ID: 1161116824

View in Genome Browser
Species Human (GRCh38)
Location 19:2501870-2501892
Sequence GAGCGCAGACTGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161116824_1161116829 -9 Left 1161116824 19:2501870-2501892 CCTCCCTCCATCAGTCTGCGCTC No data
Right 1161116829 19:2501884-2501906 TCTGCGCTCTGTGGCATCTGTGG No data
1161116824_1161116830 -4 Left 1161116824 19:2501870-2501892 CCTCCCTCCATCAGTCTGCGCTC No data
Right 1161116830 19:2501889-2501911 GCTCTGTGGCATCTGTGGCGTGG No data
1161116824_1161116831 18 Left 1161116824 19:2501870-2501892 CCTCCCTCCATCAGTCTGCGCTC No data
Right 1161116831 19:2501911-2501933 GACCCTTCTTTGCTTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161116824 Original CRISPR GAGCGCAGACTGATGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr