ID: 1161130976

View in Genome Browser
Species Human (GRCh38)
Location 19:2588533-2588555
Sequence GCGTCCAGCTGCCGCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161130976_1161130983 9 Left 1161130976 19:2588533-2588555 CCAGGGCGGCGGCAGCTGGACGC 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1161130983 19:2588565-2588587 GGAACTTTCTCCCGTCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 54
1161130976_1161130985 11 Left 1161130976 19:2588533-2588555 CCAGGGCGGCGGCAGCTGGACGC 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1161130985 19:2588567-2588589 AACTTTCTCCCGTCAGTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1161130976_1161130984 10 Left 1161130976 19:2588533-2588555 CCAGGGCGGCGGCAGCTGGACGC 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1161130984 19:2588566-2588588 GAACTTTCTCCCGTCAGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161130976 Original CRISPR GCGTCCAGCTGCCGCCGCCC TGG (reversed) Intronic
900540163 1:3198634-3198656 GCCTCCAGCAGCAGCCGCCCAGG + Intronic
901456504 1:9366132-9366154 GCTTCCAGCTGCAGCCTCCCAGG - Intronic
901535938 1:9883097-9883119 CCGTCCCGCTGCTGCCACCCAGG - Intronic
901712442 1:11126305-11126327 GCACCCAGCTGCCTCCTCCCTGG + Intronic
902214329 1:14924714-14924736 GCCTCCCGCTGCACCCGCCCGGG - Intronic
903284210 1:22267068-22267090 GCTTCAAGCTGCCGCTGCACAGG + Intergenic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
905403670 1:37719563-37719585 GCTTCCGGCTGCCACCCCCCAGG - Exonic
905796343 1:40818626-40818648 GCTTCCAGGTGCCGCCGCGGCGG - Exonic
906719354 1:47994382-47994404 GCTGCCAGCTGCTGCCGCACGGG - Exonic
908272803 1:62437148-62437170 GCGCCCATCTGCGCCCGCCCCGG - Exonic
910259737 1:85283770-85283792 GGGTGCAGCTGCAGCTGCCCAGG + Intergenic
912951486 1:114123558-114123580 GGGTCCAGCTTCAGCCACCCTGG - Intronic
915916935 1:159945895-159945917 GGGGCCAGCTCCCGCAGCCCTGG - Intergenic
917565211 1:176206642-176206664 GCTTCCTGCTGCCGCTGCCTAGG + Exonic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
918571487 1:185998310-185998332 GCCTTCAGTTGCCGCTGCCCAGG - Intronic
920333311 1:205227915-205227937 CCGCCCGGCTGCCTCCGCCCGGG - Intergenic
922419604 1:225450650-225450672 TCGTCCTGCTGTCGCAGCCCTGG + Intergenic
922513146 1:226186475-226186497 GCCCCCAGCCGCCGCCTCCCCGG + Exonic
923008241 1:230068240-230068262 GCGTCCTCGTGCCGCCGCTCCGG + Intronic
1063663712 10:8049945-8049967 GCGTCCAGCTGTGGCCGCCGCGG - Intergenic
1070883234 10:79867333-79867355 GCGTCCAGCTGCTGCTGGGCTGG + Intergenic
1071649802 10:87383640-87383662 GCGTCCAGCTGCTGCTGGGCTGG + Intergenic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1078424591 11:11238860-11238882 GGGTCCTGCTGCCTCCTCCCAGG - Intergenic
1081604731 11:44520244-44520266 GCGCCCAGCTGCCCCCGCCTCGG - Intergenic
1081871737 11:46385778-46385800 GCGTCAAGAAGCCCCCGCCCGGG - Exonic
1084546851 11:69818952-69818974 GCCTGCAGCCGCCGCCGCCGCGG - Exonic
1084557747 11:69884952-69884974 GGGACCAGCTGCCCCCTCCCCGG + Intergenic
1085525706 11:77162337-77162359 CGGTCCTGCTGCCGCCTCCCAGG + Intronic
1087188723 11:95230833-95230855 CCGACGGGCTGCCGCCGCCCCGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1090363033 11:126186508-126186530 GCGTCCAGCTGTCCACTCCCTGG - Intergenic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1092246554 12:6867399-6867421 CCGCCCTCCTGCCGCCGCCCCGG - Exonic
1092899498 12:13044823-13044845 CCGTCCCGCCGCCCCCGCCCAGG - Intronic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1104448851 12:128853563-128853585 GCATGCCGCCGCCGCCGCCCGGG - Exonic
1104912726 12:132247490-132247512 GCTTCCAGCTGCCTCAGCCTAGG + Intronic
1104919159 12:132281718-132281740 GCATCCTGCTGCCTCCCCCCAGG - Intronic
1105725708 13:23160320-23160342 GCGTCCAGCCGGCGGCGCCCTGG + Intergenic
1106157378 13:27171434-27171456 CCGTCCAACCGCCCCCGCCCGGG + Intronic
1107770656 13:43785936-43785958 GCGTCCAGCGGCCGAGGCGCGGG + Intronic
1108243879 13:48496155-48496177 GCTTCCAGCTGCCGGCCTCCTGG - Intronic
1112091670 13:96090368-96090390 GCGGCCCGCTCCCGCCGCCCCGG - Intergenic
1112402124 13:99086495-99086517 GAGTCCGGCCGCCGCAGCCCAGG + Intronic
1112416362 13:99206448-99206470 GCGTCCCGCAGCCGCTTCCCTGG + Intronic
1113792992 13:113040653-113040675 GCCTCCACCTGCCCCTGCCCTGG + Intronic
1113804208 13:113103992-113104014 GCGGGCACCTGCAGCCGCCCTGG + Intergenic
1113846399 13:113394109-113394131 TCTTGCAGCAGCCGCCGCCCGGG + Intergenic
1115028438 14:28767606-28767628 GCCACCACCGGCCGCCGCCCTGG + Exonic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1119106755 14:71932328-71932350 GGGCCCAGGTGCCGGCGCCCAGG + Intergenic
1119545743 14:75470016-75470038 GCGCCCGGCTGCCGCCTCCTGGG - Exonic
1121679014 14:95777176-95777198 GGGTCCAGCTCCCCCAGCCCAGG + Intergenic
1122370477 14:101226499-101226521 TGGTCCAGCTGCCCCCTCCCAGG - Intergenic
1122880947 14:104690179-104690201 GCTTCCAGCTGCCCACGCGCAGG + Intronic
1122884337 14:104703912-104703934 ACGTCCAGCAGCTGCAGCCCTGG - Exonic
1122979060 14:105182936-105182958 GCTTCCAGCAGCAGCAGCCCCGG + Intergenic
1123041107 14:105490569-105490591 GCTTCCCTCTGCCGCCGCCACGG - Intronic
1124176058 15:27425138-27425160 GCCTCCAGCTGTCGTCTCCCAGG - Intronic
1124237672 15:28004010-28004032 CCGTCCAGCCGCTGCCACCCAGG + Intronic
1125728324 15:41879482-41879504 GCCTCCAGCTGCCCCCACCTGGG + Exonic
1129853978 15:78811323-78811345 GCGTGCAGCTCCCGGCGACCCGG + Exonic
1131493567 15:92883077-92883099 GGGTCCAGCCGCCGGGGCCCGGG - Intergenic
1132630287 16:914066-914088 GCGTGTAGCTGCAGCCGCCCAGG - Intronic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1136292725 16:29285533-29285555 GCCCCCAGCTGCCGTGGCCCTGG - Intergenic
1136630858 16:31488557-31488579 TCGCGCAGCTGCAGCCGCCCTGG + Intronic
