ID: 1161114182

View in Genome Browser
Species Human (GRCh38)
Location 19:2487857-2487879
Sequence GTTCTGGGGCTCTGAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114182_1161114190 1 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114182_1161114197 30 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114182_1161114192 7 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114182 Original CRISPR GTTCTGGGGCTCTGAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr