ID: 1161140000

View in Genome Browser
Species Human (GRCh38)
Location 19:2641565-2641587
Sequence TGGGGCTCCAGGGGAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161140000 Original CRISPR TGGGGCTCCAGGGGAAAATC TGG (reversed) Intronic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
901204862 1:7488387-7488409 TGGGGCTCCAGGAGCGAAGCTGG - Intronic
902393012 1:16117000-16117022 TGGGGATCTAAGGGAAAAACAGG + Intergenic
902874898 1:19335115-19335137 TGGGGCCCCAGGAGAACCTCAGG + Intergenic
903236290 1:21952776-21952798 TGGGGAGCCAGGGGACAATGGGG - Intergenic
903305220 1:22408449-22408471 TGGGGCTCCGGGGAAAGCTCAGG + Intergenic
904384610 1:30133093-30133115 TGCAGCTTCAGGGGACAATCTGG - Intergenic
905703034 1:40033169-40033191 GGAGGCTCTAGGGGAAAATGTGG + Intergenic
906061639 1:42952928-42952950 TGAGGCTCCAGGGGAGCATGTGG - Intronic
906107445 1:43303411-43303433 TGAGGATCCAGTGGAAAATGGGG + Intronic
909440242 1:75688659-75688681 TAGGGCTCCAGGGAAACACCTGG + Intergenic
909987939 1:82185479-82185501 TGGCTCTCAAGGGGAAACTCAGG - Intergenic
910234926 1:85025527-85025549 TGGGGCTATAGGGGAAAGTGAGG - Intronic
910592979 1:88947626-88947648 TGGGGCTCCAGGGGAGGTCCTGG - Intronic
912802300 1:112727777-112727799 TCTGGCTCCAGGAGAAATTCTGG + Intergenic
913191091 1:116413602-116413624 GGAGGCTCCTGGGGAAAATAAGG + Intergenic
915730112 1:158047384-158047406 TGGGGGTTCAGGGGAAGGTCAGG + Intronic
916123681 1:161550696-161550718 TGGGGTTACGGGGGAGAATCTGG - Intronic
916133568 1:161632059-161632081 TGGGGTTACGGGGGAGAATCTGG - Intronic
917120525 1:171641315-171641337 GAGGGCACCAGGGGAAAATGTGG + Intronic
917521019 1:175748562-175748584 CAGGGCTCCATGGGAAACTCTGG - Intergenic
919820261 1:201468150-201468172 TGGTGCCTCAGGGGAAAGTCCGG + Intronic
920500389 1:206481603-206481625 GGGGGCTCCAGGGGTAGATGTGG + Intronic
920567049 1:206982390-206982412 TGGGGCAGCAGGTGTAAATCGGG + Intergenic
921340200 1:214126941-214126963 TGGGGATCCAGGAGCAACTCAGG - Intergenic
922588332 1:226752740-226752762 TGGGGCTCCAGTGGACCCTCTGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065886786 10:30085235-30085257 TGGGACATCAGGGGAAAAGCAGG + Intronic
1067790893 10:49286901-49286923 TGGGGCTGCAGAGGAGAACCAGG - Intergenic
1072979416 10:100087292-100087314 TGGGGCTCCTGGGGAGAGGCTGG + Intergenic
1073103082 10:101017019-101017041 TGGGTCCCCAGGGGAAAATCAGG - Intronic
1075649230 10:124116870-124116892 GGGGGCTCCAGGGGACAGCCTGG + Intergenic
1075829920 10:125399893-125399915 AGGGGCTCCTGGGGACACTCAGG + Intergenic
1076458088 10:130617750-130617772 TGGAGCTCCAGGGGGAAGTCCGG + Intergenic
1076626864 10:131826417-131826439 TGGGCCTCCAGGGCAAGTTCTGG + Intergenic
1076689401 10:132213746-132213768 AAGGGCTCCAGGGGAAAAGCAGG + Intronic
1076827503 10:132976730-132976752 GGGGGCTCCAGGGGAGAATCTGG + Intergenic
1077296186 11:1827283-1827305 TGGGGCACGAGGGGAGAATGGGG - Intergenic
1078579507 11:12527519-12527541 TGGGGCTGCAGTGGAAGACCAGG - Intronic
1080605268 11:33860121-33860143 TGGGGCCCCAGCGAATAATCAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082095292 11:48124894-48124916 TGGGGCTCCGAAGGAAAATGGGG + Intronic
1082785209 11:57312973-57312995 AGGGGCTCAAGGGGAACAGCTGG + Exonic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083793063 11:64998486-64998508 TGAGGCTCCAGGTGATAAACTGG - Intergenic
1085117369 11:73941553-73941575 TGTCTCTCCAGGTGAAAATCAGG - Intergenic
1086100564 11:83094982-83095004 TGGGGCTTCAGGTGAGAATGAGG + Intergenic
1087042929 11:93819417-93819439 TGGGGCTCCAGGTGAGATTGGGG - Exonic
1089631450 11:119787096-119787118 TGGGGCTCCTGGGCAAACCCAGG - Intergenic
1094125534 12:27018960-27018982 TGGGGATCCAGGGAAAAGGCAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096096080 12:48936628-48936650 GGGGGCTCCAGGGACCAATCTGG - Exonic
1096113304 12:49041207-49041229 CGGGGCTCCAGGGGATAGGCAGG + Exonic
1097266362 12:57747616-57747638 TGTGGCTCTAAGGGTAAATCAGG + Exonic
1097813647 12:64046641-64046663 GGGGGCCCCAGGGGAGAAGCAGG + Intronic
1104633659 12:130424791-130424813 TGGGGCTGGTGGGGAAACTCGGG + Intronic
1104773514 12:131379358-131379380 TGGGGCCCCCGGGGGAACTCTGG - Intergenic
1104970346 12:132528097-132528119 TGGGGCTCCAGAGGGAAAGCGGG - Intronic
1108029226 13:46211775-46211797 TGGGGCTGCAGGGGAAGCTGCGG - Intronic
1110426282 13:75370769-75370791 TGGAGCTCCAGGGACAGATCAGG + Intronic
1112435764 13:99390273-99390295 TCTGGCCCCAGGGGAGAATCGGG - Intergenic
1112934030 13:104777113-104777135 TGGGGCTTCAGTAGAAAACCTGG + Intergenic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114398691 14:22389584-22389606 TGAAGCTCCAGGAGAAATTCAGG + Intergenic
1114474069 14:22981926-22981948 GTGGGCTCCAGCCGAAAATCGGG + Exonic
1114961462 14:27895976-27895998 TGGGGATTCAGGGGAAAGTGTGG - Intergenic
1118476680 14:66123957-66123979 AGGAGCTCCAGTGGTAAATCAGG - Intergenic
1119034128 14:71215563-71215585 TGGGTCCCCAGAGGAAAACCAGG - Intergenic
1119062581 14:71491328-71491350 AGGGGCTCAAGGGGAAAAAGAGG - Intronic
1119683724 14:76613249-76613271 TGGTTTTCCAGAGGAAAATCAGG + Intergenic
1121219533 14:92275264-92275286 TGGGGTTCCTGGGGAAAGTGTGG - Intergenic
1121996666 14:98608202-98608224 TGGGGCTCCCGGGGACAGCCTGG - Intergenic
1122977480 14:105176856-105176878 GGGGGCTCCAGGGGAAGCTGAGG - Intronic
1124791844 15:32734989-32735011 GGGTGTTCCAGGGGAAAAGCAGG + Exonic
1125360511 15:38859853-38859875 TGGGGCTCAAAGGGAAAAGCAGG - Intergenic
1126926240 15:53590197-53590219 TGGGGGTACAGGGGAAAAAGTGG - Intronic
1128697672 15:69780701-69780723 GTGGGCTCGAGGGGAGAATCAGG + Intergenic
1129701509 15:77771156-77771178 TGGAGGTCCAGGGGAAGGTCGGG - Intronic
1132490820 16:229592-229614 TGGGGGTCTAGAGTAAAATCAGG - Intergenic
1133226030 16:4340780-4340802 TGGGGCACCATGGGAAAGCCTGG + Intronic
1133303879 16:4798323-4798345 TGGGGCACCTGGGAAAAGTCTGG - Intronic
1134125786 16:11615106-11615128 TGGGGCTCTAGGAGAAAACGAGG + Intronic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1135134387 16:19876854-19876876 TAGCTCTCCAAGGGAAAATCAGG - Intronic
1135527028 16:23221392-23221414 AGAGGCTCTAGGGGAAAATCTGG + Intergenic
1135856611 16:26017359-26017381 TGGAGCTCTAGGGGAAAAGTTGG + Intronic
1138165088 16:54793891-54793913 TGGTTCTCCAGAAGAAAATCAGG - Intergenic
1138310481 16:56019393-56019415 GAGGCCTCCAGGGGAACATCTGG - Intergenic
1139619061 16:68122485-68122507 AGGGGATCCAAGGGTAAATCGGG - Exonic
1139726307 16:68902075-68902097 TGGGGCTCATGTGGCAAATCAGG + Intronic
1140217873 16:73022832-73022854 TGGGTCTTCAGGGCAAAACCTGG - Intronic
1141763445 16:86043916-86043938 GGCGGCTCCAGGGGAAAATCTGG - Intergenic
1143180237 17:4980057-4980079 TGGGGCTCCAGGGCAGCAGCAGG + Exonic
1143901164 17:10175937-10175959 AGGGGCCCCAGGGGACAGTCAGG - Intronic
1144787721 17:17841045-17841067 TGAGCCTCCAGGGGCAAAGCTGG - Intergenic
1144953929 17:19009753-19009775 TGGGGCCTCAGGGAAAAGTCTGG - Intronic
1145876315 17:28320747-28320769 GAGGGCTCCAGGGGAGAATCTGG + Intronic
1148335213 17:46836269-46836291 TGGGGCTCCCAGGGAAATCCAGG + Intronic
1148549273 17:48541153-48541175 TGTTGGTCCAGGGGAAAGTCTGG + Intronic
1148712058 17:49689133-49689155 TGGGGCTCAAGAGGAAAGCCTGG - Intergenic
1151337309 17:73447537-73447559 TGGTGCTCCAGGGGATCATTGGG - Intronic
1151725537 17:75881719-75881741 GGGGGCTCCATGGGAAAGGCTGG + Intronic
1152300672 17:79493797-79493819 TGGGCCTCCAGGTGAAACTCAGG - Intronic
1152542577 17:80983745-80983767 TGAGGCTCCGAGGGAGAATCCGG - Intergenic
1156873972 18:41983399-41983421 TGGGGCTTCAGGGGAAGAGGTGG - Intronic
1157166392 18:45361888-45361910 TGGTGCTCCCGGGGAAAAGATGG - Intronic
1157796629 18:50580913-50580935 TGGGTTTCCAAGGGAAATTCAGG - Intronic
1158339372 18:56448922-56448944 TGGGGCTCGTGGGGAAAGGCTGG - Intergenic
1159113641 18:64088944-64088966 TGGGGCACAAGGGGAATATGGGG + Intergenic
1159345899 18:67202763-67202785 TGAGGCTCCAGAGGAACAGCAGG - Intergenic
1159861584 18:73655169-73655191 TGGGGCTACAGAGGACATTCGGG + Intergenic
1159941680 18:74413271-74413293 CAGGGCTACAGGGGAAAAGCAGG - Intergenic
1160953353 19:1678063-1678085 GGGGGCTGCAGGGGAGACTCTGG - Intergenic
