic
982342118 4:154311273-154311295 GCCTCTGCACACTCCAGCCTGGG - Intronic
985904643 5:2823729-2823751 GCCACTGCACGGGGCTGCTGTGG - Intergenic
986359853 5:6966808-6966830 GCCTCTGTAGGCTCCAGCTCTGG + Intergenic
987709393 5:21489501-21489523 GCCACTGCACTCTCCAGCTTAGG - Intergenic
988750219 5:34184671-34184693 GCCACTGCACTCTCCAGCTTAGG + Intergenic
989068466 5:37486382-37486404 GCCACTGCACTCTCCAGCTTAGG - Intronic
989442902 5:41493531-41493553 GCCTCTGCAGGCTCCACCTCTGG - Intronic
990135666 5:52641884-52641906 GCCTCTGTACGCTCCACCTCTGG + Intergenic
990149412 5:52800005-52800027 GCCTGCGCACGCGCGAACTGCGG + Exonic
990179208 5:53141600-53141622 GCCTCTGCAGGCGCCACCTCTGG + Intergenic
992019938 5:72612598-72612620 GCCACTGCAGGCCCAAGCTGTGG - Intergenic
992753901 5:79886404-79886426 GACTCTGCACTCCCCAGCTGTGG - Intergenic
993006577 5:82434868-82434890 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
993867623 5:93213676-93213698 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
994421516 5:99530816-99530838 GCCACTGCACTCTCCAGCTTAGG - Intergenic
994461324 5:100069737-100069759 GCCACTGCACTCTCCAGCTTAGG + Intergenic
994485529 5:100383488-100383510 GCCACTGCACTCTCCAGCTTAGG + Intergenic
996500779 5:124213704-124213726 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
999692463 5:154160350-154160372 GCGGCTGCACCCGCCAGCAGTGG + Intronic
1001478007 5:172064685-172064707 GCCCCTGCGCTCCCCAGCTGAGG + Intronic
1001702671 5:173718656-173718678 GCCTCTGCCCTCCACAGCTGTGG - Intergenic
1005605463 6:27472884-27472906 GCCTCTGCAGGAGAAAGCTGGGG - Intronic
1005986801 6:30880983-30881005 GCAGCTGCCCGGGCCAGCTGCGG - Intronic
1006211819 6:32401726-32401748 GCCTCTGCCCTCCCCAGCAGAGG - Intronic
1008777663 6:55061353-55061375 GCATCTGCACATGCCATCTGGGG - Intergenic
1010526432 6:76905674-76905696 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1010679632 6:78783662-78783684 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1016667356 6:146657596-146657618 GCCTCTGCACTCTCATGCTGAGG + Intronic
1016870957 6:148816085-148816107 GCCTCAGGATGGGCCAGCTGGGG + Intronic
1018099849 6:160427538-160427560 ACCTGTCCACTCGCCAGCTGAGG - Intronic
1019447223 7:1077580-1077602 GCCTGTGCACGGGGCACCTGAGG - Intronic
1022586722 7:31620151-31620173 GCCTCTGCAGGCTCCACCTCTGG + Intronic
1022873785 7:34506833-34506855 GCCCCACCACGCGTCAGCTGTGG - Intergenic
1023888646 7:44377542-44377564 GCCTCTGCTCCAGTCAGCTGTGG + Intergenic
1025658241 7:63539752-63539774 GCCTCTGTAGGCGCCACCTCTGG - Intergenic
1028119378 7:87040290-87040312 GCCTCTGCAGGCTCCACCTCTGG + Intronic
1032086652 7:128887209-128887231 CCCTCTGCACCTGCCAGGTGAGG - Exonic
1033107069 7:138536807-138536829 GCCTCTGCAGACGCCACCTCTGG - Intronic
1034980007 7:155469696-155469718 GCCTCTGCACCCCCCAGCAGTGG + Intergenic
1034989052 7:155536096-155536118 GCCTCTGACCCCGCCAGGTGAGG - Intergenic
1035199189 7:157249277-157249299 GTCTCTGCATGGGCCTGCTGTGG + Intronic
1035453590 7:158995443-158995465 GCCTCTTCCCGCACCTGCTGCGG - Intergenic
1037618531 8:20543063-20543085 GCCTCTGGGCGCCCCAGCTGGGG - Intergenic
1040940183 8:52825045-52825067 GCCACTGCATGCTCCAGCTTGGG - Intergenic
1046903282 8:119545346-119545368 GCCACTGCACACGCCAGCCTGGG - Intergenic
1047070129 8:121334263-121334285 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1047347281 8:124040426-124040448 GACTTTGCACTCACCAGCTGGGG + Intronic
1048125946 8:131635700-131635722 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1048594563 8:135852991-135853013 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1049002834 8:139837228-139837250 GCCGCTGTTCACGCCAGCTGGGG + Intronic
1049912620 9:284302-284324 GCCTGTGCAGGAGCCAGATGAGG - Intronic
1052513469 9:29450926-29450948 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1052858345 9:33421205-33421227 GCCACTGCACTCTCCAGCTTGGG + Intergenic
1053038782 9:34851198-34851220 GCCTCTGCAGGCACCACCTCTGG - Intergenic
1055443391 9:76358601-76358623 GCTTCTGCTCGGGGCAGCTGTGG + Exonic
1058910617 9:109517106-109517128 GCCTCTGCAAGCACCAGCTATGG - Intergenic
1060895292 9:127213062-127213084 GCAGCTGCAGGCGCCAGCTCTGG - Intronic
1061328133 9:129876276-129876298 GCCTCTGCCTGGGGCAGCTGGGG + Intronic
1061449253 9:130659775-130659797 GCCTTTGTACGCGCCGGCGGGGG + Intergenic
1062491700 9:136808069-136808091 GCCTCTGGCCGCGCCGGCTCCGG + Exonic
1203691215 Un_GL000214v1:45095-45117 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1203490754 Un_GL000224v1:102658-102680 GCCTCTGCTCCCACCAACTGTGG - Intergenic
1203503378 Un_KI270741v1:44536-44558 GCCTCTGCTCCCACCAACTGTGG - Intergenic
1203710854 Un_KI270742v1:95679-95701 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1203645080 Un_KI270751v1:59096-59118 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1186968051 X:14809724-14809746 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1189309413 X:40009263-40009285 GCCTGTGCACGAGCCAGTGGCGG - Intergenic
1190921701 X:54859527-54859549 GCCTCTGTAGGCTCCACCTGTGG - Intergenic
1192942324 X:75925550-75925572 GCCTCTGTAGGCTCCACCTGTGG + Intergenic
1192955852 X:76069336-76069358 GCCTCTGTAGGCTCCACCTGTGG + Intergenic
1193017853 X:76756109-76756131 GCCTCTGTAGGCTCCAGCTCTGG + Intergenic
1193025443 X:76841172-76841194 GCCTCTGTAGGCTCCGGCTGTGG + Intergenic
1193029557 X:76882741-76882763 GCCTCTGCAGGCTCCATCTCTGG + Intergenic
1196511752 X:116520082-116520104 GCCTCTGCAGGCTCCACCTCTGG - Intergenic
1196638516 X:118032260-118032282 GCCTCTGCAGGCTCCACCTCTGG + Intronic
1197709362 X:129654714-129654736 GCGCCCGCACGCGCCAGCCGCGG - Exonic
1200136041 X:153875339-153875361 GCCTTTGCACAAGCCAGCTGAGG + Intronic
1200288508 X:154848379-154848401 GCCTCTGTACGCTCCACCTTTGG - Intronic
1201779866 Y:17708889-17708911 GCCTCTGTACGCTCCACCTCTGG + Intergenic
1201795794 Y:17895111-17895133 GCCTCTGCAGGCTCCACCTCCGG + Intergenic
1201805761 Y:18010874-18010896 GCCTCTGCAGGCTCCACCTCCGG - Intergenic
1201821689 Y:18197103-18197125 GCCTCTGTACGCTCCACCTCTGG - Intergenic
1201962796 Y:19700453-19700475 GCCTGTCCACGTGCCAGGTGAGG + Intergenic
1201991442 Y:20031477-20031499 GCCTCTGCAGGCTCCACCTCTGG + Intergenic
1202055563 Y:20826466-20826488 GCCTCTGTAGGCTCCAGCTCTGG - Intergenic