ID: 1161114186

View in Genome Browser
Species Human (GRCh38)
Location 19:2487871-2487893
Sequence GGAAGCTGCAGGGAGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114186_1161114202 22 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114186_1161114201 21 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114186_1161114200 20 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data
1161114186_1161114192 -7 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114186_1161114197 16 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114186 Original CRISPR GGAAGCTGCAGGGAGTTCTG GGG (reversed) Intergenic
No off target data available for this crispr