1138497297 16:57416274-57416296 GAATCCAGCGGCCGCCTCCCAGG - Intergenic
1138529693 16:57628323-57628345 GCCTCCATCTGTCGCCTCCCAGG - Intronic
1139922154 16:70467272-70467294 GTGCCCAGGTGCCGCAGCCCTGG + Intronic
1141702814 16:85650266-85650288 GCCTCCAGAGGCCGCCCCCCAGG + Intronic
1141949158 16:87329700-87329722 GGCTCCCGCTGCTGCCGCCCTGG + Exonic
1142098613 16:88259537-88259559 GCCCCCAGCTGCCGTGGCCCTGG - Intergenic
1142136554 16:88454274-88454296 GCGCGCAGCTGCCGCAGCCTAGG + Intronic
1142237337 16:88928408-88928430 ACGTCCAGCTGCCCCCACACAGG + Intronic
1143670621 17:8393371-8393393 GCGTCCGGCTGGCGCCCTCCAGG + Exonic
1144864542 17:18326698-18326720 GCCTCCAACTGCAGCCGCCCTGG - Intergenic
1146284318 17:31564352-31564374 GCTTCCAGGTGCAGCCTCCCAGG + Intergenic
1146399543 17:32492346-32492368 GCTTCCAGCTGCCAGCGCACAGG + Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148493401 17:48037619-48037641 CTGCCCAGCTCCCGCCGCCCGGG + Intronic
1152352395 17:79791036-79791058 GCGTCCTGCTGCCCAGGCCCAGG - Intergenic
1152633518 17:81421157-81421179 GCCCCCAGCTGCCTCCGCCTGGG + Intronic
1152927082 17:83092283-83092305 GCGTCCACCTGCCACCGGCGTGG - Intronic
1154163544 18:11997344-11997366 GCCTCCAGCTCCCACTGCCCAGG - Intronic
1155306413 18:24483045-24483067 GGGACCAGCTGCAGCCGCCACGG - Intergenic
1158012774 18:52748202-52748224 TGGTCCAGCTGCCGCCTCACAGG - Intronic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160822498 19:1065053-1065075 GCTTCCAGCTGCCGCCGGGAGGG + Exonic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1161438725 19:4279089-4279111 GTGTCCAGCTGCCGCGGCCTCGG + Exonic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162739884 19:12767829-12767851 GCGCCCAGCTGCAGCCGCGGGGG - Exonic
1163714869 19:18867809-18867831 GCCTCCAGCTTCCCCTGCCCCGG + Exonic
1163785557 19:19273212-19273234 GGGTCCAGCAGCCGCCGCTATGG - Exonic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1164992175 19:32692370-32692392 GCGTGCTGCTGCTGCGGCCCAGG + Exonic
1165751804 19:38264770-38264792 GCGTTCAGGTGCCGACGCTCCGG - Exonic
1166871359 19:45872870-45872892 GCGTCCAGCTTCAGCTCCCCTGG - Exonic
1167258252 19:48443529-48443551 GCGCCCACCAGCCGCCGTCCAGG - Exonic
1167738764 19:51311880-51311902 GCTTCTCGCCGCCGCCGCCCTGG + Exonic
1168124550 19:54276276-54276298 CAGCCCAGCTGCCGACGCCCAGG - Exonic
926140341 2:10364440-10364462 GCCTCCAGCTCCTGCCTCCCTGG - Intronic
926155028 2:10448692-10448714 CCGTTCAGCTGCCGCGGGCCGGG - Intergenic
926285461 2:11483744-11483766 GTCTCCAGCTGCCGGCGCCCTGG - Intergenic
927542738 2:23927201-23927223 GCCTCCAGCTGCCCCGCCCCCGG + Intergenic
929118888 2:38467494-38467516 CAGTCCAGCTGCCGATGCCCTGG + Intergenic
931517626 2:63059208-63059230 GCTTCCAGCTTGCGCCGCACTGG + Intergenic
933374999 2:81467536-81467558 ACGGCCAGCTGCCCTCGCCCCGG - Intergenic
935820159 2:106886447-106886469 GCTTGCAGCTGCCGCCGGCGCGG - Exonic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
945305552 2:208255462-208255484 CGGCCAAGCTGCCGCCGCCCAGG - Intronic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
947122934 2:226836154-226836176 GCCGCCAGCTCCCGCAGCCCGGG - Intronic
947549836 2:231038037-231038059 GCCTCCAGCAGCCGCAGCCCCGG - Exonic
947633158 2:231666511-231666533 GGGTCCAACTGCCCCAGCCCAGG + Intergenic
1171123044 20:22582187-22582209 GCGGCCTGCTGCTGCTGCCCGGG + Exonic
1171411803 20:24952763-24952785 GCGTCCAGCTCTCGGCACCCAGG + Intronic
1172042157 20:32052962-32052984 CCGACCAGCTGCAGCCGGCCTGG - Intronic
1174497428 20:50958288-50958310 GCAGCCAGCTGCCGACACCCGGG + Intronic
1176083993 20:63287681-63287703 ACGTCCAGCTGTCGCTGCTCGGG - Exonic
1176178331 20:63738841-63738863 GCTTCCAGCTGCCCCAGCCTAGG + Exonic
1178314766 21:31558876-31558898 GCGTCCGGCCGGAGCCGCCCCGG - Intronic
1179576603 21:42312230-42312252 ACCTCCAGCTGCCCCCGGCCGGG - Exonic
1179912027 21:44455634-44455656 GCCTCCGGCCGCCGCCGCGCAGG + Exonic
1180073259 21:45449248-45449270 GCTTCCAGCTGCCGCCGGCCAGG + Intronic
1180843675 22:18970535-18970557 GCATCCAGGCGCCGCCGCTCCGG - Intergenic
1180871437 22:19149319-19149341 GCCTCCAGCTGGCGGCGACCAGG + Intronic
1181381611 22:22508879-22508901 GCGTCCAGCCGTCGCCACCAGGG - Exonic
1182360802 22:29745335-29745357 CCTTCCAGCTGCAGCCACCCTGG - Intronic
1182468464 22:30532487-30532509 GTGTCCGGCTGCAGCTGCCCAGG + Intronic
1183121780 22:35735572-35735594 ACGTCCAGCTGCAGCCCCACAGG - Intergenic
1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG + Exonic
1183427223 22:37746383-37746405 GCCTCCTGCTCCCGCCGCCCTGG + Intronic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1184779528 22:46640024-46640046 GCCCCCTGCTGCCACCGCCCAGG - Intronic
1185296688 22:50058246-50058268 GGGCCCAGCAGCCGCCGCACCGG - Intergenic
950368656 3:12508121-12508143 GCCTACAGCTGCCACCTCCCAGG - Intronic
952816476 3:37452054-37452076 CCGTCCAGCCGCCGCCGCCCGGG + Intergenic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
956738783 3:72258939-72258961 GCGTGCAGCTGCCCCCTCCTTGG - Intergenic
962118760 3:132540309-132540331 CCGTCCAGCTGGCTCCTCCCTGG - Intergenic
962398980 3:135040955-135040977 GCGTCCAGCTGCAGAAGGCCTGG + Intronic
962466700 3:135667257-135667279 GCCTCCAGCTGCTGCCCCCATGG - Intergenic
968196660 3:196712514-196712536 GCGTCCGGCTTCCGGCGTCCTGG + Exonic
968213495 3:196868392-196868414 GCCTCCAGCTCCGGCCGCCGTGG + Intronic
968317503 3:197736847-197736869 CCCTCCCGCTGTCGCCGCCCGGG - Intronic
968729100 4:2261459-2261481 GCGTACAGCGCCCGCCGCCGGGG - Intronic
968968952 4:3783635-3783657 GCCTCCAGCTTCCTCCGCACAGG + Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
976285096 4:83363595-83363617 GTGTCCAGCAGCAGCTGCCCTGG - Intergenic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
984734895 4:183099511-183099533 GCGGTCAGCTGCCGCTGCCCCGG + Exonic
985524462 5:394990-395012 GCCTCCTGCTGTCGCCCCCCAGG + Intronic
985713721 5:1444701-1444723 CCGGCAAGCCGCCGCCGCCCTGG + Intronic
989643337 5:43603734-43603756 GCATCCAGCTGCCACCTCTCTGG - Intronic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
994897101 5:105720909-105720931 GAGTCCATCTTCCTCCGCCCAGG + Intergenic
995724388 5:115169174-115169196 CCGGCCGGCTGCCGCCGCCTGGG - Intronic
997504250 5:134404097-134404119 GCGTACAGCTGCCGCCGGTTTGG + Intronic
999396845 5:151234973-151234995 GCCGCTAGCTGCCGCCTCCCAGG - Intronic
999727238 5:154446652-154446674 CGCCCCAGCTGCCGCCGCCCCGG + Exonic
1001228343 5:169964440-169964462 GCGTCTAGCTGCCCCCTCCCAGG - Intronic
1001483198 5:172102437-172102459 GCGTCCAGCTGTTGACTCCCCGG - Intronic
1003433050 6:6058111-6058133 GCACCCAGCTGGCGTCGCCCAGG + Intergenic
1007327458 6:41073219-41073241 GCGGCCAGCGGCCCCGGCCCGGG + Intronic
1007444511 6:41895019-41895041 GCCTCCCGCCGCCCCCGCCCCGG + Intronic
1015143419 6:129959584-129959606 TGGTCCAGCTGCAGCCTCCCCGG + Intergenic
1017021290 6:150142678-150142700 GCCTCCACCTGGCGCGGCCCCGG - Intergenic
1017446362 6:154510379-154510401 GCCTGCAGCTGCCGTCGCTCGGG - Exonic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1018686572 6:166308251-166308273 GCGTCCAGCCGCGGCCTCTCCGG + Exonic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1022485125 7:30771817-30771839 CTCCCCAGCTGCCGCCGCCCCGG - Intronic
1025033050 7:55572577-55572599 GCGCCCAGCAGCCGCGCCCCAGG - Intronic
1025777298 7:64570383-64570405 GCTTCTCGCCGCCGCCGCCCTGG - Intergenic
1026360565 7:69598483-69598505 GGCTCCCGCTGCAGCCGCCCGGG + Intergenic
1026807639 7:73437923-73437945 CGCTCCAGCTGCCCCCGCCCTGG - Intergenic
1027219835 7:76206810-76206832 GCCTCCTGCCGCCCCCGCCCTGG + Intronic
1029110922 7:98212709-98212731 ATGTCCAGCAGCCGCCTCCCAGG + Exonic
1031008417 7:116499639-116499661 GCGGGAAGCGGCCGCCGCCCGGG + Exonic
1031966492 7:128031411-128031433 GCAATCAGCTGCCGCCGGCCCGG - Intronic
1041167342 8:55102653-55102675 GCGAGCAGCCGCCGCCGTCCGGG - Exonic
1043464082 8:80487386-80487408 CCGCCCCGCTGCCGTCGCCCAGG - Exonic
1043997026 8:86830380-86830402 AGATCCAGCTGCCTCCGCCCAGG - Intergenic
1045063453 8:98426917-98426939 GCGTGCCTCGGCCGCCGCCCGGG - Intronic
1045114976 8:98972554-98972576 GAGTCCCGCAGCCGCGGCCCGGG + Intergenic
1045583326 8:103501192-103501214 GCGGCCAGCGCCGGCCGCCCGGG + Intronic
1055090979 9:72364784-72364806 GCGCCCTGGTGCCGCCGCCGCGG + Intronic
1056577387 9:87866933-87866955 GCCTCCAGCAGGCTCCGCCCAGG + Intergenic
1057152344 9:92807457-92807479 GCGTCCAGGAGCCGCCCCCAGGG + Intergenic
1060933969 9:127505489-127505511 ACCCCCAGCTGCCGCAGCCCTGG - Exonic
1060961668 9:127685035-127685057 CCGTCCAGCTGCCACTGACCTGG - Intronic
1060964805 9:127706576-127706598 GCGTCCAGCTGATGGGGCCCTGG - Intronic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic