ID: 1161114189

View in Genome Browser
Species Human (GRCh38)
Location 19:2487881-2487903
Sequence CCTAGAGCTGGGAAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114189_1161114200 10 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data
1161114189_1161114206 28 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114206 19:2487932-2487954 GTCGGGGCAGTGCCCAGCCAGGG No data
1161114189_1161114201 11 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114189_1161114202 12 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114189_1161114197 6 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114189_1161114205 27 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114205 19:2487931-2487953 GGTCGGGGCAGTGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114189 Original CRISPR CCTAGAGCTGGGAAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr