ID: 1161114190

View in Genome Browser
Species Human (GRCh38)
Location 19:2487881-2487903
Sequence CCCTGCAGCTTCCCAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114181_1161114190 8 Left 1161114181 19:2487850-2487872 CCAAGAGCCCAGCCCTCAGAGCC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114184_1161114190 -4 Left 1161114184 19:2487862-2487884 CCCTCAGAGCCCCAGAACTCCCT No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114185_1161114190 -5 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114179_1161114190 14 Left 1161114179 19:2487844-2487866 CCACCGCCAAGAGCCCAGCCCTC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114180_1161114190 11 Left 1161114180 19:2487847-2487869 CCGCCAAGAGCCCAGCCCTCAGA No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114178_1161114190 29 Left 1161114178 19:2487829-2487851 CCTTCTCTCTGCAGACCACCGCC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114177_1161114190 30 Left 1161114177 19:2487828-2487850 CCCTTCTCTCTGCAGACCACCGC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114182_1161114190 1 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
1161114183_1161114190 0 Left 1161114183 19:2487858-2487880 CCAGCCCTCAGAGCCCCAGAACT No data
Right 1161114190 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114190 Original CRISPR CCCTGCAGCTTCCCAGCTCT AGG Intergenic
No off target data available for this crispr