ID: 1161116575

View in Genome Browser
Species Human (GRCh38)
Location 19:2500373-2500395
Sequence GCGTACGCCAAGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161116575_1161116582 25 Left 1161116575 19:2500373-2500395 CCCTGGCCTGTCTTGGCGTACGC No data
Right 1161116582 19:2500421-2500443 AGATGTTTCTTTCTCAACCTTGG No data
1161116575_1161116579 0 Left 1161116575 19:2500373-2500395 CCCTGGCCTGTCTTGGCGTACGC No data
Right 1161116579 19:2500396-2500418 TGGCAGTCTGCGTTCTGAACAGG No data
1161116575_1161116581 2 Left 1161116575 19:2500373-2500395 CCCTGGCCTGTCTTGGCGTACGC No data
Right 1161116581 19:2500398-2500420 GCAGTCTGCGTTCTGAACAGGGG No data
1161116575_1161116583 30 Left 1161116575 19:2500373-2500395 CCCTGGCCTGTCTTGGCGTACGC No data
Right 1161116583 19:2500426-2500448 TTTCTTTCTCAACCTTGGCTTGG No data
1161116575_1161116580 1 Left 1161116575 19:2500373-2500395 CCCTGGCCTGTCTTGGCGTACGC No data
Right 1161116580 19:2500397-2500419 GGCAGTCTGCGTTCTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161116575 Original CRISPR GCGTACGCCAAGACAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr