ID: 1161153287

View in Genome Browser
Species Human (GRCh38)
Location 19:2720624-2720646
Sequence CCTGAAGCCCGGCTCCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 265}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161153279_1161153287 -9 Left 1161153279 19:2720610-2720632 CCCAGCCCTGGGTCCCTGAAGCC 0: 1
1: 0
2: 2
3: 44
4: 430
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153272_1161153287 19 Left 1161153272 19:2720582-2720604 CCCAGACGTCCAGGCAGGGCCAA 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153271_1161153287 20 Left 1161153271 19:2720581-2720603 CCCCAGACGTCCAGGCAGGGCCA 0: 1
1: 0
2: 2
3: 14
4: 231
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153280_1161153287 -10 Left 1161153280 19:2720611-2720633 CCAGCCCTGGGTCCCTGAAGCCC No data
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153270_1161153287 21 Left 1161153270 19:2720580-2720602 CCCCCAGACGTCCAGGCAGGGCC No data
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153273_1161153287 18 Left 1161153273 19:2720583-2720605 CCAGACGTCCAGGCAGGGCCAAT 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153277_1161153287 0 Left 1161153277 19:2720601-2720623 CCAATCTACCCCAGCCCTGGGTC 0: 1
1: 0
2: 2
3: 19
4: 248
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153267_1161153287 24 Left 1161153267 19:2720577-2720599 CCACCCCCAGACGTCCAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 257
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153278_1161153287 -8 Left 1161153278 19:2720609-2720631 CCCCAGCCCTGGGTCCCTGAAGC 0: 1
1: 0
2: 2
3: 62
4: 465
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153266_1161153287 25 Left 1161153266 19:2720576-2720598 CCCACCCCCAGACGTCCAGGCAG 0: 1
1: 0
2: 2
3: 25
4: 257
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265
1161153274_1161153287 10 Left 1161153274 19:2720591-2720613 CCAGGCAGGGCCAATCTACCCCA 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161153287 Original CRISPR CCTGAAGCCCGGCTCCCGGC CGG Intronic
900510045 1:3054534-3054556 CCTGCTGCGGGGCTCCCGGCGGG - Intergenic
900542492 1:3210407-3210429 TCAGAAGCCAGGCTCCCAGCTGG + Intronic
901199078 1:7456648-7456670 CCTGATACCTGGCTCCCTGCGGG - Intronic
903466911 1:23558347-23558369 CCTGCCGTCCGGCTTCCGGCAGG + Exonic
903556543 1:24197725-24197747 CCTGAACCACTGCTCCTGGCGGG + Intergenic
907197371 1:52697851-52697873 CGTGAGCCACGGCTCCCGGCCGG + Intronic
910427550 1:87132053-87132075 TCAGAAGCCCGGCTCCTCGCCGG + Intronic
912681067 1:111729441-111729463 CCTGAGTCCCGGCTGCCAGCTGG + Intronic
912816073 1:112829710-112829732 CCTGAAGTCCGGCACCCTGTGGG + Intergenic
913630085 1:120701102-120701124 GCTGCTGCCCAGCTCCCGGCTGG + Intergenic
914560003 1:148808670-148808692 GCTGCTGCCCAGCTCCCGGCTGG - Intronic
914612830 1:149321545-149321567 GCTGCTGCCCAGCTCCCGGCTGG + Intergenic
917311661 1:173685348-173685370 CCTGAAGTCCGGCACCCTGTGGG - Intergenic
920029448 1:203027594-203027616 CCTGAAACCTGGCTCCTGGAGGG - Intronic
922680714 1:227593071-227593093 CCTGAAGTCCGGCACCCTGCGGG - Intronic
922690203 1:227683031-227683053 CCTGAAGTCCAGCACCCTGCAGG + Intergenic
922831741 1:228557736-228557758 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922831744 1:228557740-228557762 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922832221 1:228609718-228609740 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922832224 1:228609722-228609744 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922832781 1:228611959-228611981 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922832784 1:228611963-228611985 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922833342 1:228614200-228614222 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922833345 1:228614204-228614226 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922833902 1:228616441-228616463 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922833905 1:228616445-228616467 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922834459 1:228618682-228618704 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922834462 1:228618686-228618708 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922835019 1:228620914-228620936 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922835570 1:228623117-228623139 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922835573 1:228623121-228623143 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922836128 1:228625359-228625381 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922836131 1:228625363-228625385 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922836686 1:228627598-228627620 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922836689 1:228627602-228627624 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922837245 1:228629840-228629862 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922837248 1:228629844-228629866 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922837806 1:228632081-228632103 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922837809 1:228632085-228632107 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922838364 1:228634321-228634343 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922838367 1:228634325-228634347 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922838922 1:228636546-228636568 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922838925 1:228636550-228636572 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922839482 1:228638787-228638809 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922839485 1:228638791-228638813 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922840043 1:228641018-228641040 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922840046 1:228641022-228641044 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922840603 1:228643259-228643281 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922840606 1:228643263-228643285 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922841166 1:228645490-228645512 CCAGGAGCCCGGCTCCAGCCTGG - Intergenic
922841169 1:228645494-228645516 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
923986397 1:239387069-239387091 ACTGAAGGGCGGCTCCGGGCAGG + Intronic
