ID: 1161114193

View in Genome Browser
Species Human (GRCh38)
Location 19:2487892-2487914
Sequence AGGGGCCAAGGCCTAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114193_1161114200 -1 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114200 19:2487914-2487936 TGTGATCTCCACCTCGTGGTCGG No data
1161114193_1161114201 0 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG No data
1161114193_1161114197 -5 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114193_1161114209 25 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114209 19:2487940-2487962 AGTGCCCAGCCAGGGCTCCGGGG No data
1161114193_1161114208 24 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114208 19:2487939-2487961 CAGTGCCCAGCCAGGGCTCCGGG No data
1161114193_1161114210 28 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114210 19:2487943-2487965 GCCCAGCCAGGGCTCCGGGGAGG No data
1161114193_1161114202 1 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114202 19:2487916-2487938 TGATCTCCACCTCGTGGTCGGGG No data
1161114193_1161114206 17 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114206 19:2487932-2487954 GTCGGGGCAGTGCCCAGCCAGGG No data
1161114193_1161114207 23 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114207 19:2487938-2487960 GCAGTGCCCAGCCAGGGCTCCGG No data
1161114193_1161114205 16 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114205 19:2487931-2487953 GGTCGGGGCAGTGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114193 Original CRISPR AGGGGCCAAGGCCTAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr