ID: 1161133912

View in Genome Browser
Species Human (GRCh38)
Location 19:2608519-2608541
Sequence GGCACAGGTGTGCCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161133912_1161133915 16 Left 1161133912 19:2608519-2608541 CCAGATGCAGGCACACCTGTGCC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1161133915 19:2608558-2608580 GAGTCACGAGACCAGCAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1161133912_1161133918 27 Left 1161133912 19:2608519-2608541 CCAGATGCAGGCACACCTGTGCC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1161133918 19:2608569-2608591 CCAGCAACCTGGAAACCTGGAGG 0: 1
1: 0
2: 4
3: 20
4: 278
1161133912_1161133916 24 Left 1161133912 19:2608519-2608541 CCAGATGCAGGCACACCTGTGCC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1161133916 19:2608566-2608588 AGACCAGCAACCTGGAAACCTGG 0: 1
1: 0
2: 4
3: 24
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161133912 Original CRISPR GGCACAGGTGTGCCTGCATC TGG (reversed) Intronic
900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG + Intronic
900964685 1:5949777-5949799 GGCAGAGGCATGCCTGAATCCGG + Intronic
902995697 1:20223135-20223157 GGCAGTGGTGTGGGTGCATCTGG - Intergenic
903692435 1:25183934-25183956 GGCACAGCAGAGCCTGGATCTGG - Intergenic
905817723 1:40965063-40965085 GGAACAGGTGGGCCTGCATTTGG + Intergenic
906311300 1:44756476-44756498 GGCAATGGTGTGGCTGCATAAGG - Intronic
907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG + Intronic
912507667 1:110167220-110167242 GAGACAGCTCTGCCTGCATCAGG + Intronic
916437804 1:164792836-164792858 GGCACAGGGATGCCAGCACCTGG - Intronic
917194472 1:172450736-172450758 GGCACACGTGCACCTGCCTCAGG - Intronic
918482424 1:184992838-184992860 TGTACAGGTGCACCTGCATCTGG - Intergenic
922194920 1:223351600-223351622 TCCACAGCTGTTCCTGCATCTGG - Intronic
922618148 1:226975158-226975180 GGCAGAGGTGGGCAGGCATCAGG + Intronic
923407870 1:233680629-233680651 GGCACAGGTGTGCCTGGTGGTGG - Intergenic
923546735 1:234928797-234928819 GGCACAGGTGTGCACACACCTGG + Intergenic
923566278 1:235078973-235078995 GCCACAGGTGTGTCTCCTTCAGG - Intergenic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
1063928961 10:11009988-11010010 GGCACAGTTGTGCCTTTATGCGG + Intronic
1064314252 10:14240041-14240063 GGCCCAGGTGAGCATGCATTCGG - Intronic
1069580111 10:69560016-69560038 GGCCCAGGTGTGCCTGGCTCTGG - Intergenic
1069833794 10:71296341-71296363 GGCACAGGTGTGTGTGTGTCAGG - Intronic
1070151277 10:73806710-73806732 GGAACAGGTGTGGCTGCATGTGG + Exonic
1072082791 10:92048511-92048533 GCCACAGGTTTGGCTGCACCTGG + Intronic
1073361093 10:102899433-102899455 TGAAGAGGTCTGCCTGCATCTGG - Intronic
1075557137 10:123441712-123441734 CGGACAGGTGTGAGTGCATCTGG - Intergenic
1076280381 10:129241832-129241854 GGTACAGGTGTGCATGCAAAGGG + Intergenic
1076791405 10:132778863-132778885 GGTACAGGTGTGCCCTCAGCAGG + Intronic
1077043647 11:535241-535263 GGCACAGGTGAGCGGGCGTCGGG - Intronic
1077200037 11:1302179-1302201 CACACAGGTGTGCGGGCATCGGG - Intronic
1080091780 11:28356931-28356953 GGCCCAGGTGTGCTGGCCTCAGG + Intergenic
1084475778 11:69387979-69388001 GGCAGAGGTGTCCCTGCAGGGGG + Intergenic
1085036056 11:73300775-73300797 GTCACAGGTGTGCTTGCAGCTGG + Intergenic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1088415763 11:109587068-109587090 GGCACTGGTCTGCTTGAATCAGG + Intergenic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1090399162 11:126437246-126437268 TGCACACGTGTACCTGCATGTGG - Intronic
1090619838 11:128550583-128550605 GGCAAGGCTGTTCCTGCATCAGG + Intronic
1091624536 12:2112035-2112057 AGCACATGTGTGCGTGCATGTGG + Intronic
1092331057 12:7588559-7588581 GGCTCATCTGTGCCTGCATGAGG + Intergenic
1103403612 12:120659739-120659761 AGCACAGGTGTGCCTGGATCAGG - Intronic
1105302694 13:19150386-19150408 AGTACAGGTGTGCCTGCAGCAGG - Intergenic
1106309589 13:28542696-28542718 GGCACATGTGTGTCTGGGTCTGG - Intergenic
1106502404 13:30341498-30341520 GTCACAGGTTTCTCTGCATCAGG + Intergenic
1106636661 13:31535895-31535917 GACACAGGGGTGGCTTCATCAGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1114985036 14:28216792-28216814 GTCACAGAGGTGCTTGCATCGGG - Intergenic
1117546444 14:56797927-56797949 GGCCCAGCTGGGCCTGCCTCGGG - Intergenic
1118255399 14:64201171-64201193 GGCCCAGGTCTGCTTGCCTCTGG + Intronic
1119428913 14:74552989-74553011 GGCACAGGTCTGCTTGCAGATGG + Exonic
1119741482 14:77016509-77016531 GTCACAGGTGTGCATCCACCAGG - Intergenic
1119883113 14:78117107-78117129 GTCTGAGGTATGCCTGCATCTGG - Intergenic
1121518353 14:94568910-94568932 GACACAGGTGAGGCTGCATTGGG + Intronic
1123129457 14:105973871-105973893 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123129537 14:105974205-105974227 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123129553 14:105974284-105974306 GGGACAGGTGTTCTTGCCTCAGG - Intergenic
1123579651 15:21704417-21704439 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123579724 15:21704740-21704762 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123579765 15:21704923-21704945 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123616278 15:22146928-22146950 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123616351 15:22147251-22147273 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1123616392 15:22147434-22147456 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1125551946 15:40551708-40551730 GGCTCAGGTGATCCTGCCTCAGG - Intronic
1128479768 15:68027344-68027366 GGATCAGGAGTGCCTACATCGGG + Intergenic
1128700365 15:69799522-69799544 GCCACAGCTGTGCCTGGAGCTGG - Intergenic
1202988521 15_KI270727v1_random:438662-438684 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1202988594 15_KI270727v1_random:438985-439007 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1202988635 15_KI270727v1_random:439168-439190 GGGACAGGTGTGCTTGTCTCAGG - Intergenic
1132662323 16:1067010-1067032 AGCACAGGTGTTTCTGCTTCTGG - Intergenic
1132738603 16:1399447-1399469 GGCACAGGCGTGGCGGCTTCGGG + Exonic
1132786572 16:1660145-1660167 AGCACAGGTGTGCCTGAGGCCGG + Intronic
1134326605 16:13213397-13213419 TGCACATGTGTGTCTGCATAGGG + Intronic
1138998146 16:62477774-62477796 AGCACAGGGATGCCTGGATCTGG - Intergenic
1141169391 16:81681477-81681499 GGCGCAAGTATGGCTGCATCTGG + Intronic
1141360916 16:83394445-83394467 ACCACACGTGTGCCTGCCTCAGG - Intronic
1141766484 16:86062998-86063020 GGCACATGTGTCCTTGCTTCCGG - Intergenic
1143480331 17:7224407-7224429 GGTCCAGGAGAGCCTGCATCAGG + Intronic
1145296164 17:21593866-21593888 GGCCCATCTGTGCCTCCATCAGG + Intergenic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1150223054 17:63508003-63508025 GGCCCAGGTGTGCCTGAATGAGG + Intronic
1150472767 17:65451173-65451195 GGGATAGATGTGCCTGCCTCTGG + Intergenic
1152147345 17:78576434-78576456 TTCACAGATGTGCCTGAATCGGG - Intronic
1152496512 17:80676579-80676601 GGACCGGGTGTGCCAGCATCTGG + Intronic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1159634518 18:70789062-70789084 GGCGCAGGTGTGTGTGCATGTGG - Intergenic
1159914861 18:74179873-74179895 GGGTCAGGTGTGCCGGCATGTGG + Intergenic
1160160311 18:76465736-76465758 GGCACAGAAGTCCCTGCACCAGG + Intronic
1160943583 19:1631045-1631067 AGCACGGGTGAGCCTGCAGCGGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1162006142 19:7780803-7780825 GGCACAGATGTTTCTGCAACTGG - Intergenic
1162207604 19:9067425-9067447 GGCAGAGAATTGCCTGCATCAGG + Intergenic
1162720755 19:12661208-12661230 TGCACATGTGCGCTTGCATCCGG - Intronic
1163713592 19:18861390-18861412 GGCACAGCTCTGCCTCCATGAGG + Intronic
1163758606 19:19121063-19121085 GGCACAGGTAGGCCTGCAGGTGG + Exonic
1164538464 19:29104447-29104469 GGGACAGCTGTGCCTACATTTGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925350789 2:3199711-3199733 GACATGGGTGTGTCTGCATCTGG + Intronic
925350804 2:3199774-3199796 GACAGGGGTGTGTCTGCATCTGG + Intronic
925350824 2:3199863-3199885 GACATGGGTGTGTCTGCATCTGG + Intronic
925350853 2:3199979-3200001 GTGACGGGTGTGTCTGCATCTGG + Intronic
925891501 2:8438624-8438646 GGCCCAGGGGTGCATGCATCAGG - Intergenic
929533641 2:42767400-42767422 GGCACACCTGTGGCTGCTTCAGG + Exonic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
929868098 2:45735270-45735292 GCCAAAGGAGAGCCTGCATCAGG - Intronic
930048799 2:47197581-47197603 GGCACAGGTGTGGCTGAAGAGGG + Intergenic
932497585 2:72154054-72154076 GGCCAGGCTGTGCCTGCATCTGG - Intergenic
933172010 2:79135178-79135200 AGCACAGATGTGCCTTCCTCAGG + Intergenic
934504712 2:94880940-94880962 GGGACAGGTCTGCTGGCATCAGG + Intergenic
935862242 2:107345590-107345612 ACCACAGGTGTGGCTGCTTCCGG - Intergenic
937104239 2:119295099-119295121 GGCAAAGGTGTGCCTCCAGGAGG + Intergenic
937690652 2:124751084-124751106 AGCACAGATGTGCCTGAACCTGG + Intronic
938288718 2:130138330-130138352 GACACAGGGGTGCCGGCAGCAGG - Intergenic
938358504 2:130670291-130670313 TGCAAAGGTGTGCCAGGATCAGG + Intergenic
938467815 2:131534602-131534624 GACACAGGGGTGCCGGCAGCAGG + Intergenic
946403387 2:219480526-219480548 GGCACAGGAGTGGCTTCTTCAGG - Intronic
947773316 2:232687996-232688018 GGCAGTGATGTGCCAGCATCTGG - Intergenic
948470355 2:238173493-238173515 GGCACAGGTGTGTGTGCATGTGG - Intronic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
948952291 2:241261775-241261797 GGCACAGCTGGACCTGCATTAGG + Intronic
1168888742 20:1279899-1279921 GGCACAGCTGTGCCTTCCTGTGG + Intronic
1170614100 20:17935214-17935236 GGAACAGGTGTGGCTGGATGGGG + Intergenic
1171265799 20:23771651-23771673 GGCACATGGGTGCCAGCCTCTGG + Intergenic
1171881690 20:30622047-30622069 TGCAAGGGTGTGCCTGGATCAGG - Intergenic
1172502066 20:35434475-35434497 GGCCCAGCTGTGCCTGGAGCTGG - Exonic
1172808358 20:37629508-37629530 GGGACAGGTGTGCCTGCCAGTGG + Intergenic
1173148603 20:40546700-40546722 GTCTCAGATGAGCCTGCATCGGG - Intergenic
1173875246 20:46366398-46366420 GGCACAGGTGTGGCCTCAGCCGG + Exonic
1174773549 20:53323249-53323271 GGCAGATGTGTGCCAGCCTCTGG - Intronic
1175291400 20:57878140-57878162 GGCACAGGTGTTCCAGCCTCAGG + Intergenic
1175725001 20:61311898-61311920 GGAACAGGTGTGGATGCAGCCGG - Intronic
1175972472 20:62693635-62693657 GGCTGAGGCGTGGCTGCATCCGG - Intergenic
1178699266 21:34819632-34819654 GTCACAGGGATGCCTTCATCTGG + Intronic
1179575638 21:42306732-42306754 GCCACAGGTTTACCTGCGTCTGG - Intergenic
1180009529 21:45040452-45040474 GGGACAGGCGGGCCTGCAGCCGG - Intergenic
1180125662 21:45788429-45788451 GTCACAGGTGAGCCATCATCTGG - Intronic
1180161926 21:46002008-46002030 GGCTCACGTGCTCCTGCATCTGG - Exonic
1180220801 21:46356613-46356635 GACACATGTGTGCCCACATCTGG + Intronic
1180974711 22:19841987-19842009 GCCACCTGTGTGCCTGCCTCAGG - Intronic
1181108282 22:20587344-20587366 GGCACAGGGGTGCCGGCAGCAGG - Exonic
1182700560 22:32234003-32234025 GGAACAGGTGTGCTTGCATGGGG + Intronic
1183189223 22:36311004-36311026 GGCACAGGTGTGCTAGAACCGGG + Intronic
1183332847 22:37230517-37230539 GGCTCAGGGCTGCCTGCATCAGG - Intronic
1183364621 22:37400363-37400385 GGCACAGGTGTGTGGGCCTCCGG - Intronic
1183385152 22:37510033-37510055 GGCTCAGGAGGGCCTGCAGCAGG - Intronic
1184830837 22:46985327-46985349 GGCACAGTTGAGCCGGCATCTGG - Intronic
1185165140 22:49256950-49256972 GGCCCAGCTGTGCTGGCATCTGG - Intergenic
1185366830 22:50440696-50440718 GGCACATGTGTGCAGGCAACAGG + Intronic
953748069 3:45590446-45590468 GGCACAGCTGTGGCTGGACCAGG + Intronic
953834789 3:46333169-46333191 GGTACAGATGTTTCTGCATCTGG - Intergenic
958785445 3:98593003-98593025 GGCCCAGGTGTGCCAGGCTCTGG - Exonic
958884501 3:99710660-99710682 GGCACAGGTGTGCTAACATGTGG + Intronic
959459243 3:106604400-106604422 GGCATAGGTGTGCATGGGTCAGG + Intergenic
959782365 3:110250271-110250293 GGCATATATGTGCCTGCAGCTGG + Intergenic
960933525 3:122879596-122879618 GGCATACCTGTGCCTGCTTCTGG + Exonic
962387333 3:134942536-134942558 GACAGAGGTGAGACTGCATCAGG + Intronic
967866376 3:194193313-194193335 TGCACAGGTGTGCCTTCCTCGGG + Intergenic
967941802 3:194772152-194772174 GGCTCAGGTCAGACTGCATCTGG - Intergenic
968654760 4:1773669-1773691 GGCAGAGGGGAGCCTCCATCTGG - Intergenic
968977560 4:3829949-3829971 GGCACAGGTGTGGCTGGAGGTGG + Intergenic
969457269 4:7307214-7307236 GGCACAGCAGTGCCTTTATCTGG - Intronic
969591400 4:8123748-8123770 GGCAGGGGTGTGCCGGCATTGGG + Intronic
969842380 4:9892016-9892038 GGCACTGGGGTCCCTGCAGCTGG - Intronic
972017186 4:34262103-34262125 GGCAGTGGTGTGCATGCATGTGG - Intergenic
973745701 4:53961101-53961123 CACACAGGTGTGGCTGGATCAGG + Intronic
975641179 4:76501808-76501830 GGCATAGGAGTGCCTGCACATGG + Intronic
975666594 4:76740239-76740261 TGCACAGGTGGGCCTGCCCCCGG - Exonic
982371511 4:154638690-154638712 CACACATGTGTGCCTGCACCAGG - Intronic
983490794 4:168386708-168386730 GGGCCAGGTGAGCCTGCCTCTGG + Intronic
983584379 4:169339933-169339955 GGCCCATGTGTGCCAGCATAGGG + Intergenic
985837706 5:2282601-2282623 GTGACAGGTGGGCCTGCAGCAGG + Intergenic
985837712 5:2282627-2282649 GGGACAAGTGGGCCTGCAGCCGG + Intergenic
988591752 5:32555626-32555648 GGCCCAGGTTTGCCTACAGCAGG - Intronic
990492319 5:56314690-56314712 GGCAGGGCTGTGCATGCATCCGG - Intergenic
995246956 5:109945556-109945578 GGCAGAGCTGTGCCTGCCACAGG + Intergenic
995595380 5:113742464-113742486 GGCACATATGTGACTTCATCTGG - Intergenic
996866389 5:128127638-128127660 GGCAGAAGTGTGACTGCAACAGG - Intronic
999140379 5:149357782-149357804 GGCGCAGGTGTGCCCGCTTCGGG - Intergenic
999176066 5:149632503-149632525 GTCTTAGCTGTGCCTGCATCCGG + Exonic
999342897 5:150788538-150788560 GGCACAGGTTTGCTTGAACCTGG + Intronic
1000765767 5:165286811-165286833 TGCACAGGTGTGCCAGCTGCTGG - Intergenic
1002886183 6:1296426-1296448 GGCACAGGCGTGACACCATCAGG + Intergenic
1004265635 6:14146217-14146239 GGCACCAGTGTGCCCACATCTGG + Intergenic
1005436078 6:25813522-25813544 GGCACAGCTGAGCCTGCACAGGG + Intronic
1005506002 6:26469202-26469224 GGCTCAGGTGTCCCTGCAGTTGG + Exonic
1006512904 6:34531349-34531371 GGCACATCTGAGCCTTCATCCGG - Intronic
1006991812 6:38221453-38221475 GGCCCATGTGTCCCTTCATCTGG - Intronic
1010846819 6:80719971-80719993 AGCACTGGTGTGCCTGCACTGGG + Intergenic
1011419035 6:87152576-87152598 GGGACAGATGTGCTTGCATCCGG - Intergenic
1014270601 6:119331795-119331817 GGCAGAGGAGTGACTGCAACAGG + Intronic
1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG + Intronic
1018767339 6:166944790-166944812 GGGGCATGTGTGCCTGCAGCTGG - Intronic
1019179743 6:170178782-170178804 GGCGCGGGGGTGCCTGCCTCAGG - Intergenic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1022195033 7:28056749-28056771 GGGACAGGAGTGTGTGCATCAGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1024253581 7:47523667-47523689 GGCAAAGGTTTTCCTTCATCTGG + Intronic
1025756387 7:64347721-64347743 GGCACATGTGTCCATGCTTCTGG - Intronic
1026098479 7:67365517-67365539 GGCACAGTTGTGAATGCATTGGG - Intergenic
1026608488 7:71836351-71836373 TGCACAGGTGGACCTGGATCTGG + Intronic
1027420795 7:78015798-78015820 GGGCCAGATGTGGCTGCATCTGG + Intergenic
1032947818 7:136871654-136871676 GGCACAGGTATGCCTGTTTGTGG - Intronic
1035056410 7:156039462-156039484 GCCACAGGTCTGCCTGGGTCTGG - Intergenic
1035372641 7:158389068-158389090 GGCACTGCCCTGCCTGCATCTGG - Intronic
1036127311 8:6074881-6074903 GGGACAGGAGTGTTTGCATCTGG + Intergenic
1037920913 8:22804853-22804875 GGGACTGGTGTGGCTGCAGCAGG - Intronic
1038978744 8:32732483-32732505 TGGACAGATGTGCCTTCATCTGG + Intronic
1042515078 8:69650745-69650767 GCCACTGGTGTCCCTGCACCTGG + Intronic
1045048361 8:98300716-98300738 GGCACAGGTGTGGCTGGGTGTGG + Intergenic
1049640473 8:143712892-143712914 GGTCCAGGTGGGCCTGCATGGGG + Intronic
1049777931 8:144415025-144415047 GGCACAGGGGAGCCAGCAGCCGG - Exonic
1050829135 9:9989651-9989673 GGCACAGGTGTGGGTGCAAGAGG + Intronic
1051528669 9:18075825-18075847 GGCACAGGTCTGCCCACAGCAGG - Intergenic
1053255420 9:36613148-36613170 CGCTAAGGTGTGCCTGCCTCAGG + Intronic
1053386215 9:37692249-37692271 GGTTCAGTTTTGCCTGCATCAGG - Intronic
1059487570 9:114638500-114638522 GGCTCAGGAGTGCCTAAATCAGG - Intronic
1060473931 9:123971088-123971110 GGCATGTGTGTGCATGCATCCGG - Intergenic
1061187642 9:129063941-129063963 AGCCCAGGTGTTCCTCCATCAGG - Intronic
1062382192 9:136291834-136291856 AGCACAGGTGTGCCTGTGTCTGG + Intronic
1062606460 9:137350820-137350842 GGCTCAGGGATGCCTGCACCAGG + Intronic
1198428839 X:136546054-136546076 GCCCCATGTATGCCTGCATCAGG + Intronic
1200880598 Y:8208170-8208192 GGCACAGCTTTGCCTACAGCAGG - Intergenic