ID: 1161114191

View in Genome Browser
Species Human (GRCh38)
Location 19:2487882-2487904
Sequence GCCTAGAGCTGGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114191_1161114201 10 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114191_1161114202 11 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114191_1161114205 26 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114205 19:2487931-2487953 GGTCGGGGCAGTGCCCAGCCAGG No data
1161114191_1161114206 27 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114206 19:2487932-2487954 GTCGGGGCAGTGCCCAGCCAGGG No data
1161114191_1161114197 5 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114191_1161114200 9 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114191 Original CRISPR GCCTAGAGCTGGGAAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr