ID: 1161152686

View in Genome Browser
Species Human (GRCh38)
Location 19:2717911-2717933
Sequence TGGGGCTGTCCCCTCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161152686_1161152703 20 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152703 19:2717954-2717976 ACATGGCGGCTTCTCAGAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 179
1161152686_1161152699 3 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152699 19:2717937-2717959 CCCGGGGAGGGAGGAGGACATGG 0: 1
1: 0
2: 9
3: 87
4: 755
1161152686_1161152701 6 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152701 19:2717940-2717962 GGGGAGGGAGGAGGACATGGCGG 0: 1
1: 1
2: 24
3: 317
4: 2653
1161152686_1161152692 -6 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152692 19:2717928-2717950 GCCCCACGCCCCGGGGAGGGAGG 0: 1
1: 1
2: 4
3: 58
4: 358
1161152686_1161152702 17 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152702 19:2717951-2717973 AGGACATGGCGGCTTCTCAGAGG 0: 1
1: 0
2: 3
3: 13
4: 161
1161152686_1161152690 -10 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152690 19:2717924-2717946 GACAGCCCCACGCCCCGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 145
1161152686_1161152704 23 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152704 19:2717957-2717979 TGGCGGCTTCTCAGAGGAGGTGG 0: 1
1: 1
2: 6
3: 83
4: 408
1161152686_1161152691 -9 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152691 19:2717925-2717947 ACAGCCCCACGCCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 192
1161152686_1161152696 -3 Left 1161152686 19:2717911-2717933 CCAGGCTTGAGGGGACAGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1161152696 19:2717931-2717953 CCACGCCCCGGGGAGGGAGGAGG 0: 1
1: 0
2: 3
3: 58
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161152686 Original CRISPR TGGGGCTGTCCCCTCAAGCC TGG (reversed) Intronic