ID: 1161155001

View in Genome Browser
Species Human (GRCh38)
Location 19:2727943-2727965
Sequence GCAAGCTGGAGAATTAACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161155001_1161155003 3 Left 1161155001 19:2727943-2727965 CCGGAGTTAATTCTCCAGCTTGC 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1161155003 19:2727969-2727991 GCTGAGAGACGCCCCCATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161155001 Original CRISPR GCAAGCTGGAGAATTAACTC CGG (reversed) Intronic
902187961 1:14739690-14739712 TCAAACTGGAGAACTAACTGTGG + Intronic
903963294 1:27070771-27070793 GGAAGCTGGAGAAGGGACTCTGG - Intergenic
910663660 1:89701143-89701165 TCAAGCTGGAGAAATAATTTGGG + Intronic
911274708 1:95847632-95847654 GCAGGAAGGAGAATGAACTCAGG + Intergenic
912501570 1:110126125-110126147 GCACACTGGAGAATGAATTCTGG - Intergenic
915057905 1:153152751-153152773 GCATGCTGAAGAATTAGCTAAGG + Intergenic
917308177 1:173648936-173648958 GAAAGCTGGGGTTTTAACTCAGG + Intronic
917752375 1:178065691-178065713 GCAGGATGGAGAATGAATTCGGG + Intergenic
918197452 1:182235474-182235496 AGAAGCTGGAGAATGGACTCTGG + Intergenic
922950137 1:229552381-229552403 GCAAGCAAGAGACTTAACTATGG - Intronic
924851853 1:247838995-247839017 GCAAGCTGGAGCATGAACACAGG - Intergenic
1067045568 10:42983372-42983394 ACAAGCACGAGAATTGACTCAGG - Intergenic
1067708912 10:48633305-48633327 GCATGCTGGAGAAGTAAAACTGG + Intronic
1068111004 10:52680997-52681019 GCAAGTTAGGGAATTGACTCAGG - Intergenic
1068264718 10:54631807-54631829 GCAGGAAGGAGAATGAACTCAGG + Intronic
1070198246 10:74178424-74178446 GGAAGAAGGGGAATTAACTCTGG - Intronic
1070280178 10:75043079-75043101 AAAAGCTGGATAATTAACACTGG + Intronic
1070839165 10:79471237-79471259 GCTATCTGGAAAATTACCTCTGG - Intergenic
1074602642 10:114931030-114931052 GCAAAGTGAAGAATTACCTCTGG - Intergenic
1075225414 10:120624571-120624593 GCAAGAAGGAGAATTACCACGGG + Intergenic
1078894553 11:15586440-15586462 GTAAGCAGCAAAATTAACTCTGG - Intergenic
1083602459 11:63957441-63957463 CCATGCTGGAGAAAAAACTCAGG + Intergenic
1088737805 11:112742637-112742659 GAAAGCTGGAGGATAAACACTGG - Intergenic
1090641122 11:128729576-128729598 GCAGGCTCCAGAATGAACTCAGG + Intronic
1091566256 12:1650584-1650606 ACAAGCTAGAAAATTAACTGTGG - Intergenic
1095216818 12:39558620-39558642 GCAGGAAGGAGAATGAACTCAGG - Intronic
1095613222 12:44156872-44156894 GCAAGTTCTAGACTTAACTCTGG - Intronic
1097335943 12:58383465-58383487 GCAAGCTGGAGACTTGACCCAGG + Intergenic
1098212958 12:68185657-68185679 GCAAGCTGGGAAATAAACTTGGG + Intergenic
1100805868 12:98282931-98282953 GCAGGAGGGAGAATGAACTCAGG + Intergenic
1103124226 12:118407501-118407523 GCAAGCTGGTCTATTACCTCTGG - Intronic
1109620532 13:64899698-64899720 CCAAGCTCTAGAATTAACTTGGG + Intergenic
1112049548 13:95632197-95632219 CCAGGCTGGAGATTTAAATCTGG - Intronic
1112209614 13:97362718-97362740 AGAAGCTGGAGAATGAACTAAGG + Intronic
1112754296 13:102614107-102614129 GCAAGCTGGACAAATCCCTCAGG + Exonic
1114820965 14:26018968-26018990 GCAGGAAGGAGAATGAACTCAGG + Intergenic
1116361898 14:44010139-44010161 GCAGTCTGGAAAAATAACTCAGG - Intergenic
1116734249 14:48669322-48669344 GCATGCTAGAGAATTAAAGCAGG + Intergenic
1118734425 14:68691413-68691435 TAAAGCCGGAGAATTAACCCAGG + Intronic
1124828714 15:33126726-33126748 GCAGGCTGGAGCAGAAACTCGGG + Intronic
1125665860 15:41429612-41429634 GCAAGCAGGAGAATTGAATGCGG - Intronic
1127030660 15:54858307-54858329 GCAATGTGGACAATTTACTCAGG - Intergenic
1129470328 15:75750222-75750244 GCAAGCTGGAGAAGGGCCTCAGG - Intergenic
1130983448 15:88828765-88828787 GCAGGTGGGAGAATTAACTCTGG - Intronic
1132146707 15:99433577-99433599 GGAAGCTGCAGAAATAGCTCTGG - Intergenic
1135661551 16:24301394-24301416 GGAGGTTGAAGAATTAACTCTGG + Intronic
1138522588 16:57579404-57579426 GGGAGCTGGAGAATGAACCCAGG + Intronic
1142525963 17:541152-541174 TCAAGCTGTAGACTTTACTCAGG + Intronic
1144029570 17:11307423-11307445 ATAAGCTGGAGAATTGACACTGG - Intronic
1148337604 17:46851882-46851904 GGAAGCTGGAGACCGAACTCAGG - Intronic
1149271444 17:54982900-54982922 GTATGCTGGAAAATTAATTCAGG - Intronic
1153298773 18:3574009-3574031 GCAAGAGGGAGTATTAAATCTGG - Intronic
1156026684 18:32662781-32662803 AAAACCTGGAGAATTATCTCAGG - Intergenic
1156480633 18:37434398-37434420 ACAAGCCGCAGAATTAGCTCTGG - Intronic
1160353916 18:78210077-78210099 GCAAGCTGGTGAAGTAAGGCAGG - Intergenic
1161155001 19:2727943-2727965 GCAAGCTGGAGAATTAACTCCGG - Intronic
1164623601 19:29712553-29712575 GCAACATGGAGTAGTAACTCAGG + Intronic
932119149 2:69082255-69082277 AGAAGCTGGAGAATTGACACAGG + Intronic
932967807 2:76498417-76498439 GCAAGCTACAGAATGAATTCAGG + Intergenic
934944889 2:98533359-98533381 GCAAGCTACAGAATCAACACGGG - Exonic
939089584 2:137763706-137763728 GGAAGCTGCTGATTTAACTCTGG + Intergenic
942900522 2:181111510-181111532 GAAAGCTGGAGAAGTAAATGGGG + Intergenic
943098640 2:183459575-183459597 GAGAGCTGGTGAAATAACTCAGG - Intergenic
944883122 2:204035543-204035565 GCAAACTGGATAATAAACTATGG - Intergenic
945470049 2:210218074-210218096 GAAAGCTGGAGAAGTAAGTAGGG - Exonic
1174123664 20:48287068-48287090 GCAAGCTGGAGAATTAGGGCGGG - Intergenic
1174415783 20:50365884-50365906 GCAACCTGGAAATTTAACTTGGG - Intergenic
1174606640 20:51766920-51766942 GCAAAATGGAGATTGAACTCCGG - Intronic
1178939094 21:36890071-36890093 GCAGGCAGGAGAATGAACACAGG - Intronic
1184760656 22:46542282-46542304 GCAGGCTGGAGATTTGTCTCTGG - Intergenic
949651911 3:6169499-6169521 TAAAGCTGGAGATTGAACTCAGG + Intergenic
951194686 3:19811046-19811068 GGAGGCTGGAGAAAGAACTCTGG - Intergenic
954205821 3:49058107-49058129 GCAAGCAAGACAATTAACTGGGG + Intronic
954567298 3:51609229-51609251 AAAAGCTGGAGAGTAAACTCTGG - Intronic
956506055 3:69941447-69941469 GTAAAATGGAGAATTATCTCAGG + Intronic
956884747 3:73547805-73547827 GCAAGCTTCAGAGTTGACTCTGG - Intronic
959295700 3:104531438-104531460 GCAAGCAGGAGTAGTCACTCAGG - Intergenic
960523397 3:118681603-118681625 TCAAGCTGGAGTATAAAATCTGG - Intergenic
961069293 3:123906659-123906681 GAAAGCTGTAGAATTTTCTCTGG - Intronic
964535611 3:157717867-157717889 TCAAGCTGGTGAATGAGCTCAGG - Intergenic
965564622 3:170101008-170101030 GCTATCTTGAGAATTAACTTTGG - Intronic
965888216 3:173476076-173476098 ACAAGCTGGAGAATTACCTAAGG + Intronic
967683573 3:192394073-192394095 GAAAGCTGGAGACTTATTTCTGG - Intronic
967778220 3:193406651-193406673 GGAAGCTGGAGAATGAAAGCCGG + Intronic
971552085 4:27970146-27970168 GCAAGCTGAAAAATTAAATGAGG - Intergenic
971610585 4:28720478-28720500 GTAATCTGGAGAATTAATTATGG + Intergenic
972989965 4:44812843-44812865 GCAAGCTGGAGAAAGAACCAAGG - Intergenic
974603638 4:64121981-64122003 GCAAGTTAGAGAATTTAGTCTGG - Intergenic
974874774 4:67690007-67690029 GAAAGGAGGAGAAGTAACTCAGG + Intronic
975343258 4:73264617-73264639 ACAAGGTAGAGAAGTAACTCAGG - Intergenic
984993852 4:185408777-185408799 GCAAGCTGTACAATTAATTTGGG - Intronic
986344556 5:6822775-6822797 GCAAGCTGGAGAATTGGCAGAGG - Intergenic
991126205 5:63072488-63072510 GCAAGAAGGAGAATGAACACAGG - Intergenic
993076485 5:83238520-83238542 GCAAGCTAGAGAATTCGCTCAGG - Intronic
994352571 5:98763681-98763703 TCAAGCCTGAGAATGAACTCAGG - Intergenic
994576928 5:101590143-101590165 GCAAGAGGGAGAATGAACGCAGG + Intergenic
996624380 5:125552379-125552401 GCATGCTGGAGAATAAAATGGGG - Intergenic
998202266 5:140134524-140134546 GAAAGCTGGAGAGTTAAGTAGGG - Intergenic
998266667 5:140672217-140672239 GGAAGGTTGAGAATTAAGTCAGG + Exonic
998486817 5:142510123-142510145 GCAAGCTGGAATTTGAACTCAGG - Intergenic
998515292 5:142748478-142748500 GCAAGCAACAGAACTAACTCTGG + Intergenic
999642203 5:153682974-153682996 GAAAGATGGAGAATTAACCTTGG - Intronic
999787262 5:154902628-154902650 ATAAGCTGGTGAAATAACTCAGG + Exonic
1000917593 5:167100782-167100804 GCAATCCAGAGAATTAATTCAGG + Intergenic
1001021957 5:168190605-168190627 GAAAGCTGGAGAACTGCCTCTGG - Intronic
1003488084 6:6596828-6596850 GTACTTTGGAGAATTAACTCAGG - Intronic
1006702764 6:35989564-35989586 GAAACATGGAGAATAAACTCAGG + Intronic
1007475517 6:42117135-42117157 ACAGGGAGGAGAATTAACTCTGG - Intronic
1008346477 6:50433265-50433287 GCAGGATTGAGAATTAACTCTGG + Intergenic
1010130341 6:72485395-72485417 GCACGTTTGAGAATTACCTCAGG - Intergenic
1012726995 6:102826039-102826061 GCATGAAGGAGAATTAACACAGG - Intergenic
1016752654 6:147648275-147648297 GCAAGAAGGAGAATGAACACAGG + Intronic
1017852952 6:158321440-158321462 TCAAGTTGGAGAATGAAGTCTGG - Intronic
1024148911 7:46547542-46547564 GCAAGATGGAGAAATTACACAGG + Intergenic
1025725932 7:64059764-64059786 TCAAGTTGGATAATTAAGTCTGG - Intronic
1026708207 7:72713655-72713677 GGAAGCTGGAGATTTTACACTGG + Exonic
1027181813 7:75946019-75946041 GCAAGATGGACAAATAAATCAGG - Intronic
1027366561 7:77464396-77464418 GCAAGCTGGTGCAGAAACTCAGG + Intergenic
1031250339 7:119372101-119372123 GCAAGCTGGATAAAAAACTAAGG + Intergenic
1032625165 7:133584046-133584068 GCATGCTGGAGGTTTAACTTTGG + Intronic
1037114683 8:15210186-15210208 TCGAGCTGCAGAATTAACTGTGG + Intronic
1038788838 8:30648671-30648693 GCTAGCAGGAAAACTAACTCTGG - Intronic
1040956541 8:52985342-52985364 TCAATCTGGAAAATTAAGTCTGG + Intergenic
1043256121 8:78138771-78138793 GCAAGCTGGAGATATAATTCTGG + Intergenic
1046461678 8:114546754-114546776 GGAAGCTAGAGAATTAACCATGG + Intergenic
1047133676 8:122051650-122051672 CCAAGCTGGAGCATCAACTTCGG - Intergenic
1050566450 9:6889295-6889317 TCAAGCTGAAGAATGAACCCTGG - Intronic
1052260456 9:26509492-26509514 GCATGCTAGAGAAATAAATCCGG + Intergenic
1056918460 9:90764673-90764695 GCAAGCAGGAGGATTAATTCTGG - Intergenic
1060264937 9:122106206-122106228 GCAGGAAGGAGAATGAACTCAGG + Intergenic
1061478675 9:130885553-130885575 ACAAACTGGAGAATAATCTCCGG + Exonic
1186318178 X:8393795-8393817 GAAAGCTGGGGAAATAACTCAGG - Intergenic
1186473350 X:9838012-9838034 GTAAGCTGAAGACTTAAATCAGG + Intronic
1187563316 X:20423176-20423198 GCAAGCTGGTGAATTGGATCTGG - Intergenic
1188566047 X:31527653-31527675 GGAAGCTGGAGAAAGAACTTTGG - Intronic
1189261299 X:39680633-39680655 GCCAGCTGAAGGGTTAACTCTGG + Intergenic
1189384704 X:40527895-40527917 GCCAGCTGGTGAATTAAATGAGG + Intergenic
1190766993 X:53483474-53483496 GCAACCCGGAGAATTATCTGGGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193534652 X:82698960-82698982 GCAAGAAGGAGAATGAACACAGG - Intergenic
1198284783 X:135178678-135178700 CCAAACTGGAGAATTAAATGGGG + Intergenic
1201343807 Y:12960729-12960751 GCAAGCCGTAGAATTAATTCTGG + Intergenic