1067141374 10:43659882-43659904 CCTAAAGACCGGCTTGCGGCCGG + Intergenic
1070789062 10:79178917-79178939 CATGAAGCCCTGCCCCCGCCTGG + Intronic
1070959128 10:80486631-80486653 CCTGAGGCCCAGCTCCCTGGAGG + Intronic
1071206223 10:83282126-83282148 CATGAGCCACGGCTCCCGGCCGG + Intergenic
1071283033 10:84120097-84120119 CCTGAAGTCTGGCACCCCGCGGG - Intergenic
1071588097 10:86845280-86845302 GCTGAAGCCCAGCTGCCCGCAGG - Intronic
1073930126 10:108566367-108566389 CCTGCAGCCCGCCTCCCTGGGGG + Intergenic
1076060932 10:127413462-127413484 CTTGGAGCCAGGCTCCCCGCTGG - Intronic
1076263551 10:129091180-129091202 CCTGGAGCCCCACTCCCAGCGGG - Intergenic
1076738200 10:132468091-132468113 CCCCAAGGCCGGCTCCAGGCAGG + Intergenic
1076824510 10:132960340-132960362 CCTCAAACCCGGCTCCCGCCAGG + Intergenic
1076979497 11:197136-197158 CCTGACTCCTGGCTCCCAGCTGG + Intronic
1076985395 11:232410-232432 CCTGTAATCCGGCACCCGGCCGG + Intronic
1077179535 11:1206111-1206133 CTTGCAGCCCTGCTCCCAGCGGG - Intergenic
1077304929 11:1864759-1864781 TCTGCAGGCCGGCTCCCTGCAGG - Intronic
1077353661 11:2104841-2104863 CATGAAGCACGGCTTCCTGCTGG - Intergenic
1077557477 11:3232547-3232569 CCGGTAGCCCGGCTCTCAGCCGG - Intergenic
1081868546 11:46372718-46372740 CCTGAAGCCGGGGTCCCTGTGGG + Intronic
1081875478 11:46405435-46405457 CATGAAGCACTGCACCCGGCTGG - Intronic
1083121339 11:60515416-60515438 CCAGGAGCCCAGCACCCGGCCGG - Exonic
1083747948 11:64745532-64745554 CCGGAAGCCTGGCTCCCCACAGG + Intergenic
1085165530 11:74396693-74396715 CCTGAGCCACGGCGCCCGGCCGG + Intronic
1085453169 11:76649812-76649834 CCTAGAGCCTGGCTCCAGGCAGG - Intergenic
1087998006 11:104835665-104835687 CCTGAGCCACGGCACCCGGCTGG + Intergenic
1090161509 11:124500107-124500129 CCTGAAGCCTGGCCCCTGCCAGG + Intergenic
1090780372 11:130002158-130002180 CCCGGTGCTCGGCTCCCGGCCGG + Intronic
1091649730 12:2301074-2301096 CCTGAGGACCGGCTCACGACAGG - Intronic
1092239297 12:6827588-6827610 CCTCAAGCCCCGCCCCCAGCAGG - Intronic
1092239597 12:6828728-6828750 CCCGGAGCCCGACTCCGGGCCGG + Exonic
1094048634 12:26195600-26195622 CCTGGAGCGCGGCGCACGGCTGG - Exonic
1096207765 12:49737824-49737846 CCCGAAGTCCGGCACCCTGCGGG + Intronic
1096839146 12:54370196-54370218 CCGGACGCCTGGGTCCCGGCTGG + Exonic
1100565648 12:95790962-95790984 CCCGACGCCCGGCTGCCCGCTGG + Intronic
1103377920 12:120470714-120470736 GCTTGAGCCCGGCGCCCGGCTGG + Intronic
1103573005 12:121857357-121857379 CCTGGAGACCGGTTCCCGGGAGG - Exonic
1103614841 12:122145537-122145559 CCTGCACCCCAGCTGCCGGCAGG - Exonic
1104049487 12:125186262-125186284 CCTGTGCCCCGGCTCCCGGGCGG + Intergenic
1105420455 13:20247596-20247618 CCTGAAGCCCTGCTCCCCATAGG + Intergenic
1105899998 13:24745752-24745774 CCGGAACCAGGGCTCCCGGCTGG + Intergenic
1108541957 13:51453272-51453294 CCCGAAGCCCGCCTCCGGGTCGG - Intronic
1109909404 13:68890296-68890318 CTTGAAGTCCGGCACCCTGCGGG - Intergenic
1113942256 13:114024489-114024511 CCTGAATCCCGAATCCCGCCTGG - Intronic
1114374474 14:22129452-22129474 CATGAGCCCCTGCTCCCGGCTGG - Intergenic
1115768455 14:36647231-36647253 CCGGAAGTGCGGCTCCCGCCTGG - Intergenic
1121629868 14:95414172-95414194 CCTGAAGCCCCCCTCCAGCCTGG + Intronic
1122876410 14:104668033-104668055 CCTGAGTCACGGCACCCGGCCGG - Intergenic
1123675005 15:22702184-22702206 CGTGAGGCCCTGCGCCCGGCTGG - Intergenic
1124327018 15:28775173-28775195 CGTGAGGCCCTGCGCCCGGCTGG - Intergenic
1124374475 15:29121533-29121555 GCTGAAGCTCGGCTCCAGGGCGG + Exonic
1126849123 15:52786960-52786982 CCTGAAGCCTGGCTCTGGGGTGG + Intronic
1128491630 15:68152228-68152250 CATGAGCCCCTGCTCCCGGCTGG + Intronic
1129869333 15:78930735-78930757 GCTGCAGCACGGCTCCCTGCAGG + Intronic
1130540247 15:84817058-84817080 CCCGGGACCCGGCTCCCGGCCGG - Exonic
1132201524 15:99957473-99957495 TCAGAATCCCGGCTCCCGCCCGG - Intergenic
1133784644 16:8964255-8964277 CCTGAACCCCGGCTGCCGGGTGG - Intronic
1133955852 16:10443326-10443348 CCTGAAGTCCAGCACCCTGCAGG - Intronic
1134016690 16:10893319-10893341 CCTGAACCACGGATCCTGGCAGG + Intronic
1135023771 16:18983903-18983925 CCTGATGCTCGGCTCCTCGCGGG + Intergenic
1136909183 16:34132826-34132848 CCAGGAGCCCGGCTCCAGCCGGG + Intergenic
1137250403 16:46736922-46736944 CCTGAGGACCTGCTCTCGGCAGG - Intronic
1137426431 16:48384956-48384978 CCTGGAGCCCCGGGCCCGGCGGG - Intronic
1138104857 16:54282510-54282532 CCTGGAGCCGGAATCCCGGCTGG + Intergenic
1138211049 16:55163820-55163842 ACTGAAGCCCAGCTCCAGCCTGG - Intergenic
1138459677 16:57140844-57140866 CCTGAGCCACGGCACCCGGCCGG + Intronic
1140519021 16:75566317-75566339 CCGGAAGCCCCGCCCCCGGCCGG + Intergenic
1141430483 16:83968413-83968435 CCTCAGGCCCCGCGCCCGGCCGG + Intergenic
1141772291 16:86096705-86096727 CTTGATGCCTAGCTCCCGGCTGG + Intergenic
1142672001 17:1491691-1491713 GCTGCGGCCCGGCCCCCGGCGGG - Intronic
1143496412 17:7315209-7315231 CCAGGAGCCCGCCACCCGGCCGG + Intronic
1143521233 17:7445447-7445469 CCTAAAGCCACGCCCCCGGCCGG - Intronic
1144759668 17:17700320-17700342 CCTGTCGCCCGGCCCCAGGCGGG + Intronic
1147044291 17:37742306-37742328 CCCGGTCCCCGGCTCCCGGCCGG - Intronic
1147943466 17:44066428-44066450 CGTGAAGCCCGAGTCCGGGCCGG - Intronic
1148558648 17:48593425-48593447 CCTGAAGCGGGGCTCCTGGGCGG + Exonic
1150391728 17:64793849-64793871 GCTGAGGCCCGGCACTCGGCAGG + Intergenic
1150645987 17:66977799-66977821 CCTGAAGCCAGGCACTCAGCAGG - Intronic
1151050403 17:70971661-70971683 CCTGAGCCACGGCGCCCGGCTGG + Intergenic
1151320048 17:73347594-73347616 CCAGCAGCCCAGCTCCCTGCTGG + Intronic
1151491209 17:74433058-74433080 CCCGAACCCCCACTCCCGGCTGG + Intronic
1152476468 17:80521589-80521611 CTTGAGGCCCAGCTCCCAGCTGG - Intergenic
1152552216 17:81035452-81035474 CCAGCAGCCCGGGTCCCGGGTGG - Intronic
1152633534 17:81421218-81421240 CCCTCAGCCCGGTTCCCGGCTGG + Intronic
1154014088 18:10601088-10601110 CCCGAAGTCCGGCACCCTGCGGG - Intergenic
1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG + Intronic
1161587613 19:5114050-5114072 ACTGCAGCCTGGCTCCTGGCGGG + Intronic
1161894467 19:7069818-7069840 GCGGAAACCCGGCTCCCGGGAGG - Intronic
1162155814 19:8677426-8677448 CCTGAAGCCCGGCATCCAGAGGG - Intergenic
1163402339 19:17101695-17101717 GCTGAAGCCAGGCGGCCGGCAGG + Exonic
1165348141 19:35261842-35261864 CCGAAAGCCCAGCTCCAGGCTGG - Intronic
1166250767 19:41569550-41569572 CCTGCAGCCCCTCTCCCTGCAGG - Intronic
1166792476 19:45406127-45406149 CCAGAAGCCCCGCCCCTGGCTGG + Intronic
1167291215 19:48626098-48626120 CCTGAAGCCAGGCCCCGGGGTGG + Exonic
1167638431 19:50667900-50667922 CCTGGATCCCGCCTCCCCGCTGG - Exonic
1167934786 19:52897269-52897291 CCTCAACCCCGGTTCCCGGGAGG - Intronic
1168250970 19:55141759-55141781 CATGAGGCCCCGCGCCCGGCCGG + Intronic
925010183 2:479068-479090 CCAAAAGCCAGGCTACCGGCAGG + Intergenic
925233823 2:2259744-2259766 CCTGAAGCCCATCTGCCGTCGGG - Intronic
925882345 2:8363334-8363356 CCCTGAGCCCTGCTCCCGGCTGG + Intergenic
925911655 2:8577722-8577744 CCTGGAGGTCGGCTCCCCGCAGG + Intergenic
926107387 2:10160793-10160815 CCTGGAGCCCTGCCCCCGCCAGG + Intronic
926474696 2:13308253-13308275 CCTGCAGCCCGGGTCTGGGCGGG - Intergenic
926688556 2:15717285-15717307 CCTGAACCCCCACCCCCGGCTGG + Intronic
927990347 2:27442782-27442804 CCGGGAGCCCGGCCCCCGCCCGG - Intronic
928085758 2:28345311-28345333 GCTGAAGCGGGGCTCCAGGCTGG - Intergenic
931221925 2:60295993-60296015 GCTGAAGCCCTGCTCCTGGTTGG - Intergenic
932256836 2:70294836-70294858 CGTGAGCCCCCGCTCCCGGCTGG + Intergenic
933196278 2:79393817-79393839 CCAAAAGCCTGGCTCCCTGCAGG + Intronic
934522391 2:95027364-95027386 CTGGAAGCCCCGCTACCGGCAGG - Intronic
934662147 2:96148730-96148752 CCTGGAGCCTGGCGCCTGGCAGG - Intergenic
937905823 2:127052328-127052350 CCGGAAGGCAGGCTGCCGGCTGG + Exonic
944457557 2:199911307-199911329 CCTCAGCGCCGGCTCCCGGCCGG + Exonic
944632666 2:201643062-201643084 TCTGAGGCCCGGGGCCCGGCGGG - Intronic
945720336 2:213410883-213410905 CCTGAAGTCCGGCACCCTGCGGG + Intronic
947749140 2:232523778-232523800 CCTGCAGCTGGGCTCGCGGCTGG - Exonic
948728122 2:239947052-239947074 CCTGAAGCCCGGTGCTCAGCAGG + Intronic
948844549 2:240676870-240676892 CCTGAGGCCCAGCTCCTGCCTGG + Intronic
948849311 2:240698009-240698031 CCTGAGGCCCAGCTCCTGCCTGG - Intronic
1168893048 20:1306849-1306871 CCTGAGTCCCAGCTCCCAGCTGG + Exonic
1170712816 20:18807665-18807687 CCTACAGCCTGGCTCCCAGCTGG + Intergenic
1171180844 20:23089187-23089209 CCAGGACCCCAGCTCCCGGCAGG - Intergenic
1171771867 20:29327898-29327920 CCAGGAGCCCGGCTCCAGCCGGG - Intergenic
1171813816 20:29765110-29765132 CCAGGAGCCCGGCTCCAGCCAGG - Intergenic
1171904644 20:30891594-30891616 CCAGAAGCCCGGCTCCAGCCGGG + Intergenic
1174259399 20:49282830-49282852 CCTGAAGTCCGACACCCTGCGGG - Intergenic
1175513827 20:59555265-59555287 CCCGAAGTCCGGCACCCTGCGGG - Intergenic
1175812010 20:61863529-61863551 CCTGAAACTGGGCTCCCTGCAGG - Intronic
1175839705 20:62019210-62019232 CCTGAAGCCCCTCTCCTGGCTGG + Intronic
1175902994 20:62367310-62367332 TCTGAAGCCAGGCGGCCGGCAGG + Exonic
1175931830 20:62497204-62497226 CCTGAGGCCCGGGTCCCTGGGGG - Intergenic
1175950478 20:62580850-62580872 CCTGCAGCCTGGCGCCTGGCTGG + Intergenic
1176181497 20:63751784-63751806 CATGAAGCCCCGCCCCCGGTGGG + Intronic
1176188173 20:63792981-63793003 TCTGCAGCGCGTCTCCCGGCAGG - Intronic
1176216423 20:63950144-63950166 CCAGAAGCCCGCCTCACCGCAGG + Intronic
1180068531 21:45424709-45424731 CCTGAAAACCGGCTCCCTTCCGG + Intronic
1180317264 22:11285733-11285755 CCAGGAGCCCGGCTCCAGCCGGG - Intergenic
1183688987 22:39377525-39377547 CCTGAAGCCAGCCTCCCTCCTGG + Intronic
1184329880 22:43820705-43820727 GCTGGCGCCCGACTCCCGGCAGG + Intergenic
1184352979 22:43956996-43957018 TCAGAAGTCCTGCTCCCGGCAGG - Intronic
1184549841 22:45198587-45198609 GCTGCAGCCCTGCTCCCTGCTGG + Intronic
1185402797 22:50627330-50627352 CCTGGTGCCCAGCTCCCGGGGGG - Exonic
949414095 3:3798626-3798648 TCTGAAGCCCTGCTTCCGGCTGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950195639 3:11007295-11007317 CATGAGGCCCGGCTCCCCGGAGG + Intronic
950846046 3:16017093-16017115 CCCGAAGTCCGGCACCCTGCGGG - Intergenic
953766306 3:45746465-45746487 CCTGGAGCCTGTCTCCCGGGGGG + Intergenic
954145195 3:48631004-48631026 CCTGAGGCACGGCTACCGGGTGG - Exonic
956456524 3:69426478-69426500 CCTGAAACAGGGCTCCAGGCAGG - Intronic
957715030 3:83917378-83917400 CGTGAAACACCGCTCCCGGCAGG - Intergenic
966886523 3:184380366-184380388 GCTGCTGCTCGGCTCCCGGCCGG + Exonic
967849491 3:194071200-194071222 CCTGTTTCCCGGCTCCCGCCCGG + Intergenic
968234994 3:197026267-197026289 TCAGAAGCCCGGCTCCGGGTAGG - Intronic
969613086 4:8237784-8237806 CCTGGAGCGCTGCGCCCGGCTGG + Intronic
969666236 4:8558942-8558964 CCTGAGGCCTGGCTCTCTGCCGG - Intronic
969718012 4:8877732-8877754 CCCCAAGCCTGGCTCCCTGCAGG + Intergenic
972765916 4:42152183-42152205 CTCGGAGCCCGGCGCCCGGCGGG - Exonic
979623994 4:122826635-122826657 ACTGAGGCCGGGCTCCCCGCCGG + Intergenic
982662719 4:158225879-158225901 CCCGAAGTCCGGCACCCTGCGGG - Intronic
982961363 4:161841872-161841894 CCTTAAGATCGGCTCCCAGCTGG + Intronic
984435370 4:179703184-179703206 CCTGGTGCCTGGCTCCCAGCAGG - Intergenic
984705117 4:182841951-182841973 CCTGTTGCCCGGCTCCCTGACGG + Intergenic
985674719 5:1224987-1225009 CCCGAAGCCCGGATTCCCGCAGG - Exonic
986926961 5:12766419-12766441 CGTGAACCACGGCGCCCGGCCGG - Intergenic
995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG + Intergenic
996056507 5:118988538-118988560 ATTGAAGCCCGGCTGCCGCCGGG + Exonic
997301991 5:132813375-132813397 CCCGAAGGCCGGGGCCCGGCGGG + Intergenic
998552393 5:143090153-143090175 CCCGAAGTCCGGCACCCTGCGGG - Intronic
1001534877 5:172491298-172491320 CCTGAGGCCCGGCTGCCTACTGG + Intergenic
1001579548 5:172789520-172789542 CCTGAGGCCCGGCTCCACTCTGG + Intergenic
1002519622 5:179784397-179784419 CCTGAAGCCCAGCTTGCAGCAGG + Intronic
1003493551 6:6644240-6644262 CCTGAACCACTGCACCCGGCTGG - Intronic
1003684105 6:8283598-8283620 CCTGAAGCCGGTCTCCCTGGAGG + Intergenic
1006920791 6:37625851-37625873 CCTGCAGCCCGCCTCCCCGTGGG + Intergenic
1013770770 6:113625473-113625495 CCTGAAGCTAGGCTCCCTCCAGG + Intergenic
1016447796 6:144150656-144150678 CGAGAAGCCCCTCTCCCGGCAGG - Exonic
1018615238 6:165680620-165680642 CCTGAGCCCCCGCTCCTGGCTGG - Intronic
1018847210 6:167563897-167563919 CATGAGGCCTGGCACCCGGCAGG - Intergenic
1019479375 7:1259623-1259645 CCTATAGCCCGGCTCCCCGTGGG - Intergenic
1019624440 7:2008902-2008924 CCTGAAGCCTGGCTCCGAGTGGG - Intronic
1019896862 7:3989638-3989660 CCTGAAACCCAGCTCCCCGTGGG + Intronic
1020014045 7:4820777-4820799 TCTGCAGCCCGGCCCCCGCCCGG + Intronic
1028334077 7:89629446-89629468 CCTGAAGTCCGGCACCCTGAGGG + Intergenic
1033589415 7:142797308-142797330 CCTGAATCCCGCCGCCCGGGTGG - Intergenic
1034088209 7:148339504-148339526 CCGGCAGCCCGAGTCCCGGCGGG - Intronic
1034195041 7:149239856-149239878 CGCGAAGCCCCGCCCCCGGCAGG - Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1036432352 8:8702473-8702495 CCTGGCGCCCGGCTGGCGGCTGG + Exonic
1037803893 8:22049098-22049120 CCTGGGGCCCGGGGCCCGGCTGG - Intronic
1037913994 8:22761032-22761054 TCTGATGCCCGCCTCCCCGCTGG - Intronic
1039059998 8:33565771-33565793 CCAGAAACACGGCTCCCGCCAGG + Intronic
1039461062 8:37744764-37744786 CCTAAAGCCTGGCTGCCTGCAGG + Intronic
1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG + Intronic
1049646507 8:143738156-143738178 CCTGCTGCCCAGCTGCCGGCTGG + Intergenic
1049689924 8:143953890-143953912 GCTGAAGCCCCGCCCCTGGCCGG - Intronic
1052021643 9:23531722-23531744 ACGGAAGCCCAGCTCCTGGCTGG - Intergenic
1055308209 9:74952253-74952275 CCGGGCGCCCGGCTCCCGGGGGG - Exonic
1055532497 9:77198942-77198964 CGTGAACCACCGCTCCCGGCTGG + Intronic
1056271080 9:84948660-84948682 CCTGAAGGCCTGCTCCCTCCTGG - Intronic
1057179400 9:93021666-93021688 CCTGAATCCCAACTCCAGGCTGG + Intronic
1057298025 9:93860741-93860763 CCTGGAGCCCGGCACCCTCCTGG + Intergenic
1057422912 9:94926690-94926712 CCTCATGCCCTGCTCCCGGGTGG - Intronic
1060140027 9:121201669-121201691 CCTGACGCCCCCCTCCCGCCCGG - Exonic
1060421653 9:123473447-123473469 CCTGAGTCTCGGCTCCAGGCTGG - Intronic
1061450894 9:130666521-130666543 ACCGAAGCCGGGGTCCCGGCGGG + Intronic
1061559706 9:131394428-131394450 CCCGCAGCCCCGCGCCCGGCGGG - Intronic
1062319762 9:135985028-135985050 CCTTGAGCCCCGCGCCCGGCTGG - Intergenic
1062391312 9:136335018-136335040 GCTGAAACCCAGCTCCCTGCCGG - Intronic
1062582348 9:137234161-137234183 CCTGCTGGCCGGCTCCCTGCTGG + Exonic
1203761572 EBV:15015-15037 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203762501 EBV:18087-18109 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203763430 EBV:21159-21181 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203764359 EBV:24231-24253 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203765288 EBV:27303-27325 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203766217 EBV:30375-30397 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203767146 EBV:33447-33469 CCTGAAGCCCGGGTCTCTGGAGG - Intergenic
1203365505 Un_KI270442v1:251448-251470 CCAGGAGCCCGGCTCCAGCCGGG - Intergenic
1185590517 X:1273608-1273630 CGTGAACCACTGCTCCCGGCTGG + Intronic
1189833784 X:45000760-45000782 CCCGAAGTCCGGCACCCTGCGGG - Intronic
1190023879 X:46904172-46904194 TCTGCTGCCCGGCTCCCAGCAGG + Intergenic
1190227655 X:48558800-48558822 ACTGAAGCCGGGCTACCTGCAGG - Intronic
1192915423 X:75646367-75646389 CCTGAAGTCCAGCACCCTGCAGG - Intergenic
1199816022 X:151397402-151397424 CCTCAAGCCCTGCTCCAGGCTGG - Intronic
1200310292 X:155071187-155071209 CCTGACGCCCGGACCGCGGCCGG + Exonic
1200769339 Y:7109022-7109044 CCTGAAGTCTGGCACCCTGCAGG + Intergenic
1201073192 Y:10168777-10168799 ACTGGAGCCCGGCTCCTGGTGGG - Intergenic