1161140000 19:2641565-2641587 TGGGGCTCCAGGGGAAAATCTGG - Intronic
1161520833 19:4722870-4722892 TGGGGCCCCTGGGGAAGACCAGG + Intronic
1162449838 19:10748097-10748119 GGGGGCTGCAGGGAAAAGTCTGG + Intronic
1162461546 19:10816892-10816914 TGGGGCTCCACGGGAGGGTCGGG - Intronic
1162910338 19:13844460-13844482 TGGGGCCCCAGGGGAAGATTTGG + Intergenic
1163098970 19:15082173-15082195 GGGGGAGCCAGGGGAACATCAGG - Intergenic
1163492951 19:17627688-17627710 AGGGGCTGCAGGGGAAACTGAGG + Intronic
1163899048 19:20084511-20084533 TGGGGCTCCTGGGTCAAATGAGG + Intronic
1165154583 19:33779314-33779336 CAGGGCTGCAGGGGCAAATCCGG - Intergenic
1165803738 19:38567944-38567966 TGGGGCTCCCGGGGAGAAGAAGG - Intronic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166378589 19:42342993-42343015 TGGTTTTCCAGAGGAAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1167283652 19:48586423-48586445 AGAGACTCCAGGGGAGAATCTGG - Intronic
1167661427 19:50798127-50798149 TGGTGCTCCAGGGGTGAAGCAGG - Exonic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168127302 19:54292363-54292385 TGGGGGTCCATGGGAAAGGCTGG + Intergenic
924997620 2:377338-377360 TGGGGCTTCAGGGGCTAGTCTGG - Intergenic
925267300 2:2574957-2574979 TGGGGGTCCGGGGGAACAGCAGG - Intergenic
927858576 2:26543204-26543226 TGGTGCTCCATGGGAGTATCTGG - Intronic
928590596 2:32810633-32810655 TGGAGCTCCAGAGGGGAATCTGG + Intronic
928913603 2:36447893-36447915 TGGGTCTTCAGGTGAAATTCGGG + Intronic
931018184 2:58010589-58010611 TAGGTCTCCATTGGAAAATCGGG + Intronic
932342675 2:70976257-70976279 TGTGGCTCCAGGGTCAACTCTGG - Intronic
932589978 2:73059398-73059420 TGGGGCTCCAGGGAGGAATTTGG - Intronic
933474018 2:82766183-82766205 TGGGTCTCCAGGGGTCAGTCTGG - Intergenic
933663968 2:84949737-84949759 TGTGGCTCCAGGGGCAACTTTGG + Intergenic
933698290 2:85236497-85236519 TGGGGCTCCAGGGACACACCAGG - Intronic
936466176 2:112753188-112753210 TGGGGATCCAGGGAGAGATCTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
942997426 2:182280206-182280228 TGGGGCTTAGGGGGAAAATTTGG - Intronic
945893644 2:215457874-215457896 TGGGTCTTTAGAGGAAAATCGGG - Intergenic
946775897 2:223140867-223140889 TGGGGCTTCGGGGGACACTCGGG - Intronic
1168850742 20:975213-975235 TGGTGCTCCAGGGGACACTGAGG + Intronic
1168991773 20:2102124-2102146 AGGGGCTCCAGGGGGGAAACGGG + Exonic
1169756770 20:9051304-9051326 TCAGGCTCCAAGGGAGAATCTGG - Intergenic
1171360642 20:24584222-24584244 TCGTGCTCCAGGTGGAAATCAGG + Intronic
1171426237 20:25050531-25050553 GGGGGCTCCAGGGTCAAATTTGG - Intronic
1171994284 20:31720232-31720254 TGGGGTTCCAGGGCAAACTCAGG + Intronic
1173187995 20:40856022-40856044 AGAGGCACCAGGGGAAAAGCAGG + Intergenic
1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG + Intergenic
1175416252 20:58803512-58803534 TGAGGCTGCAGGGGAAGATAAGG - Intergenic
1175450999 20:59068006-59068028 TGGGGCCCAAGGGCCAAATCTGG + Intergenic
1175668819 20:60883400-60883422 AGGGTCTCCAGAGGAAACTCTGG + Intergenic
1176086247 20:63296846-63296868 TGGGGCTCGGGGGGAAGAGCAGG - Intronic
1176157485 20:63628944-63628966 TGGGGCTCCAAGAGACAAACTGG + Intergenic
1176708871 21:10133705-10133727 TTGGGCTCCAGGGGGATATCAGG + Intergenic
1176877756 21:14150087-14150109 TGGAGCTCCAAGTGGAAATCTGG - Intronic
1178374577 21:32056316-32056338 TGAGGCTCCAGAGGGGAATCAGG + Intergenic
1178715434 21:34959986-34960008 GAGGGCTCCAGTGGGAAATCTGG + Intronic
1181711559 22:24694875-24694897 TCAGGCTCCATGTGAAAATCCGG - Intergenic
1181851810 22:25754905-25754927 TCGGGCTCCAGGGGGAATCCTGG - Intronic
1183010289 22:34940916-34940938 TGGGGCTACAGTGGAGACTCAGG + Intergenic
1184464932 22:44663364-44663386 AGGGGCTCTAGGAGAGAATCTGG + Intergenic
1184805958 22:46794948-46794970 TAGTTCTCCAGGGTAAAATCAGG - Intronic
952972296 3:38659219-38659241 TGGGGTCCCTGGGGAAAGTCTGG + Intergenic
953368954 3:42371113-42371135 GGGAGTTCCAGGGGAGAATCAGG - Intergenic
955111094 3:55950756-55950778 TGGGGCTGCAGTGGCAAATGGGG + Intronic
955946392 3:64198623-64198645 AGGGGCCCCAGTGGAAAATGAGG - Intronic
956034933 3:65080485-65080507 AGGGGAGCCAGGGGAAACTCAGG + Intergenic
957163776 3:76644410-76644432 AGAGGTTCCAGGGAAAAATCAGG - Intronic
957399503 3:79690476-79690498 GTGGGCTCTAGGGGAGAATCTGG - Intronic
958592168 3:96171721-96171743 TGGGGTTCCAGGAGGAAAACAGG - Intergenic
958912029 3:100004832-100004854 TGGGGCAGGTGGGGAAAATCTGG + Intronic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960469245 3:118040543-118040565 TAGGGCTGCACGGGGAAATCTGG - Intergenic
960844457 3:121993607-121993629 TGGAGCTCCTGGTGGAAATCAGG + Exonic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
966870842 3:184289671-184289693 TTGGGCTCCAGGATAAAGTCTGG - Exonic
967788945 3:193526817-193526839 GAGGGCTCCAGGGGAACCTCTGG + Intronic
968597993 4:1495180-1495202 AGGGGCTCCCGGGGGAATTCTGG - Intergenic
968671932 4:1856570-1856592 TGGGGCTCCAAGGGCAAGTCAGG + Intergenic
969461201 4:7330020-7330042 GGAGGCTCTAGGGGAAAATCTGG + Intronic
969528006 4:7713869-7713891 TGGGTCCTCAGGGGACAATCAGG - Intronic
969635303 4:8365712-8365734 TGGGGCTCCAGGGGCATCTGAGG - Intergenic
970405951 4:15764674-15764696 TAGCTCTCCAGAGGAAAATCAGG - Intergenic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
976023158 4:80655785-80655807 TGGGGCCCCAGGAGGAAAACTGG + Intronic
976292170 4:83431021-83431043 TGGGGCATCAGTGGAGAATCTGG - Intronic
979567910 4:122177470-122177492 TGGGAAGCCACGGGAAAATCTGG - Intronic
979873687 4:125859693-125859715 TAGGGACTCAGGGGAAAATCAGG - Intergenic
980130911 4:128814931-128814953 TGGGGCTAAATGGGGAAATCTGG - Intronic
981770348 4:148300982-148301004 TGGGGCTCCATGAGGAAAACAGG - Intronic
982091127 4:151880798-151880820 TGGGGCTCAAGGGCAGAATTCGG - Intergenic
983519889 4:168697259-168697281 TCGGGTTCCAGAGGAAAATTTGG - Intronic
986006560 5:3673295-3673317 TGGGTTTCCAGGGTAAATTCAGG + Intergenic
986283143 5:6339782-6339804 TGTAGCTCCAGGGGAATATCTGG - Intergenic
986304842 5:6507367-6507389 GGGGGCTCCAGGGGAGAATCTGG - Intergenic
986647245 5:9929531-9929553 TGGGACTCAGAGGGAAAATCAGG + Intergenic
987164903 5:15187575-15187597 TGAGGCTGTAGGGGAGAATCTGG + Intergenic
988401640 5:30768894-30768916 TGGGGCTCTAGTGAAAAATACGG + Intergenic
990492206 5:56313648-56313670 TGGAGCTCCCAGGGAAAATAAGG + Intergenic
990624588 5:57597279-57597301 GGAGGCTCCAGGGGAGAATCTGG + Intergenic
994246130 5:97479242-97479264 CGGGGCTGTAGGGGAAAATTGGG + Intergenic
998367515 5:141640600-141640622 TGGAGCCCCAGGGGAAAAGCTGG + Exonic
998502267 5:142644057-142644079 TAGGGCTCCTGGGGACATTCTGG - Intronic
998861540 5:146448327-146448349 TGAGGTTCCAGGGGAAAAAAAGG - Intronic
999123156 5:149225708-149225730 TGGGGCTCAGGGGGAAAGGCTGG - Intronic
999615473 5:153418314-153418336 TGAGGCTGGAGGGGACAATCAGG - Intergenic
1001975815 5:175997499-175997521 TGGGGCACCTGGGGAGAATCAGG - Intronic
1002241610 5:177846273-177846295 TGGGGCACCTGGGGAGATTCAGG + Intergenic
1002707207 5:181170009-181170031 CGGGGCTGCAGGGGAAAGGCGGG - Intergenic
1002815806 6:678694-678716 TGGGGCTCCAGGGCAACAGGGGG + Intronic
1003280095 6:4683690-4683712 TGGAGATCCAGGGGGAAATTAGG + Intergenic
1004314405 6:14573157-14573179 TGGGACTTGAGGGGATAATCTGG - Intergenic
1004455424 6:15787415-15787437 TGGGGGTGGAGGGGAAAATGGGG + Intergenic
1005105031 6:22214719-22214741 TCTGGCTCCTGGTGAAAATCTGG + Intergenic
1007687092 6:43673435-43673457 TGGGGATGCAGAGGAAAAGCTGG + Intronic
1011897789 6:92253461-92253483 TGGTGCTACAGGGGATAACCAGG + Intergenic
1013003212 6:106045772-106045794 TGGGGGTGCGGGGGAAGATCTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1018764088 6:166916766-166916788 TGTGTCTCCATGGCAAAATCTGG + Intronic
1019070181 6:169339076-169339098 GGGGGCTCCAGGTGAAACTGGGG + Intergenic
1020451062 7:8320869-8320891 TGGGGCTACAAAGGTAAATCAGG - Intergenic
1021129342 7:16892276-16892298 AGGGCTTCCAGGGGAAAATAAGG + Intergenic
1022843070 7:34182927-34182949 AGGGGCTCCAGAGAAAAAGCTGG + Intergenic
1024285830 7:47756726-47756748 TGGAGCTCCAGGGTCACATCTGG - Intronic
1027917915 7:84349907-84349929 TGGAGCGCAAAGGGAAAATCTGG - Intronic
1028381842 7:90208843-90208865 GGGGGCTCCAGGGGGAAGTGGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029865568 7:103624340-103624362 TGGGGCTGGTGTGGAAAATCAGG + Intronic
1029946516 7:104539061-104539083 GGAGGCTCTAGGGGAAAATCTGG - Intronic
1030482273 7:110119809-110119831 TGGGGCTCCAGGCGCTAATGGGG - Intergenic
1030596948 7:111551620-111551642 AAGGGCTCCAGTGGCAAATCAGG + Intronic
1032339305 7:131056047-131056069 TGGAGCACTAGGGGAACATCAGG - Intergenic
1034378197 7:150665074-150665096 ATGGGCTCCAGTGGAAAACCAGG + Intergenic
1035041505 7:155931531-155931553 TGCGGATCCCGGGGAGAATCTGG + Intergenic
1035156310 7:156916485-156916507 TGGGGCTCAAGGGGACAACCGGG - Intergenic
1036923347 8:12879469-12879491 TGGGGCTCAAGGTAAAAATCTGG + Intergenic
1037916199 8:22774937-22774959 AGGGGCTCCTGGGGAAGAGCTGG - Intronic
1041809026 8:61887175-61887197 TGAGGCTGCAGGGGCCAATCTGG + Intergenic
1041946515 8:63449788-63449810 AGGGGGTCCAGGGGAAAATAAGG + Intergenic
1042593752 8:70423769-70423791 TGGGGTACCAGGGTAAAATTGGG + Intergenic
1044861355 8:96526797-96526819 TGGATCGTCAGGGGAAAATCAGG - Intronic
1046293633 8:112194498-112194520 AGGGGCTGCAGGGAAGAATCAGG - Intergenic
1048209419 8:132442615-132442637 TGGGGAACTAGGAGAAAATCTGG - Intronic
1048289286 8:133168070-133168092 TCGGGCTCCAGGGGAACTTAAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056951643 9:91044818-91044840 TGGAGCTCAAGGGGAGAAACTGG - Intergenic
1056965565 9:91160879-91160901 GGGGGCTCCAGGGGATACTGGGG + Intergenic
1057591788 9:96379358-96379380 TGGGGCGAGAGGGGAAAATAAGG - Intronic
1057600244 9:96450811-96450833 CGGGGCTCCGGGGGAAACGCTGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060624823 9:125102378-125102400 AGAGGCTGCAGGGGAAAATGAGG - Intronic
1060930968 9:127489383-127489405 TGGGGCTGCAGGGAAAAGTGTGG + Intronic
1061245918 9:129401308-129401330 GGTGACTCCAGGGGACAATCCGG + Intergenic
1061329022 9:129880722-129880744 TCGGGCTCCAGGGACAAAGCTGG - Exonic
1061752137 9:132786458-132786480 TGGGGGTCCAGGGGAGAAGCAGG - Intronic
1061898955 9:133663171-133663193 AGGGGCTCAAGGGGAAACTGAGG + Intergenic
1062694705 9:137867488-137867510 AGGGTCCCCTGGGGAAAATCTGG - Intronic
1202793632 9_KI270719v1_random:102675-102697 TTGGGCTCCAGGGGGATATCAGG + Intergenic
1187243121 X:17531276-17531298 TGGGGCACCAGGGGAAGAACTGG - Intronic
1187287181 X:17916867-17916889 TGGAGATCCTGGGGAAAATCAGG - Intergenic
1190197197 X:48329566-48329588 TGGGGCTCCAGGAGAAACAGAGG + Intergenic
1190327269 X:49214265-49214287 TAGTGCTGCAGGAGAAAATCAGG + Exonic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194824204 X:98541400-98541422 TGGGGCTCCTGGATAAACTCAGG - Intergenic