ID: 1161114185

View in Genome Browser
Species Human (GRCh38)
Location 19:2487863-2487885
Sequence CAGGGAGTTCTGGGGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114185_1161114202 30 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114185_1161114192 1 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114185_1161114197 24 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114185_1161114190 -5 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114185_1161114201 29 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114185_1161114200 28 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114185 Original CRISPR CAGGGAGTTCTGGGGCTCTG AGG (reversed) Intergenic