ID: 1161141207

View in Genome Browser
Species Human (GRCh38)
Location 19:2649054-2649076
Sequence TTATGTTCTGGGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161141197_1161141207 20 Left 1161141197 19:2649011-2649033 CCTGAGGAGCTGGGCCTACAGGT 0: 4
1: 432
2: 31660
3: 156991
4: 259218
Right 1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG 0: 1
1: 0
2: 1
3: 41
4: 447
1161141195_1161141207 23 Left 1161141195 19:2649008-2649030 CCTCCTGAGGAGCTGGGCCTACA 0: 6
1: 573
2: 45757
3: 167384
4: 228057
Right 1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG 0: 1
1: 0
2: 1
3: 41
4: 447
1161141200_1161141207 6 Left 1161141200 19:2649025-2649047 CCTACAGGTGGGCATCACTGTTG 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG 0: 1
1: 0
2: 1
3: 41
4: 447
1161141193_1161141207 29 Left 1161141193 19:2649002-2649024 CCTCAGCCTCCTGAGGAGCTGGG 0: 850
1: 98279
2: 205137
3: 247625
4: 258589
Right 1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG 0: 1
1: 0
2: 1
3: 41
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161141207 Original CRISPR TTATGTTCTGGGAAGGGGGA AGG Intronic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
903495235 1:23761875-23761897 TTTCTTTCTGGGAAGCGGGAGGG + Exonic
904716011 1:32468109-32468131 TTATTTTTTGAGATGGGGGATGG - Intronic
905238308 1:36565621-36565643 TTATGGGTTGGGGAGGGGGAAGG - Intergenic
905317660 1:37093833-37093855 TTGGCTTCTGGGAAGGTGGAGGG + Intergenic
905392816 1:37648897-37648919 TTGTTTTCTGGGAAGGGGAGGGG - Intergenic
905643534 1:39608873-39608895 TTATATTCTAGAAAGGGAGATGG + Intergenic
905869511 1:41395063-41395085 GCATGTTCTGTGAAGGGGGCAGG + Intergenic
907809449 1:57853863-57853885 TTATTTTCTGGGTTGAGGGAGGG + Intronic
909750449 1:79153681-79153703 AGATGATCTGTGAAGGGGGAGGG + Intergenic
909934971 1:81540741-81540763 TTATTCTCAGGAAAGGGGGAAGG + Intronic
910586638 1:88887420-88887442 TAATCTTCTGGGATGGGGGATGG + Intronic
910772346 1:90842831-90842853 TCATCTGCTGGGAGGGGGGAAGG - Intergenic
912538128 1:110391198-110391220 CTATGCTCAGGGCAGGGGGATGG + Intergenic
913400961 1:118432440-118432462 GTATGGTCTGGGATGGGGGTGGG + Intergenic
914807635 1:151003174-151003196 GTATGTTGTGTGAAGGGGCAGGG - Intronic
915190165 1:154143188-154143210 TTTTTTTTTGGGCAGGGGGAGGG - Intronic
915232254 1:154454346-154454368 TCATTTTCTGGGAGGGGGGTTGG + Intronic
915359883 1:155279484-155279506 TGAGGTTCTGTGGAGGGGGAAGG + Intronic
916092462 1:161318267-161318289 TTATATGCGGGGGAGGGGGAAGG - Intronic
916799238 1:168199912-168199934 TTAGGTTCCGTGAAGAGGGAAGG - Exonic
916916992 1:169417616-169417638 CTTTCTTCTAGGAAGGGGGAAGG - Intronic
917218697 1:172704556-172704578 TGGTGTTGGGGGAAGGGGGAGGG + Intergenic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917650433 1:177071361-177071383 TTGTGGTCAGGGAAGAGGGAAGG + Intronic
918421566 1:184369537-184369559 TTATTTTCTGGGATTGGGGGTGG + Intergenic
919765200 1:201122697-201122719 TTATATTCAGGGAACTGGGAAGG - Intronic
919878613 1:201888414-201888436 TTGTGTTCTGGGAATGGGGGCGG + Intergenic
920315078 1:205071114-205071136 ACAGGTTCTGGGAAGGGGCATGG + Intronic
920434819 1:205940924-205940946 CTGTGTTCTGGGAAGAGGAAAGG + Intronic
920974720 1:210775101-210775123 TTATGTGCTTGGAGGGGGCAGGG - Intronic
921261781 1:213390859-213390881 TTATGTTCTGGGGAGGCAAAGGG + Intergenic
922640036 1:227220850-227220872 TTTTGTTCTTGGATGGGGAATGG - Intronic
922872118 1:228911366-228911388 TCAAGTGCTGGAAAGGGGGAGGG - Intergenic
923797167 1:237168641-237168663 TTTTCTTTTGGGGAGGGGGAAGG + Intronic
923939809 1:238809376-238809398 TTATGGACTGGGAATGGGGAGGG + Intergenic
923963345 1:239107641-239107663 AGATGTTCAGGGAAGGGGCAAGG + Intergenic
1063497821 10:6526637-6526659 GCACGTTCTGGGAAGGCGGATGG + Intronic
1064366472 10:14713031-14713053 TTCAGTCCTGGGAAAGGGGAGGG - Intronic
1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG + Intergenic
1068151605 10:53139448-53139470 TTAGTTTCAGGGGAGGGGGAAGG + Intergenic
1068262026 10:54595043-54595065 GTATGGTTTGGGAAGGTGGAGGG - Intronic
1068365928 10:56049980-56050002 CTATCTTCTTGGAGGGGGGAGGG - Intergenic
1068432642 10:56952352-56952374 AGATGTTCTGGGAAGGAGCATGG + Intergenic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069663925 10:70142619-70142641 TGAGGTTCTGGCAAGTGGGAGGG + Intronic
1069948427 10:72002918-72002940 TTGCATTCTGGGAAGGGAGATGG + Intronic
1072620111 10:97074158-97074180 TTATGGTCTGGAGAGGGAGATGG - Intronic
1073217018 10:101842082-101842104 TTGAGACCTGGGAAGGGGGAGGG - Intronic
1073621109 10:105049471-105049493 TTAATTTCTGGGATGGGTGAGGG - Intronic
1073822355 10:107278963-107278985 TTTTGTTCTGGGATGTGTGAAGG + Intergenic
1074293817 10:112163209-112163231 TTATGTTCTTGTCAGTGGGATGG - Intronic
1074763923 10:116686817-116686839 TTATGGTTTGGGAAGGGGTGGGG - Intronic
1075931563 10:126301145-126301167 TTCTGTGCTGGGGAGAGGGAGGG - Intronic
1076100685 10:127775275-127775297 TTATGTTAAGGGAATGGGGGCGG - Intergenic
1076149399 10:128150193-128150215 TTGCGTCCTCGGAAGGGGGAGGG + Intergenic
1076501348 10:130938870-130938892 CTATGCTCTGGGCAGGGGGCTGG - Intergenic
1076918821 10:133440946-133440968 TTATGTTATGGTCTGGGGGAAGG + Intergenic
1077454455 11:2670053-2670075 TTCTGCTCTGGGGAGGGGGTTGG + Intronic
1078251193 11:9617870-9617892 TTGTGTTCTGTGTAGGGAGATGG + Intergenic
1080092209 11:28361647-28361669 TTCTTTTCTGGGTAGGGGGAGGG + Intergenic
1081259616 11:40943646-40943668 TTGTTTTCTGTGAAGGGGAAGGG + Intronic
1081859040 11:46321504-46321526 TTATGTTCTGGCAGGGGGTGTGG + Intergenic
1083118362 11:60486735-60486757 TAGTCTTCTGGGAAGGGGAATGG - Intergenic
1083386017 11:62310967-62310989 CCATGTTCTGGGAAGGGACAAGG + Intergenic
1083404785 11:62449088-62449110 TAAAGTTCTGGGAATGGGTAAGG + Intronic
1083784181 11:64934336-64934358 TTATTTATTGGGCAGGGGGAGGG + Exonic
1083798872 11:65034972-65034994 CCAAGTTCTGGGAAGGTGGAAGG - Intronic
1084035766 11:66509323-66509345 TTAGGGGCTGGGGAGGGGGAGGG + Exonic
1085043913 11:73342759-73342781 TTGTGTCCTGGGGCGGGGGATGG + Intronic
1086443467 11:86850645-86850667 TTAGTTTCAGGGGAGGGGGAAGG - Intronic
1089780045 11:120867313-120867335 TTATGTTCTGGGTAGCTGGAAGG + Intronic
1090823330 11:130364688-130364710 TTATAATCTTGGAATGGGGAAGG - Intergenic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091309495 11:134562478-134562500 GCTTGTTCTGGGAGGGGGGATGG + Intergenic
1091906492 12:4193717-4193739 TTCTCTCCTGGGAAGGGGGAGGG - Intergenic
1091951997 12:4600852-4600874 CTTTCTTCTAGGAAGGGGGAAGG - Intronic
1092133149 12:6126402-6126424 TTATCTTCTAGGTTGGGGGATGG - Intergenic
1092320511 12:7469006-7469028 TTATGTTCTTGGCAGGGACATGG + Intronic
1092613072 12:10191823-10191845 ATATGTTCTGGGTAGAGGTAAGG + Intergenic
1093050724 12:14501695-14501717 TTATTATCTGGCAATGGGGATGG - Intronic
1095377918 12:41553393-41553415 TTATTTTATGTGAAGTGGGAAGG + Intronic
1095907113 12:47389830-47389852 TTATTTTTTGGAGAGGGGGATGG + Intergenic
1096258272 12:50075633-50075655 GGCTGTTCTAGGAAGGGGGAAGG + Intronic
1096693881 12:53336766-53336788 GTATGTTGTGGGAAGAGGCATGG + Intronic
1096712167 12:53465289-53465311 TTATGTTGTGGGGGGGAGGAGGG + Intronic
1097717205 12:62979606-62979628 TCATTTTCTGGGAACGAGGAGGG + Intergenic
1099059945 12:77895339-77895361 TTATTTTGTGGGGAGGAGGAAGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099615293 12:84926882-84926904 TTATTTTCTGGGAAAGGGAGAGG + Intergenic
1099983447 12:89634164-89634186 ATATGTTCTGGGATTGGAGAAGG - Intronic
1100865647 12:98853963-98853985 TTATGATCTGGGACCAGGGATGG + Intronic
1101653294 12:106696714-106696736 TGATGTTCTGGGAAGGGACTGGG - Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102482464 12:113233198-113233220 TTGTGTGCGGGAAAGGGGGACGG - Intronic
1102551393 12:113694675-113694697 TTATTTGCCTGGAAGGGGGATGG + Intergenic
1102721356 12:115019139-115019161 TTAGGTCCTGGAAAGGGAGAAGG + Intergenic
1102747815 12:115265374-115265396 TTATTTTGTGGGAAGAGGGCAGG + Intergenic
1103018619 12:117515531-117515553 TTATGTTCTAAGGTGGGGGAGGG + Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104588306 12:130064602-130064624 TTCTGTTCTAGGATGTGGGAGGG + Intergenic
1104597931 12:130132653-130132675 CCATGTTCTGGGAAGGAGGAAGG - Intergenic
1104803289 12:131569354-131569376 TTATGTCCTGAGGAGAGGGAGGG - Intergenic
1105061279 12:133153533-133153555 TGATGTTCTGGGTTGGGGAAAGG + Intronic
1107986544 13:45781367-45781389 TTAGGTTCTGGGAAGGGGATTGG + Exonic
1108049978 13:46424177-46424199 TTATGTTCTGGTTAGGGGATGGG - Intronic
1108171036 13:47742178-47742200 GTCTGTTCTGGGGTGGGGGAAGG + Intergenic
1108867719 13:54941883-54941905 TTAGTTTCGGGGGAGGGGGACGG + Intergenic
1109272339 13:60268468-60268490 TTAGTTTCGGGGGAGGGGGAAGG + Intergenic
1109370340 13:61414058-61414080 TTTGCTTCTGGGAACGGGGATGG - Intronic
1109542497 13:63797465-63797487 TTATGTTCTGGTTAGGGGATGGG - Intergenic
1110427395 13:75383974-75383996 TTATCTCCGAGGAAGGGGGAGGG + Intronic
1112649761 13:101382287-101382309 TTGTGTTATGGGGAGGGGGGCGG + Intronic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1113569839 13:111346033-111346055 TTGTTTTCAGGGAAGGGGGCAGG - Intergenic
1114534705 14:23415500-23415522 TGGTGTTCTGGGTTGGGGGAGGG + Exonic
1114535877 14:23422134-23422156 TTATGGGCTGGGGAGGAGGAAGG + Intronic
1114715228 14:24817483-24817505 TTCAGTTCTGGGAAGGGTGATGG - Intronic
1115196300 14:30803659-30803681 TTCTGTTCTGGGATAGGGGAAGG + Intergenic
1115859391 14:37667317-37667339 TAATGTGCTGGGCAGGGGGTGGG - Intronic
1116326652 14:43538989-43539011 TTAGTTTCGGGGGAGGGGGAAGG - Intergenic
1116939173 14:50773263-50773285 TTAGTTTGTGGGAAGGAGGAGGG - Intronic
1117183736 14:53218115-53218137 TTATTTCCTGGGAAGGGGCTTGG - Intergenic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1118077589 14:62317698-62317720 TTATGTTCTAGAGAGGGTGAAGG - Intergenic
1118500390 14:66356847-66356869 TTATTGTCTGGGGAGGAGGAGGG - Intergenic
1118597658 14:67448576-67448598 TGAAGTTTGGGGAAGGGGGATGG + Intronic
1118845491 14:69544902-69544924 TTATGTTCTGGCAGGGGAGATGG + Intergenic
1118892468 14:69921617-69921639 TTGTATTCTGGGGAGGGTGAGGG + Intronic
1119815152 14:77559474-77559496 TTATGATCTGAGAATGAGGAGGG + Intronic
1119856985 14:77908291-77908313 TTGAGATCTGGGAAGTGGGAAGG - Intronic
1119996654 14:79261098-79261120 TGATGTGCTGGGAAGGGGTGAGG + Intronic
1120189075 14:81423624-81423646 TTTTGTTGGGGGAAGAGGGAGGG - Intronic
1121587284 14:95070883-95070905 TAATGTCCGGGGAAGGGGGAGGG + Intergenic
1121888503 14:97566963-97566985 TTATGTCATGGGCAGGAGGATGG + Intergenic
1122034753 14:98939218-98939240 TGATCTTCTGGGAAGATGGATGG - Intergenic
1123076193 14:105668515-105668537 TCATCTTCTGGGATGGGGGCAGG + Intergenic
1124176638 15:27431588-27431610 TTGTCTTGTTGGAAGGGGGAAGG + Intronic
1124213822 15:27789200-27789222 TTTTTTTCTGGGCGGGGGGAGGG + Intronic
1125327335 15:38549225-38549247 TCATGAACTGGGAAGGAGGAAGG + Intronic
1127155257 15:56117629-56117651 CTAGGTGCTGGGAAAGGGGATGG - Intronic
1127678708 15:61271573-61271595 GTATGTGCTGGGAATGGGGCAGG + Intergenic
1127700824 15:61498784-61498806 TTATTATTTGGGAAGGAGGAAGG + Intergenic
1127775054 15:62257985-62258007 TGATGTGCTGGGAGGTGGGAAGG - Intergenic
1127784868 15:62346793-62346815 TTATGTTCTAGAATGGGGGTTGG + Intergenic
1128614613 15:69099433-69099455 TCTTGTCCTGTGAAGGGGGATGG + Intergenic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1130145431 15:81270420-81270442 TTATGGTCTGTCCAGGGGGAGGG + Intronic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1131021155 15:89100055-89100077 TTATGGTCTGGAATGGGAGAAGG + Intronic
1131477034 15:92748715-92748737 TTTTATTCTGGGGATGGGGAAGG + Intronic
1132789790 16:1678967-1678989 CTATCTCCTGGGAAGGTGGATGG + Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133128073 16:3659229-3659251 TTTAGGTCTGGAAAGGGGGAAGG + Exonic
1133775516 16:8892162-8892184 TTTTGTTCTGGGCTGGGGGTTGG - Exonic
1133921251 16:10155305-10155327 TCATTTTCTGTGATGGGGGATGG - Intronic
1135727799 16:24870387-24870409 TTTTTTTGTGGGGAGGGGGACGG - Intronic
1135826048 16:25729873-25729895 TAATGCTCTGGAAAGGCGGAGGG - Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1137368798 16:47885479-47885501 TTTTTTTCTGGGAAGAGAGAAGG - Intergenic
1137606484 16:49790061-49790083 TTATGTCCTGGGGTGTGGGATGG - Intronic
1138939997 16:61778488-61778510 TTTTGTTGTGGGAAGGGGCAGGG + Intronic
1140770526 16:78199720-78199742 TTTTTTTATGGGAAGGGGGTAGG - Intronic
1141036768 16:80633372-80633394 CTCTGTTCTAGGAAGAGGGAAGG + Intronic
1141225411 16:82110437-82110459 GTGAGTTCTGGGAAGGGGGGTGG - Intergenic
1141600016 16:85119988-85120010 AGATGTTCTGGGATGTGGGATGG - Intergenic
1143159243 17:4858283-4858305 TTTTCATCTGGGAGGGGGGAGGG + Intronic
1143302718 17:5922737-5922759 TGATGTCTTGGCAAGGGGGAGGG - Intronic
1143513069 17:7406364-7406386 TCTTGTTGTGGGGAGGGGGAGGG + Intronic
1143557214 17:7669411-7669433 TTTTGTTGTGGGGAGGAGGATGG - Exonic
1143955624 17:10666168-10666190 TTATAATCTGGAAATGGGGAAGG + Intergenic
1144340944 17:14309893-14309915 TTTGGGTCTGGGAAGCGGGAGGG + Intronic
1145247145 17:21276755-21276777 TTCGGTTCTGGGAAGCTGGAAGG + Intergenic
1145757504 17:27403436-27403458 TTATGCTCTGGGGAGGTGGGAGG - Intergenic
1146241974 17:31238263-31238285 TTATGCTTTGGGCAGGGGAAGGG + Intronic
1146571972 17:33960846-33960868 TTATATTCTGGGATAGGGGCAGG - Intronic
1146634184 17:34491905-34491927 TGAGATTCTGGGAAGGGGAATGG - Intergenic
1147212201 17:38878186-38878208 TCCTGTTCTGGGCAGGGGGCTGG + Intronic
1147436718 17:40421027-40421049 ATAGGCTCTGGGAAGAGGGAGGG - Intergenic
1147610187 17:41797452-41797474 TCATGTTCAGGGAGGTGGGAGGG - Intergenic
1148698885 17:49576559-49576581 TGAGGCTCTGGGAAGGGGTAGGG - Intronic
1149379880 17:56082708-56082730 TTATGCTTTGGGGAGGTGGATGG + Intergenic
1149662123 17:58339448-58339470 GTATTTTCCGGGATGGGGGAAGG + Intergenic
1150013179 17:61525379-61525401 TGCTGTTCTGGGATGTGGGATGG - Intergenic
1150280240 17:63925866-63925888 CTGTGTTCTGGGGAGGGGGCAGG + Intergenic
1150727240 17:67661351-67661373 AGAGATTCTGGGAAGGGGGAAGG - Intronic
1152276481 17:79360858-79360880 TTATGTTGGGGGAAGGGGAGTGG + Intronic
1152379605 17:79935472-79935494 CCATGTTCTGAGATGGGGGAGGG - Exonic
1153174161 18:2351751-2351773 TTAGTTTCAGGGAAGGGGCAAGG + Intergenic
1153333894 18:3902019-3902041 TACTGTGCTGGGAAGTGGGAAGG - Intronic
1153519665 18:5939862-5939884 TGCTGTTCTGGGAAGGCGGTGGG + Intergenic
1153850398 18:9088833-9088855 TTATCTTCTGGGAAGTGCTATGG - Intergenic
1155516506 18:26628739-26628761 TTATTTTTGGGGAAGGGGTATGG + Intronic
1155790134 18:29956812-29956834 TTATGTTTAGGGAAGGGATAGGG + Intergenic
1156280607 18:35633536-35633558 GTCTGTTGTGGGATGGGGGAGGG + Intronic
1156496246 18:37527106-37527128 TTATATTCTTGCAAAGGGGATGG - Intronic
1157045251 18:44095000-44095022 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
1157776186 18:50398210-50398232 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
1158484389 18:57852336-57852358 TCATGTTCTTGGAATAGGGAAGG - Intergenic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1161193237 19:2971301-2971323 TGAAGTTCTGGGACGGGGGAGGG + Intergenic
1161761705 19:6178158-6178180 TTATGTTGAGAGAATGGGGAAGG - Intronic
1161813584 19:6485300-6485322 TTTTTTTTTGGGTAGGGGGATGG - Intergenic
1162001545 19:7747423-7747445 TGGGATTCTGGGAAGGGGGAAGG - Intronic
1163755856 19:19105836-19105858 TTTCGTTGTGGGAAGAGGGAAGG - Intronic
1164714457 19:30381314-30381336 TTAAGTTATGGGGAGGGAGAAGG + Intronic
1165637575 19:37355109-37355131 ATATGTACTGAGAAAGGGGAAGG - Intronic
1166366988 19:42282869-42282891 TTTTTTTCTGGGAGGGGGGGCGG + Intronic
1167233438 19:48299047-48299069 TTCCGCTCTGGGAATGGGGATGG - Intronic
1167335524 19:48883285-48883307 TAATTTTCTGGGAAAGGGGTGGG - Intronic
1167999535 19:53433403-53433425 TCTTGTTCTGGGAAGGTGGGGGG + Intronic
1168267264 19:55229740-55229762 TTACGTTCTGGGATGCGGGGTGG - Intergenic
925248975 2:2413051-2413073 GTCTGTTGTGGGATGGGGGAAGG - Intergenic
925886046 2:8394439-8394461 TCAGGTGCTGGGCAGGGGGAAGG - Intergenic
927606890 2:24493026-24493048 TGATGTTGTAGGAAGGGGGTCGG + Intronic
928855347 2:35796635-35796657 TCATGTTCTGGGCCGGGGCATGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929920702 2:46169232-46169254 GTTTGTGCTGGGGAGGGGGATGG + Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930964384 2:57303542-57303564 TGATATGCTGGGAAGGGGAAGGG + Intergenic
931522091 2:63109318-63109340 TTATGTTCTGGGGACAGGGTTGG + Intergenic
932440619 2:71732386-71732408 TTGTGTTCTGGCCAGGGGGAAGG - Intergenic
932587426 2:73040276-73040298 TTTTGTTTTGGGGAGGGGTAAGG - Intronic
933248258 2:79999776-79999798 TTATGTTCTAGTAAGAGAGATGG + Intronic
933307810 2:80623743-80623765 TTGTGTGCTGGGGAGTGGGATGG - Intronic
933505303 2:83169812-83169834 TTATGTTCTGGTGAGAGAGATGG + Intergenic
934300958 2:91775803-91775825 ACGTGTTCTGGGAAGCGGGAAGG + Intergenic
934571689 2:95376674-95376696 TTCTGCTCTGGGAAGGAGGAGGG + Intronic
934679782 2:96275210-96275232 ATTTGTTCTGGCATGGGGGAAGG - Intronic
936409328 2:112241205-112241227 TTGTGTTCTGGAGAGGGAGAGGG - Intronic
937090462 2:119202818-119202840 TGAGGTGATGGGAAGGGGGAGGG - Intergenic
938574335 2:132589872-132589894 TTTTATTAAGGGAAGGGGGAAGG + Intronic
938735259 2:134180105-134180127 ATATTTTCTGGGAAAGGGGTGGG - Intronic
939404248 2:141735505-141735527 TTTTTTTTTGGGAGGGGGGAGGG + Intronic
939528691 2:143329395-143329417 TTATGTTCTGAGTATGGAGAGGG + Intronic
940008131 2:149028379-149028401 TTGTGATCTGGGCATGGGGAAGG - Intergenic
940521029 2:154748048-154748070 TTATATTTTGGGATGGGAGATGG - Intronic
940526970 2:154828400-154828422 CCATGTTCTGGGAGTGGGGAAGG + Intronic
941132009 2:161662997-161663019 TTAAGTTGGGGGAAGGGGGGTGG - Intronic
944853021 2:203739537-203739559 TCATCTTCTGGGTAGGGGAAGGG + Intergenic
1168876157 20:1173692-1173714 TTAAGTCCTGGGCAGGGGGAAGG + Intronic
1168949021 20:1783855-1783877 TTAGGGCCTGGGAAGGGAGATGG - Intergenic
1169150010 20:3282141-3282163 GTGTGTTCTGAGAAGTGGGAAGG - Intronic
1169524964 20:6414334-6414356 TTTTTTTCTTGGAAGTGGGAGGG + Intergenic
1169551595 20:6707085-6707107 TAAGGTTATGGGGAGGGGGACGG + Intergenic
1170509914 20:17065842-17065864 TGATGTTCAGGGAAGGAGAAGGG + Intergenic
1170792918 20:19522401-19522423 AGATGTTCTGGTAAGGAGGAAGG + Intronic
1171086001 20:22239017-22239039 TGATGTACTGGGAATGTGGATGG - Intergenic
1172468715 20:35175512-35175534 TGATGGTGGGGGAAGGGGGACGG - Intronic
1174396069 20:50247593-50247615 TGATGTTCTGGGAATGGGTGTGG - Intergenic
1174626631 20:51920370-51920392 TTTTTTTTTGGGTAGGGGGATGG + Intergenic
1174969231 20:55255192-55255214 TTACATTAAGGGAAGGGGGAGGG - Intergenic
1175336467 20:58199343-58199365 TTAGGCTCTGGGGAGAGGGAAGG + Intergenic
1175376201 20:58525661-58525683 GCATGCTCTGGGAAGGGGGCAGG + Intergenic
1175627300 20:60500274-60500296 TGAGGTTATGGGAATGGGGATGG + Intergenic
1175627308 20:60500299-60500321 TGAGGTTATGGGAATGGGGATGG + Intergenic
1175627401 20:60500723-60500745 TGAGGTTATGGGAATGGGGATGG + Intergenic
1176417515 21:6486061-6486083 TTTTTTTTTTGGAAGGGGGAGGG + Intergenic
1178456255 21:32754793-32754815 ACATGTTGTGGGTAGGGGGAGGG - Intronic
1179511578 21:41877306-41877328 TAATGTTCTGGGCAGGGGAGTGG - Intronic
1179693011 21:43094394-43094416 TTTTTTTTTTGGAAGGGGGAGGG + Intronic
1180753389 22:18142031-18142053 TTCTAAGCTGGGAAGGGGGAGGG + Intronic
1181011728 22:20044765-20044787 TGATGTCCTTGGAAGGTGGAAGG + Intronic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182125192 22:27810908-27810930 TTCTGCTCAGGGAAGGGGGGCGG - Intergenic
1183129358 22:35818980-35819002 TTTTGTTCTGGGAAAGGGATAGG - Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1184754336 22:46507804-46507826 TTAGGTTCTGGGAAAGAGGCAGG - Intronic
1184962374 22:47940880-47940902 TTTTGTTGTGGGGTGGGGGACGG + Intergenic
1185009351 22:48304647-48304669 TTTTGATGGGGGAAGGGGGATGG - Intergenic
1185219082 22:49620102-49620124 TTATGTTAAGGGCAGGGGGACGG - Intronic
949414464 3:3800126-3800148 TTTTTTTTTGGCAAGGGGGACGG - Intronic
949643511 3:6066969-6066991 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
949971017 3:9404680-9404702 TAATTATCTGGGAAGGGGGAGGG - Intronic
951704006 3:25525634-25525656 TTATGTTCAGGGTTGGGAGAGGG + Intronic
952103630 3:30043961-30043983 TGATATTGTGGGAAAGGGGAGGG - Intergenic
952107200 3:30084455-30084477 ATAGGTCCTGGGAAGAGGGAGGG + Intergenic
953846827 3:46434052-46434074 CCATGCTCTGGGAAGGGGGTGGG + Intergenic
954456168 3:50600921-50600943 TTCTGAGCAGGGAAGGGGGATGG + Intergenic
955000922 3:54927329-54927351 TGATATTCTGGAAAGGGGAAGGG - Intronic
955305395 3:57825811-57825833 TTTTGTGCTGGAGAGGGGGATGG + Intronic
956707482 3:72011754-72011776 TCATGGTCTGGGAAGGGAGGAGG + Intergenic
956810724 3:72861688-72861710 TTATGCTGTGGGAAGAGAGAAGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957394569 3:79621242-79621264 TTCTGTTGTGGGCAGGGGCAGGG - Intronic
957916877 3:86696772-86696794 TTAGTTTCAGGGGAGGGGGAAGG + Intergenic
959223709 3:103554746-103554768 TTAGTTTCGGGGGAGGGGGAAGG + Intergenic
959538119 3:107510022-107510044 TTATGTTCTGTGAAGGTGTCAGG + Intergenic
960042196 3:113162068-113162090 TTAGGTTCTAGGCAGGTGGATGG + Intergenic
960069142 3:113409489-113409511 TTATGTTATATGAAAGGGGAGGG + Intronic
960952230 3:123006829-123006851 TTCTGTTCTGAGAATGGGGGTGG - Intronic
961123155 3:124391251-124391273 TTCTTTTCTGGGGAGGGGGTGGG + Intronic
963205910 3:142634213-142634235 TTATGTTCCCTGAAGGAGGAGGG + Intronic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964917368 3:161853787-161853809 TTAGTTTCAGGGGAGGGGGAAGG + Intergenic
965252229 3:166356451-166356473 TTAAGTGGTGGGATGGGGGAGGG + Intergenic
965733012 3:171792415-171792437 TTATATTCTGGGAATGCAGATGG + Intronic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966919204 3:184601545-184601567 TTCTGTTCTGGGGTGGGGGGAGG + Intronic
967903357 3:194480314-194480336 TTATGTCCTGGGAGAGGGCATGG - Intronic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
969143923 4:5103298-5103320 GTAAGCTCTGGGAAGGGAGAAGG - Intronic
970236127 4:13960005-13960027 TGCTGTTCTGTGAAGGGGAATGG + Intergenic
970894157 4:21083290-21083312 TCATTTTCTGAGGAGGGGGAAGG - Intronic
971382137 4:26108697-26108719 CTATGTTCTGGTAAGGGGAGTGG + Intergenic
971850185 4:31975394-31975416 TTTTCTTCTGGGAATGGGGAAGG + Intergenic
971854162 4:32022781-32022803 TTAGTTTCGGGGGAGGGGGAAGG - Intergenic
972179410 4:36444923-36444945 TTATGTTCAGGGCAGGAGAAGGG + Intergenic
972880736 4:43418687-43418709 TTAGTTTCGGGGAAAGGGGAAGG + Intergenic
974626541 4:64433311-64433333 TTAGGGGCTGGGGAGGGGGAGGG + Intergenic
975001257 4:69225116-69225138 TTAGTTTCAGGGGAGGGGGAAGG + Intergenic
975004181 4:69267167-69267189 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
975012591 4:69376131-69376153 TTAGTTTCAGGGGAGGGGGAAGG - Intronic
975800967 4:78058657-78058679 TTTTGTTCTGGGAAGCAGGCTGG - Intronic
978231870 4:106409624-106409646 TTAGTTTTTGGGGAGGGGGAAGG - Intergenic
978777730 4:112519982-112520004 AAATGTTCTGTGAAGGGGGAGGG + Intergenic
979922131 4:126511478-126511500 TTACAGTCTGGGAAGGGGAAAGG - Intergenic
980112467 4:128647891-128647913 TTCTGTTGTGGGGTGGGGGAGGG + Intergenic
980273954 4:130623641-130623663 TTATGTTCTTTGAAGGGACATGG + Intergenic
980897697 4:138875564-138875586 GAATGGTCTGGGAAGGGGAAGGG + Intergenic
981227920 4:142318549-142318571 TTATGTTCCAGGAAGGGACAGGG - Intronic
981489542 4:145325200-145325222 TTATGTTCTGGGAGGTGGGGTGG + Intergenic
982439699 4:155421514-155421536 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
983046667 4:162995466-162995488 TTATGTTCTTTGCAGGGGCATGG + Intergenic
984059393 4:174973494-174973516 ATATGTTCTGGGGAGTAGGACGG + Intronic
984290582 4:177789130-177789152 TTAGTTTCAGGGGAGGGGGAAGG - Intronic
987283176 5:16430736-16430758 GTATGATGTGGGAAGTGGGATGG - Intergenic
988915427 5:35889202-35889224 TTATTTTCTGGGAATGAGAAAGG - Intergenic
989204593 5:38798130-38798152 AAATGATCTGGAAAGGGGGAGGG - Intergenic
989240804 5:39201587-39201609 TTTTGTTGGGGGAAGGGAGAGGG - Intronic
990327202 5:54690247-54690269 TTCTGGTCAGGGAAGGGGAAAGG - Intergenic
991602831 5:68370659-68370681 TTATGCCCTGGGAAGGAGGAAGG + Intergenic
992012614 5:72544355-72544377 TGGGGTTCGGGGAAGGGGGAGGG - Intergenic
992269538 5:75051590-75051612 TTGTTTTCTAGGAAGGGAGAGGG - Intergenic
993511190 5:88773375-88773397 TTATGTACGAGGATGGGGGATGG - Intronic
994030463 5:95136076-95136098 AAATGTTCTGGGAAGGTAGAAGG - Intronic
994102462 5:95908876-95908898 TTTCTTTCTGGGAAGGGGGATGG + Intronic
994342557 5:98648435-98648457 TTATGTTCTTAGAATAGGGAAGG - Intergenic
994735447 5:103548189-103548211 TTAGGTTCTGGGGGGGGGGAGGG - Intergenic
994908617 5:105872703-105872725 TTAGTTTCAGGGAACGGGGAAGG - Intergenic
995834153 5:116383777-116383799 TGATACTCTGGGGAGGGGGATGG - Intronic
996488545 5:124065493-124065515 TTATTTTCTGTGAAGTGGGTGGG + Intergenic
996827698 5:127703796-127703818 TACTGATGTGGGAAGGGGGAGGG + Intergenic
997000821 5:129759623-129759645 TTATGCTTTGGGCAGGGGGAGGG + Intronic
997119235 5:131157235-131157257 TTATGTTGAGGGAAGGTGTAGGG - Intergenic
997454823 5:134008605-134008627 CTATGTTCTTGAAAGGGGGGTGG - Intergenic
998023967 5:138797362-138797384 TTATGTCCTGGGAAAGGGATGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998309325 5:141111507-141111529 TTGTGTGGTGGGAGGGGGGAGGG - Intronic
998539831 5:142970256-142970278 TTATGTTCTAGGAGAGGGTAAGG + Intronic
999039568 5:148392405-148392427 CTTTGTTTTGGGGAGGGGGAGGG + Intronic
999142173 5:149369723-149369745 GTATCTTCTGGGGAAGGGGAGGG + Intergenic
1000728777 5:164804659-164804681 TTAAGTTCTGAGAAGAGGGAAGG + Intergenic
1000728839 5:164805504-164805526 TTAAGTTCTGAGAAGAGGGAAGG + Intergenic
1000857152 5:166412785-166412807 ATATTTTCTGAGAAGAGGGAAGG + Intergenic
1000999713 5:167994327-167994349 TTATGTTGAGGGAAGGGGCAAGG - Intronic
1001275466 5:170347723-170347745 ATCTGGTCTGGGAAGGGAGACGG - Intergenic
1001461636 5:171920364-171920386 ATATGTTCGGTGAAGGAGGATGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002439007 5:179254372-179254394 CTATGAGCTGGGAAGGGGAATGG + Intronic
1002854538 6:1025696-1025718 TGATGTCCTGGGATGTGGGATGG + Intergenic
1003427394 6:6006864-6006886 TTATGCACTGGGAAGGCAGAGGG + Exonic
1004256716 6:14071260-14071282 TTATGTGCTGGGGGTGGGGAGGG + Intergenic
1005402528 6:25449368-25449390 TTAGGTTCTGAGGAGGAGGATGG + Intronic
1006234484 6:32616659-32616681 TTTAGTTTTGGGGAGGGGGAAGG - Intergenic
1006544775 6:34770778-34770800 CCATTTTGTGGGAAGGGGGAAGG + Intronic
1007173092 6:39878301-39878323 TTATGGGCTGGGCAGGGGAAGGG - Intronic
1007496245 6:42261868-42261890 TTATGGACTGGGGAGGGGCAAGG - Intronic
1007740844 6:44008622-44008644 TAATGGGCTGGGAAGGGGCACGG + Intergenic
1007762114 6:44139290-44139312 CTATTTTCTGTGAAGGGAGAGGG - Intronic
1007935458 6:45728341-45728363 GTATGTTCTGGGCAGAGGAAAGG + Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1009670644 6:66744917-66744939 TTATGGGCTGGCAAGGGGAAAGG - Intergenic
1010432566 6:75795386-75795408 TTATGAGCTGGGAAGGTGTATGG + Intronic
1010437440 6:75849974-75849996 TTAGTTTCAGGGGAGGGGGAAGG + Intronic
1010568315 6:77445829-77445851 ATACTTTGTGGGAAGGGGGAAGG + Intergenic
1010591130 6:77713456-77713478 TTATGTTGTGGAAAAGGGTAGGG + Intronic
1010683824 6:78828545-78828567 TTATTATCTGGGAAGGTTGATGG - Intergenic
1011000615 6:82584144-82584166 TTATGGTCTGGGGAGAGGGATGG + Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011382273 6:86755403-86755425 TCATGTTTTGGGAAGGTGAAGGG - Intergenic
1012371242 6:98509897-98509919 CAATGTTCTGGGCAGAGGGAAGG + Intergenic
1012386188 6:98685941-98685963 TTTTTTTTTGGGTAGGGGGACGG - Intergenic
1014198364 6:118583339-118583361 TTGTGCTCTGGGAAGAGGGGAGG - Intronic
1014281624 6:119448052-119448074 TTATTTTGTGGGAAGTGGGGTGG - Intergenic
1014384022 6:120779374-120779396 TTATGTGCTGGCATGGGAGATGG - Intergenic
1015616958 6:135087515-135087537 TTATGGGTTGGGAAGGGGAAGGG - Intronic
1015726696 6:136306717-136306739 TTATTCTCTGGGTAGTGGGAGGG - Intergenic
1015889195 6:137952373-137952395 ATATGTACTCCGAAGGGGGAGGG + Intergenic
1016524633 6:144987489-144987511 TTGTGTTCTCTGAAGGGGAAAGG - Intergenic
1021213916 7:17891984-17892006 TTTTGGGCTGGGAAAGGGGAGGG - Intronic
1021540608 7:21753210-21753232 TCATGTTCCAGGCAGGGGGAAGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1022200788 7:28114980-28115002 GTATGTGCAGGGAAGGGGAATGG + Intronic
1022922782 7:35033362-35033384 TTACATTCTGGAAGGGGGGATGG - Intronic
1022992475 7:35721975-35721997 TTATTTTCTGTGAAGGGTCAGGG - Intergenic
1023918399 7:44607419-44607441 CTATGTTCTGGGCAAAGGGATGG - Intronic
1024609576 7:51053048-51053070 ATATGTGCTGGGAAGGGAGAGGG - Intronic
1024759881 7:52582956-52582978 TTGTGCTTTGGGCAGGGGGAGGG + Intergenic
1026097906 7:67361336-67361358 ATATGGTCTAGAAAGGGGGAGGG + Intergenic
1026304130 7:69125217-69125239 TTATGTTAAGAGCAGGGGGAAGG + Intergenic
1029284140 7:99454542-99454564 TTATGTACTGGGGGAGGGGATGG - Intronic
1029450778 7:100640946-100640968 TTCACTTCTGGGGAGGGGGACGG + Intronic
1029451933 7:100646370-100646392 CTAGGTTCTGGGAAGGGACAGGG + Intronic
1029503727 7:100949730-100949752 TGATGTTCCAGGAAAGGGGAGGG + Intronic
1029950043 7:104574304-104574326 TTAAGTTCTACGAAGGGGGCAGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1033728998 7:144155267-144155289 TTATGTTCTTGAAAGTGGGATGG - Intergenic
1034422425 7:150996628-150996650 TTAGGATCTGGGAAGGGAGGGGG - Intronic
1034454525 7:151159919-151159941 TTGTCTTCTGGGATTGGGGAGGG - Intronic
1034507903 7:151509616-151509638 TGCTGTTCTGTGAAGTGGGAGGG - Intronic
1034853994 7:154523166-154523188 ATATTTTCTTGAAAGGGGGAAGG + Intronic
1035034489 7:155886043-155886065 TTCAGTTCTGGGAAGGAGGTTGG + Intergenic
1035849992 8:2909089-2909111 TTATTGTCTAGGATGGGGGAAGG - Intergenic
1036144939 8:6246120-6246142 TTATCTTTAGGTAAGGGGGAAGG + Intergenic
1036776300 8:11615106-11615128 GTTTGTTCTGGGAAGGGAGAGGG + Intergenic
1036917511 8:12818777-12818799 TTATGTTCTGGAGTGGGGTAGGG - Intergenic
1038451905 8:27644982-27645004 TTCTGTTCTGCGAAGGGGAGGGG + Intronic
1038724302 8:30066634-30066656 AGATTCTCTGGGAAGGGGGAAGG - Intronic
1039749172 8:40461108-40461130 ATATTTTTTGGGTAGGGGGAAGG + Intergenic
1039803251 8:40977882-40977904 TTATGGTCAGGTAAGGGAGAAGG - Intergenic
1041008496 8:53518728-53518750 TTATTTTCAGGGAGGGGAGAAGG + Intergenic
1041090611 8:54297857-54297879 CTAGGTTTTGGAAAGGGGGAGGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1043479561 8:80639088-80639110 CAAAGTTCTGGGATGGGGGATGG + Exonic
1043542030 8:81274966-81274988 TGATGTGCTGGGCAGGGAGAAGG + Intergenic
1044184717 8:89237786-89237808 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
1045290554 8:100828967-100828989 TAATTTTCTGGGAAAGGGGTGGG - Intergenic
1047009986 8:120661877-120661899 GTATGTTCAGAGAATGGGGAAGG + Intronic
1048619621 8:136117624-136117646 TTGTATTCTGGGAAGTGGGAAGG - Intergenic
1048727019 8:137398162-137398184 TAATGTGGTGGCAAGGGGGAGGG + Intergenic
1049071597 8:140359536-140359558 TTTGGTTCTGGAAGGGGGGATGG + Intronic
1049124330 8:140773352-140773374 TTACGTTCTAGTAAGGGAGAAGG + Intronic
1050077166 9:1877304-1877326 TGATGATCTGGGAAGGGCCAAGG + Intergenic
1050820324 9:9871578-9871600 TTATCTTCTGGAAAGGGGCCTGG + Intronic
1050820381 9:9871809-9871831 TTATCTTCTGGAAAGGGGCCTGG + Intronic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1051394609 9:16606535-16606557 TTTTTTTGTGGGTAGGGGGACGG + Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052334615 9:27306859-27306881 TAGTCTTCAGGGAAGGGGGAAGG + Intergenic
1052559991 9:30073118-30073140 TTATATTCTGGGCGGGAGGAAGG - Intergenic
1053207454 9:36198687-36198709 TTTTTTTCTGGGGTGGGGGAAGG - Intronic
1055187501 9:73474278-73474300 TTAGGGGCTGGGGAGGGGGAGGG - Intergenic
1055463256 9:76539164-76539186 ACATCCTCTGGGAAGGGGGAGGG - Intergenic
1055845071 9:80552138-80552160 TTATGTTGTGGGGTGGGGGGAGG - Intergenic
1056776777 9:89518763-89518785 TTCCTTTCTGGGGAGGGGGAAGG + Intergenic
1056819231 9:89825582-89825604 TTCTCTTCTGGGGAGGGGGTGGG + Intergenic
1057214496 9:93220471-93220493 TCCTGTTTTGTGAAGGGGGATGG + Intronic
1057958390 9:99431055-99431077 TTATCTGCTGGGAAGTGGAAAGG - Intergenic
1057964398 9:99489076-99489098 GCTTGTTCTGGGCAGGGGGAGGG - Intergenic
1058684354 9:107467078-107467100 TTCTGTTCGGGGAAGAGGGAAGG + Intergenic
1059339021 9:113586951-113586973 TCATGTTATGTGGAGGGGGAGGG + Intronic
1060194098 9:121612041-121612063 GTAAGTTCTGGAAAGGGGTATGG - Intronic
1060841066 9:126793494-126793516 TTCAGTTCTGGGAGCGGGGAGGG + Intergenic
1062412466 9:136432034-136432056 CCATGTTCTGGGGAAGGGGAAGG - Intronic
1185796432 X:2969266-2969288 CTATGTTCTGGGATGAGGCATGG + Intergenic
1186595951 X:10981456-10981478 TGGTGTTATGGGTAGGGGGAGGG + Intergenic
1189321645 X:40090714-40090736 TAATGCTCCGGGAAGGGGGAGGG + Intronic
1189323517 X:40099434-40099456 TTTTATACTGGGAAGGGGGTGGG + Intronic
1190539139 X:51459098-51459120 TCATGTTATGGGAAGAGGGGAGG - Intergenic
1190737325 X:53264335-53264357 TTGTGCTGTGGGAAGGGGGTGGG - Intronic
1190951085 X:55143465-55143487 TTAGTTTCAGGGGAGGGGGAAGG + Intronic
1191041823 X:56089878-56089900 TTATATTCTGGCAAGTGGAAGGG + Intergenic
1192366213 X:70475736-70475758 GTATCTTCTGGGGAGTGGGATGG + Intronic
1194697828 X:97077172-97077194 GTATCTTCTGGTAAGGAGGATGG + Intronic
1195375011 X:104218504-104218526 TTAAGTGCTAGGAAGGAGGAAGG + Intergenic
1195954622 X:110317036-110317058 TTGTGCCCTGGGAAGGGGGGAGG - Intronic
1196416486 X:115477235-115477257 TTATGTTCTAGGTGGGGGCAGGG - Intergenic
1197575875 X:128210833-128210855 TTAGTTTCAGGGGAGGGGGAAGG - Intergenic
1197732733 X:129825681-129825703 GTATGTTCTTGGAAGGGAGGAGG - Intronic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198167640 X:134072795-134072817 TAATGATATGGAAAGGGGGAAGG - Intergenic
1198622174 X:138525269-138525291 TTAGGGTCTGTGAAGGGGAAGGG + Intergenic
1198980871 X:142394450-142394472 TTACGTTGGGGGATGGGGGAGGG - Intergenic
1199140479 X:144305982-144306004 TTGTGTTCGGGGAGGCGGGAAGG + Intergenic
1199496526 X:148458550-148458572 TTTTGCTGTGGTAAGGGGGATGG - Intergenic
1200091601 X:153638650-153638672 GCATGTTCCTGGAAGGGGGACGG + Intergenic
1200211467 X:154348603-154348625 TTTGGTTCTGGGAGGGGTGAGGG - Intronic
1200215330 X:154365709-154365731 TCTTCTTCTTGGAAGGGGGAGGG - Intronic
1200464048 Y:3493514-3493536 TTACCTTCAGGGAAGGGAGAAGG - Intergenic
1200830881 Y:7688054-7688076 TGATTTTGTGGGAAGGGGGCTGG + Intergenic
1201749678 Y:17419336-17419358 TTAGGTTCAGGGGATGGGGACGG + Intergenic
1201852005 Y:18495307-18495329 TCATGTTCTCTGAAGGGAGATGG - Intergenic
1201881316 Y:18825073-18825095 TCATGTTCTCTGAAGGGAGATGG + Intronic
1202137382 Y:21680567-21680589 TTATGTCCTGTGAAGGGGCATGG - Intergenic
1202346627 Y:23935454-23935476 TCATGTTCTCTGAAGGGAGATGG + Intergenic
1202524144 Y:25734639-25734661 TCATGTTCTCTGAAGGGAGATGG - Intergenic