ID: 1161131359

View in Genome Browser
Species Human (GRCh38)
Location 19:2590805-2590827
Sequence TAGTTGGTTGGGTGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2381
Summary {0: 1, 1: 0, 2: 6, 3: 214, 4: 2160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161131359 Original CRISPR TAGTTGGTTGGGTGGGCGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr