ID: 1161123070

View in Genome Browser
Species Human (GRCh38)
Location 19:2540737-2540759
Sequence TTGCTCCGGCAGGTCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161123070_1161123080 24 Left 1161123070 19:2540737-2540759 CCCGGGGAGACCTGCCGGAGCAA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1161123080 19:2540784-2540806 GATGCCACGGCCACTCTTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 85
1161123070_1161123074 -4 Left 1161123070 19:2540737-2540759 CCCGGGGAGACCTGCCGGAGCAA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1161123074 19:2540756-2540778 GCAAACCCAGCTCCTTTTTTAGG 0: 1
1: 0
2: 0
3: 18
4: 254
1161123070_1161123079 21 Left 1161123070 19:2540737-2540759 CCCGGGGAGACCTGCCGGAGCAA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1161123079 19:2540781-2540803 TGTGATGCCACGGCCACTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 90
1161123070_1161123078 11 Left 1161123070 19:2540737-2540759 CCCGGGGAGACCTGCCGGAGCAA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1161123078 19:2540771-2540793 TTTTTAGGTCTGTGATGCCACGG 0: 1
1: 0
2: 0
3: 15
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161123070 Original CRISPR TTGCTCCGGCAGGTCTCCCC GGG (reversed) Intronic
900246146 1:1637033-1637055 GGGCCCCGGCAGGTCTCCCTGGG + Intronic
901669887 1:10849982-10850004 TTGCCCCAGCAGGACACCCCAGG + Intergenic
902098272 1:13964589-13964611 ATGCTCCAGCAGGCCACCCCAGG + Intergenic
904355559 1:29936767-29936789 TTCCTGGGGCAGGTCTGCCCAGG - Intergenic
904554249 1:31347815-31347837 TTGCCCAGGCTGGTCTCCCTGGG + Intronic
904773127 1:32892158-32892180 CTCCTCCATCAGGTCTCCCCTGG - Intronic
904981095 1:34502470-34502492 TTGCATCTGCAAGTCTCCCCAGG - Intergenic
918359127 1:183737538-183737560 TTGCCCAGGCTGGTCTCACCTGG - Intronic
920060448 1:203223521-203223543 TGTCTACGGCAGGGCTCCCCTGG + Exonic
920373209 1:205492521-205492543 TTGCTCCAGGAGCTCTCCCGTGG - Intergenic
923458617 1:234187800-234187822 TTCCTCTGGCAGCCCTCCCCAGG - Intronic
1063138104 10:3234728-3234750 CTTCACCGGCAGGTCACCCCTGG + Intergenic
1066747505 10:38615870-38615892 TTGTTCCCTAAGGTCTCCCCAGG - Intergenic
1073252982 10:102133333-102133355 TTGCTCCGGCCCGGCTCCCGCGG - Intronic
1074543600 10:114385775-114385797 TTGCTCAGGGAGATGTCCCCTGG - Intronic
1084492360 11:69485825-69485847 GTGCTCCGCCAGGGCTCCCGTGG + Intergenic
1084554353 11:69867038-69867060 TTCTTCCCACAGGTCTCCCCAGG + Intergenic
1088810161 11:113386956-113386978 TTGAACAGACAGGTCTCCCCAGG - Intergenic
1089684368 11:120137577-120137599 CTGTTCCGCCGGGTCTCCCCGGG + Exonic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1101967571 12:109291810-109291832 TTGGTCCGGCTGCTGTCCCCCGG + Intronic
1103706057 12:122873358-122873380 TTTCTCCTGCTGGTCTCACCTGG + Intronic
1104986877 12:132602453-132602475 CTGCCCCTGCAGGTCTCTCCTGG + Intergenic
1105702766 13:22945480-22945502 TTGCACAAGAAGGTCTCCCCAGG - Intergenic
1105855404 13:24367283-24367305 TTGCACAAGAAGGTCTCCCCAGG - Intergenic
1112652533 13:101415775-101415797 TGGCTCCAGCAGGTCTCCGCGGG - Intronic
1114031287 14:18583228-18583250 TTGTTCCCTAAGGTCTCCCCAGG - Intergenic
1120115300 14:80609530-80609552 TTGCTTCATCAGGTCTCCCTTGG + Intronic
1123032007 14:105456373-105456395 GAGCTCCGCCAGGTCTCTCCAGG - Intronic
1127663199 15:61119627-61119649 TTCCTCCAGTAGGGCTCCCCAGG + Intronic
1128619949 15:69140383-69140405 TTGCTGTGGCAGGTCCTCCCAGG + Intergenic
1131081960 15:89544017-89544039 CTGCTCCTTCAGGTCTCCTCTGG - Intergenic
1131257387 15:90871583-90871605 TTTCCCCGCCAGGGCTCCCCAGG + Intronic
1132346812 15:101113569-101113591 TGGCTCTGGCAGGTCCACCCTGG - Intergenic
1138582316 16:57949571-57949593 TTGCTCGGGTGGGGCTCCCCAGG - Intronic
1142123547 16:88399097-88399119 GCGCTTCGGCAGGTCTCACCTGG + Intergenic
1147707754 17:42439213-42439235 TTGCCCAGGCTGGTCTCTCCTGG - Intergenic
1147794952 17:43035608-43035630 TTGCCCAGGCTGGTCTCACCTGG - Intergenic
1151678604 17:75612726-75612748 CTGCTCCGGTGGGGCTCCCCTGG + Intergenic
1152110091 17:78353112-78353134 TAGCTCCGCCAGGGCTCCCGCGG + Intergenic
1152315130 17:79575748-79575770 TTGCTCTGGCAGGCTGCCCCGGG - Intergenic
1152860287 17:82692405-82692427 TTGCTCAGGCAGCTGTGCCCAGG - Intronic
1157337836 18:46754697-46754719 TTGCTCTGGCAAGTCCTCCCTGG - Intronic
1157554182 18:48602412-48602434 TTGCTCACGCAGGCCTCACCTGG - Intronic
1158339469 18:56449926-56449948 TGGCTCCGGAAGATCCCCCCAGG + Intergenic
1161120914 19:2525694-2525716 TTGCTCCGGCAGTTATCCCGAGG + Intronic
1161123070 19:2540737-2540759 TTGCTCCGGCAGGTCTCCCCGGG - Intronic
1161336717 19:3718290-3718312 TTACTCAGGCTGGTCTCTCCTGG + Intronic
1161814800 19:6493564-6493586 TTGGTCAGGCTGGTCTCTCCTGG + Intergenic
1162342190 19:10098095-10098117 TTGCCTAGGCTGGTCTCCCCTGG + Intronic
1163420707 19:17212177-17212199 CTGCACTGGCAGGTCTGCCCCGG - Exonic
1163638015 19:18446325-18446347 CAGCTCCGGCAGCTCTCCCAGGG - Exonic
1164413242 19:28022680-28022702 TGGCTGTGGCAGGTCTCCCACGG - Intergenic
1164517728 19:28950135-28950157 TGGCTGTGGCAGGTCTCCCATGG - Intergenic
1164692607 19:30222501-30222523 CCGCGCCGGGAGGTCTCCCCGGG + Intergenic
1164811988 19:31164724-31164746 CTGTTCCAGCAGCTCTCCCCGGG + Intergenic
1164832724 19:31334977-31334999 TTGCTCCCCCAGGTAACCCCTGG - Intronic
1165358148 19:35316699-35316721 TGGCTCCAGCAGGTCTGGCCTGG + Intergenic
1165463380 19:35958060-35958082 CTGCTCTGGCAGGTGACCCCCGG + Intergenic
1167999182 19:53431509-53431531 TTTATCCAGCAGGTCGCCCCTGG + Intergenic
1168255060 19:55160677-55160699 CTGCTCCTCCAGGTCCCCCCCGG + Exonic
925210650 2:2042927-2042949 TGGCTCCGGCAGCCCTCACCTGG + Intronic
925534425 2:4901248-4901270 TGGCTCCGGCAGGGCTCCGGGGG + Intergenic
929370887 2:41222816-41222838 TGGCTCCTGCAGGTCCCCCAAGG - Intergenic
929879189 2:45821658-45821680 ATGCTCAGGCCGGGCTCCCCTGG - Intronic
930188470 2:48433641-48433663 TTGCTTTGGCACGTCACCCCTGG + Intergenic
932446925 2:71787049-71787071 CTGCTCCAGGAGGTCACCCCTGG + Intergenic
934310469 2:91858000-91858022 TTGTTCCCTAAGGTCTCCCCAGG - Intergenic
938381360 2:130837983-130838005 GGGCTCCTGCAGGTCTGCCCTGG - Intronic
938496915 2:131802566-131802588 TTGTTCCCTAAGGTCTCCCCAGG + Intergenic
941357823 2:164514593-164514615 TTCCTCTGGCAGCCCTCCCCAGG - Intronic
944602048 2:201313112-201313134 TTCCTCTGGCAGTCCTCCCCAGG - Intronic
945992246 2:216405842-216405864 CTCCTCCTTCAGGTCTCCCCTGG + Intergenic
948316245 2:237030508-237030530 TTGTTGCCGCAGGGCTCCCCAGG + Intergenic
1170293466 20:14797378-14797400 TGGCTCCTGCAGTTCTCTCCTGG + Intronic
1170613509 20:17932243-17932265 CTGCTCAGTGAGGTCTCCCCTGG + Intergenic
1170991259 20:21303558-21303580 GAGCTCCGGCAAGGCTCCCCGGG - Intronic
1171280251 20:23890147-23890169 CTGTTCCTGCAGCTCTCCCCAGG + Intergenic
1172695895 20:36822540-36822562 GTGCTCAGGCAGCTCTCTCCTGG - Intronic
1176933057 21:14836631-14836653 TTGCCCAGGCTGGTCTCTCCTGG + Intergenic
1178027904 21:28489161-28489183 TTTCTCCAGCAGGTCTACCACGG - Intergenic
1180455400 22:15510286-15510308 TTGTTCCCTAAGGTCTCCCCAGG - Intergenic
1180537219 22:16403939-16403961 TTGTTCCCTAAGGTCTCCCCAGG - Intergenic
1181517650 22:23424712-23424734 TTGCCCAGGCTGGTCTCACCTGG + Intergenic
1183001044 22:34859324-34859346 TTGCTCTAGCAGGTCAGCCCTGG + Intergenic
1184403637 22:44287754-44287776 ATGCTGGGGCAGGTGTCCCCGGG + Intronic
954503337 3:51042589-51042611 TTGCTCCTGCTGGACTGCCCTGG - Intronic
957397661 3:79663555-79663577 TTGCCCAGGCTGGTCTCTCCTGG + Intronic
961459149 3:127039309-127039331 AGGCTCCTGCAGGTATCCCCAGG + Intergenic
965317205 3:167207737-167207759 TTGCTCCCCCAACTCTCCCCAGG - Intergenic
971014412 4:22472295-22472317 TTGCTTCGACAGGTCCTCCCAGG + Intronic
972607869 4:40630421-40630443 TCGCCCCGGGAGCTCTCCCCGGG - Intronic
974785152 4:66609832-66609854 TTCCTCTGGCAGCCCTCCCCAGG + Intergenic
975683265 4:76896986-76897008 CAGCTCCGGCCGGTCTCCGCGGG + Exonic
985608957 5:875931-875953 CTGCACGGGCAGGTGTCCCCCGG - Intronic
992876612 5:81062049-81062071 TTGCTCAGGCTGGTCACTCCTGG + Intronic
994420693 5:99524756-99524778 TAGCCCCGGCAAGTCTCCCGTGG + Intergenic
994486350 5:100389558-100389580 TAGCCCCGGCAAGTCTCCCGTGG - Intergenic
1000700910 5:164448629-164448651 TTGCTCCTGCAGGTAGCTCCTGG - Intergenic
1004295449 6:14405987-14406009 TTCCTCAGCGAGGTCTCCCCTGG - Intergenic
1005500195 6:26422699-26422721 GTGCTCAGGGAGGGCTCCCCAGG + Intergenic
1006453271 6:34117619-34117641 TTCATCCGGCACGTCTCTCCAGG + Intronic
1007199023 6:40089502-40089524 TTGCTCAGGCAGTTCTCTCTGGG + Intergenic
1015328941 6:131954872-131954894 TTCCTCCGGCATGTTTCCCTGGG - Intergenic
1019776178 7:2913243-2913265 TGGCTCCCGCGGGGCTCCCCAGG + Intronic
1020085730 7:5309151-5309173 TTGCCCGGGCTGGTCTCCTCGGG + Exonic
1023418829 7:39957159-39957181 TTGCTCAGGCTGGTCTCCTGGGG + Intronic
1029372290 7:100157656-100157678 TCGCCCCGGAATGTCTCCCCAGG + Exonic
1032227445 7:130044227-130044249 TTGCCCAGGCTGGTCTCTCCTGG + Intronic
1037058889 8:14481958-14481980 GTGGTCCGGTAGGTATCCCCAGG - Intronic
1038414055 8:27380386-27380408 CTTCTCTGGCAAGTCTCCCCTGG - Intronic
1039395633 8:37222985-37223007 TTGTTCCTTCAGGTCTCCCCAGG - Intergenic
1049308295 8:141919819-141919841 GGGGTCCTGCAGGTCTCCCCAGG - Intergenic
1049674839 8:143884825-143884847 TTCCTCCTGCAGGCATCCCCAGG - Intergenic
1049702083 8:144019922-144019944 GGGCTGCGGCAGGTCTCCTCCGG + Intronic
1049725231 8:144142698-144142720 GTGCTCCAGCAGGTCGCCCCAGG + Intergenic
1058655805 9:107219464-107219486 TTGCTCTGGCAGTACTCCCAAGG + Intergenic
1060975871 9:127764655-127764677 TTTTTCCGGCAGATATCCCCCGG + Intronic
1062027263 9:134346368-134346390 TTGCCCCTTCAGGTCTCCCTCGG + Intronic
1062221821 9:135420288-135420310 TTGCTCTGGCTGGGCCCCCCAGG + Intergenic
1187143254 X:16614699-16614721 TTGCTCAGGCTGGTCTCACCTGG - Intronic
1187143276 X:16614832-16614854 TTGCTCAGGCTGGTCTCACCTGG - Intronic
1187977524 X:24718339-24718361 TTCCTCAGACAGGCCTCCCCTGG - Intronic
1191016981 X:55819351-55819373 TTCCTCTGGCAGCCCTCCCCAGG + Intergenic
1191044264 X:56119346-56119368 TTGCTTCAGCTGGCCTCCCCTGG - Intergenic
1196965815 X:121053736-121053758 ATTCTCAGGCAGATCTCCCCTGG - Intergenic
1198943344 X:141982688-141982710 TTCCACTGGCAGGCCTCCCCAGG + Intergenic