ID: 1161114192

View in Genome Browser
Species Human (GRCh38)
Location 19:2487887-2487909
Sequence AGCTTCCCAGCTCTAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114188_1161114192 -9 Left 1161114188 19:2487873-2487895 CCAGAACTCCCTGCAGCTTCCCA No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114179_1161114192 20 Left 1161114179 19:2487844-2487866 CCACCGCCAAGAGCCCAGCCCTC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114184_1161114192 2 Left 1161114184 19:2487862-2487884 CCCTCAGAGCCCCAGAACTCCCT No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114187_1161114192 -8 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114180_1161114192 17 Left 1161114180 19:2487847-2487869 CCGCCAAGAGCCCAGCCCTCAGA No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114181_1161114192 14 Left 1161114181 19:2487850-2487872 CCAAGAGCCCAGCCCTCAGAGCC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114182_1161114192 7 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114186_1161114192 -7 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114185_1161114192 1 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data
1161114183_1161114192 6 Left 1161114183 19:2487858-2487880 CCAGCCCTCAGAGCCCCAGAACT No data
Right 1161114192 19:2487887-2487909 AGCTTCCCAGCTCTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114192 Original CRISPR AGCTTCCCAGCTCTAGGCCT TGG Intergenic
No off target data available for this crispr