ID: 1161114187

View in Genome Browser
Species Human (GRCh38)
Location 19:2487872-2487894
Sequence GGGAAGCTGCAGGGAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114187_1161114192 -8 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114187_1161114202 21 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114187_1161114201 20 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114187_1161114197 15 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114187_1161114200 19 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114187 Original CRISPR GGGAAGCTGCAGGGAGTTCT GGG (reversed) Intergenic
No off target data available for this crispr