ID: 1161111970

View in Genome Browser
Species Human (GRCh38)
Location 19:2475720-2475742
Sequence CAAGTTCTGCTGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161111970_1161111981 -6 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111981 19:2475737-2475759 AACTTGGGAAAGGCGCGGTCCGG No data
1161111970_1161111987 15 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111987 19:2475758-2475780 GGGACTCTCCGCGGATCGGGAGG No data
1161111970_1161111985 12 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111985 19:2475755-2475777 TCCGGGACTCTCCGCGGATCGGG No data
1161111970_1161111991 25 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111991 19:2475768-2475790 GCGGATCGGGAGGGGATTCCAGG No data
1161111970_1161111989 17 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111989 19:2475760-2475782 GACTCTCCGCGGATCGGGAGGGG No data
1161111970_1161111983 6 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111983 19:2475749-2475771 GCGCGGTCCGGGACTCTCCGCGG No data
1161111970_1161111984 11 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111984 19:2475754-2475776 GTCCGGGACTCTCCGCGGATCGG No data
1161111970_1161111988 16 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111988 19:2475759-2475781 GGACTCTCCGCGGATCGGGAGGG No data
1161111970_1161111982 -5 Left 1161111970 19:2475720-2475742 CCCTCCACCCCCAGCAGAACTTG No data
Right 1161111982 19:2475738-2475760 ACTTGGGAAAGGCGCGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161111970 Original CRISPR CAAGTTCTGCTGGGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr