ID: 1161140908

View in Genome Browser
Species Human (GRCh38)
Location 19:2647247-2647269
Sequence CCCAGCACCCACGTTCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161140908_1161140915 10 Left 1161140908 19:2647247-2647269 CCCATAGGAACGTGGGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1161140915 19:2647280-2647302 CCTCGCTGGTGACAGTGCTTTGG 0: 1
1: 1
2: 0
3: 9
4: 108
1161140908_1161140916 11 Left 1161140908 19:2647247-2647269 CCCATAGGAACGTGGGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1161140916 19:2647281-2647303 CTCGCTGGTGACAGTGCTTTGGG No data
1161140908_1161140913 -4 Left 1161140908 19:2647247-2647269 CCCATAGGAACGTGGGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1161140913 19:2647266-2647288 TGGGTCTCTGGGAGCCTCGCTGG 0: 1
1: 0
2: 10
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161140908 Original CRISPR CCCAGCACCCACGTTCCTAT GGG (reversed) Intronic
900484229 1:2913946-2913968 TCCAGCACCCATGTTCCTGAGGG - Intergenic
901029720 1:6300051-6300073 CCCAGCACACACGGTCCTGCTGG - Intronic
901233290 1:7653049-7653071 CCCAGCATCCACGTCCTAATAGG - Intronic
913048695 1:115096127-115096149 CCCACCTTCCACCTTCCTATAGG + Intergenic
920210595 1:204325582-204325604 CTCAGCACACACGTTACTGTGGG + Intronic
921259699 1:213374870-213374892 CCCATCACACACGTTCCTGGAGG - Intergenic
922756645 1:228100666-228100688 CCCAGCTCCGACGTTCCAGTGGG + Intergenic
1067933115 10:50583339-50583361 CCCAGCACCCCCAATCCTCTTGG + Intronic
1068810633 10:61251962-61251984 CCCACCCCCCACCTTCCAATAGG + Intergenic
1069403939 10:68077930-68077952 CCCAGCACCCTTGTTTCTACGGG - Intergenic
1069662370 10:70132241-70132263 CCCAGCTCCCCCGAGCCTATGGG + Intronic
1073905858 10:108278714-108278736 CCAATCCCCCACCTTCCTATAGG - Intergenic
1074535613 10:114326488-114326510 CCCTGAATCCATGTTCCTATTGG - Intronic
1076466984 10:130689614-130689636 CACAGCAGTCACATTCCTATGGG + Intergenic
1077317757 11:1926963-1926985 CCCACCTCCCACCTTCCTGTTGG - Intronic
1077483621 11:2828145-2828167 CCCAGGAGCCATGTTCCCATGGG - Intronic
1079137824 11:17786212-17786234 CCCACCACCCACTGTCCTAAAGG - Intergenic
1083714292 11:64567024-64567046 CCCAGCTCCCACGCTCCCAGGGG - Intronic
1089212412 11:116814401-116814423 CCCAGCACACGCTCTCCTATGGG + Intergenic
1092264394 12:6970053-6970075 CGCAGCACCCACTATCCTAGGGG + Intronic
1094242405 12:28243254-28243276 CCCAGTAACCACTTCCCTATGGG - Intronic
1095953561 12:47794614-47794636 TCCAGCACCCAGGATCTTATAGG + Intronic
1096791176 12:54046205-54046227 CCCAGCAGCCCCGCTCTTATCGG + Intronic
1099006505 12:77240504-77240526 CCCTTCACCCACATTTCTATGGG - Intergenic
1101391309 12:104303140-104303162 CCCAGCACCCAGTTTCCTGCAGG + Intronic
1109896614 13:68700060-68700082 CCCAGAACCCCCAGTCCTATGGG + Intergenic
1117099765 14:52334297-52334319 CCCAGCTCCCAAGATCTTATTGG + Intergenic
1122347970 14:101072149-101072171 CCCAGCAGCCAGGTGTCTATAGG + Intergenic
1123204691 14:106701045-106701067 CCAAGCAGTCACGTTACTATAGG - Intergenic
1123209693 14:106747485-106747507 CCAAGCAGTCACGTTACTATAGG - Intergenic
1125615870 15:41012261-41012283 CCCAACAGCCAAGATCCTATAGG + Intronic
1127385327 15:58462189-58462211 CAAAGCACTCACGATCCTATAGG - Intronic
1127920890 15:63493289-63493311 CTCCTCAGCCACGTTCCTATGGG - Intergenic
1129582911 15:76831381-76831403 CCCAGCCCCCACCCTCCCATAGG + Intronic
1131891600 15:96977982-96978004 CCCAGCCCCCAGTTTCCTTTCGG + Intergenic
1133103377 16:3492507-3492529 CCCAGCTCCCAGGTCCCTCTGGG - Intergenic
1133430717 16:5734670-5734692 CCAAACACCCACATTGCTATTGG + Intergenic
1134119373 16:11572851-11572873 CCCAGCATCTACTTCCCTATGGG - Intronic
1143481415 17:7229555-7229577 CCCAGCACCAGCCTTCCTGTAGG + Intronic
1143537675 17:7550842-7550864 CCCATCACCCACCTTCATAATGG - Exonic
1145899839 17:28483290-28483312 CCCAGCACCAACCCTGCTATGGG + Intronic
1149376302 17:56047540-56047562 CCCAGCTCCCAAGTTGCTATGGG + Intergenic
1149540646 17:57465632-57465654 GCCAGCACCCACCCTCCCATGGG - Intronic
1152543260 17:80987749-80987771 CCCAGCACCCCGTTTCCCATTGG - Intergenic
1152751907 17:82066098-82066120 CCCAGCCCCCAAGTTCGCATTGG + Intergenic
1158594887 18:58807302-58807324 CCCAGCATTCAGGATCCTATCGG - Intergenic
1158862534 18:61606721-61606743 CCCACCACCCACGTTCTAAATGG - Intergenic
1159126789 18:64233367-64233389 CCCAGCCTCCACCTTCCAATAGG + Intergenic
1161003551 19:1923377-1923399 CCCAGCGCCTGGGTTCCTATGGG + Intronic
1161140908 19:2647247-2647269 CCCAGCACCCACGTTCCTATGGG - Intronic
1162386228 19:10362019-10362041 CCCAGCACCCACATCCCCAGGGG + Intronic
1163778068 19:19229484-19229506 CCCAGCACCCACTTTCCCTGTGG - Intronic
1165857638 19:38889570-38889592 CCCAGCACCCATGTACTTAATGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167478167 19:49712875-49712897 CCCAGCCCCCTCTTTCCTCTGGG - Intronic
926047810 2:9722860-9722882 ACCAGTACCCAATTTCCTATTGG - Intergenic
927093103 2:19727483-19727505 CCCAGCAGCCACGTTCCACAGGG + Intergenic
930590343 2:53319620-53319642 CCCACCACCCACCTTCCAAAAGG + Intergenic
932481317 2:72041167-72041189 CCCAGCACCCAGCATGCTATTGG + Intergenic
943997644 2:194791256-194791278 CCCACCCTCCACGTTCCAATAGG + Intergenic
1169632377 20:7647688-7647710 CACAGCACCCAGGTGCCTGTAGG + Intergenic
1170571478 20:17635237-17635259 TCCAGCACCCACCTGCCTAGCGG - Intronic
1173269894 20:41524111-41524133 TCCAGCACTGACCTTCCTATAGG + Intronic
1176019884 20:62957185-62957207 CCCAGCTCCCATCTTCCTCTGGG - Intronic
1176293166 21:5056786-5056808 CACAGCACCCACTTCCCTTTCGG + Intergenic
1178849973 21:36204948-36204970 CCCAGCACCAACATTTCTTTTGG + Intronic
1179864094 21:44206864-44206886 CACAGCACCCACTTCCCTTTCGG - Intergenic
1180105740 21:45617050-45617072 CCCAGCAGCCACCTTCCTGGAGG - Intergenic
1181752950 22:25002435-25002457 CCCAGCTCCCTCCTTCCTCTGGG - Intronic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
1185053328 22:48565041-48565063 CCCAGCCCCCACCTTACCATGGG - Intronic
958019729 3:87980846-87980868 CCCAGCACCCACTCTCATTTAGG - Intergenic
958090922 3:88875019-88875041 TCCAGCACCCACTTTCTGATGGG - Intergenic
958732809 3:97976760-97976782 CCTAACACCAACTTTCCTATAGG - Intergenic
961533175 3:127552405-127552427 CCCTGCACCCTCATACCTATGGG - Intergenic
965507203 3:169529791-169529813 TCCAGCACCCAAGTTCCTCTGGG + Intronic
967816228 3:193800768-193800790 CCCACCATCCACATTCCTTTAGG + Intergenic
968295576 3:197573967-197573989 ACCAGAACCCTCGTTCCTAAAGG - Intergenic
968810768 4:2798803-2798825 CCCAGCACCTGTGTTCCTAGAGG - Intronic
969590892 4:8121394-8121416 CCCGGCACCCACATTCCTGGAGG + Intronic
974084074 4:57240793-57240815 CCCATCATCCACTTACCTATAGG + Intergenic
974142626 4:57907332-57907354 CCCAGGACCCACGTTCCTGATGG - Intergenic
978764229 4:112387929-112387951 CCCATCATCCACCTTCCAATAGG + Intronic
988801006 5:34696756-34696778 CCCAGGACCCATTGTCCTATTGG + Intronic
989623809 5:43410577-43410599 CCCAGGACCCACCTTCACATGGG - Intronic
990583486 5:57187463-57187485 CCCAGCACCAACGATACCATAGG - Intronic
991501796 5:67284243-67284265 CCCAGAGGCCACGTTCCTATTGG - Intergenic
999125817 5:149245024-149245046 CCCTGGACCCAGGCTCCTATGGG - Intronic
1001761496 5:174211717-174211739 CCCAGCCCCCACATCCCTCTGGG + Intronic
1002172563 5:177383700-177383722 CCCAGCCCCTCCGTTCCCATCGG + Intronic
1003038289 6:2664103-2664125 TCCAGCACCCACTTCCCTTTAGG + Exonic
1020038318 7:4980066-4980088 CCTGGCATCCACCTTCCTATTGG + Intergenic
1020156929 7:5734107-5734129 CCTGGCATCCACCTTCCTATTGG - Intronic
1027363650 7:77434482-77434504 CCCAGCACCCTGTTTCCTGTTGG - Intergenic
1034901504 7:154910527-154910549 CCCCACACCCACATTCCTTTTGG + Intergenic
1035640287 8:1179496-1179518 CCCAGCAGCCAGGTGCCTGTGGG - Intergenic
1047124202 8:121942335-121942357 CCCAGAACCCATCTTCCTGTGGG - Intergenic
1053114695 9:35490425-35490447 CCCAGCACCCACCGTCCCTTTGG + Intronic
1056125986 9:83537347-83537369 CCCAGGACCCAGGTTCCTGCAGG + Intronic
1056510609 9:87301471-87301493 CCCAGGACTCAGGTTCCTTTTGG - Intergenic
1062562792 9:137149256-137149278 ACCCGCACCCACACTCCTATCGG + Intronic
1187671883 X:21675440-21675462 TCCAGCTCCAACGTTCCGATTGG + Intergenic
1192939349 X:75896478-75896500 CCCAGCAGCCAGGCACCTATTGG - Intergenic
1193524374 X:82571885-82571907 CACAGCACCCAAGTTCTTCTAGG - Intergenic
1201232728 Y:11880224-11880246 CCCAGCCCACACCTTCCTCTGGG + Intergenic