ID: 1161114197

View in Genome Browser
Species Human (GRCh38)
Location 19:2487910-2487932
Sequence CCCCTGTGATCTCCACCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161114193_1161114197 -5 Left 1161114193 19:2487892-2487914 CCCAGCTCTAGGCCTTGGCCCCT No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114183_1161114197 29 Left 1161114183 19:2487858-2487880 CCAGCCCTCAGAGCCCCAGAACT No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114182_1161114197 30 Left 1161114182 19:2487857-2487879 CCCAGCCCTCAGAGCCCCAGAAC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114184_1161114197 25 Left 1161114184 19:2487862-2487884 CCCTCAGAGCCCCAGAACTCCCT No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114188_1161114197 14 Left 1161114188 19:2487873-2487895 CCAGAACTCCCTGCAGCTTCCCA No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114194_1161114197 -6 Left 1161114194 19:2487893-2487915 CCAGCTCTAGGCCTTGGCCCCTG No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114186_1161114197 16 Left 1161114186 19:2487871-2487893 CCCCAGAACTCCCTGCAGCTTCC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114187_1161114197 15 Left 1161114187 19:2487872-2487894 CCCAGAACTCCCTGCAGCTTCCC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114185_1161114197 24 Left 1161114185 19:2487863-2487885 CCTCAGAGCCCCAGAACTCCCTG No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114189_1161114197 6 Left 1161114189 19:2487881-2487903 CCCTGCAGCTTCCCAGCTCTAGG No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data
1161114191_1161114197 5 Left 1161114191 19:2487882-2487904 CCTGCAGCTTCCCAGCTCTAGGC No data
Right 1161114197 19:2487910-2487932 CCCCTGTGATCTCCACCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161114197 Original CRISPR CCCCTGTGATCTCCACCTCG TGG Intergenic
No off target data available for this crispr