ID: 1161114180

View in Genome Browser
Species Human (GRCh38)
Location 19:2487847-2487869
Sequence TCTGAGGGCTGGGCTCTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114180_1161114190 11 Left 1161114180 19:2487847-2487869 CCGCCAAGAGCCCAGCCCTCAGA No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114180_1161114192 17 Left 1161114180 19:2487847-2487869 CCGCCAAGAGCCCAGCCCTCAGA No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114180 Original CRISPR TCTGAGGGCTGGGCTCTTGG CGG (reversed) Intergenic
No off target data available for this crispr