ID: 1161155484

View in Genome Browser
Species Human (GRCh38)
Location 19:2730345-2730367
Sequence CTGTGATGGGCGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 537}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161155476_1161155484 -4 Left 1161155476 19:2730326-2730348 CCCCACTTTGTGCTTCCTGCTGT 0: 1
1: 0
2: 3
3: 32
4: 343
Right 1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 34
4: 537
1161155477_1161155484 -5 Left 1161155477 19:2730327-2730349 CCCACTTTGTGCTTCCTGCTGTG 0: 1
1: 0
2: 4
3: 45
4: 451
Right 1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 34
4: 537
1161155470_1161155484 28 Left 1161155470 19:2730294-2730316 CCTGGGGAGCTGATGGCTGGTGG 0: 1
1: 0
2: 4
3: 42
4: 277
Right 1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 34
4: 537
1161155469_1161155484 29 Left 1161155469 19:2730293-2730315 CCCTGGGGAGCTGATGGCTGGTG 0: 1
1: 0
2: 3
3: 20
4: 295
Right 1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 34
4: 537
1161155478_1161155484 -6 Left 1161155478 19:2730328-2730350 CCACTTTGTGCTTCCTGCTGTGA 0: 1
1: 0
2: 0
3: 35
4: 348
Right 1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG 0: 1
1: 0
2: 1
3: 34
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161155484 Original CRISPR CTGTGATGGGCGAAGGTGGA TGG Intronic
900305896 1:2007763-2007785 CTTTGCAGGGCCAAGGTGGATGG + Intergenic
900584053 1:3424053-3424075 CTGGGCTGGGCGACGGTGAAGGG - Intronic
900897399 1:5493259-5493281 CTGTGTTGGGCAGAGGTTGATGG - Intergenic
901336116 1:8450736-8450758 CTGTGATGGGGGAACCCGGATGG - Intronic
901428417 1:9198094-9198116 ATGTGATGGGCTTAGGTGGTAGG - Intergenic
901813179 1:11779142-11779164 CTGTGAAGGCCAAGGGTGGAAGG - Intronic
902862734 1:19257726-19257748 CTGTGATGGGGGAAGGCCCAGGG + Intronic
902907879 1:19572464-19572486 CTTTGAGGGGCCAAGGTGGGTGG - Intergenic
903011707 1:20335776-20335798 CATTGAGTGGCGAAGGTGGAGGG + Intronic
903034604 1:20485850-20485872 CTGCGAGGGGCGGAGGGGGAGGG + Exonic
903083702 1:20835694-20835716 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903470601 1:23584662-23584684 CTTTGAGAGGCCAAGGTGGATGG - Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
903919973 1:26792992-26793014 ATGTGATGGGCGCATATGGAAGG - Intronic
904492433 1:30869373-30869395 CTTTGATGGGGGAAGATGGCTGG + Intergenic
904914768 1:33961786-33961808 CAGTCATGGGGGAAGGTGAAGGG - Intronic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
905121720 1:35687606-35687628 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905559164 1:38912662-38912684 CTTTGAGGGGCTGAGGTGGATGG - Intronic
906020031 1:42619799-42619821 CTTTCATGGGAGCAGGTGGATGG - Intronic
906052859 1:42888721-42888743 CTGGGAGGCGCCAAGGTGGAGGG + Intergenic
906146741 1:43565048-43565070 CTGTTGTGGGGGAAGGTGGTGGG - Intronic
906277368 1:44526571-44526593 GAGTGATGGGCCCAGGTGGAAGG - Intronic
906874388 1:49521050-49521072 CTTTGAGGGGCCAAGGTGGGTGG - Intronic
907134273 1:52124434-52124456 CTTTGAGGGGCCAAGGTGGGTGG - Intergenic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
907717126 1:56936834-56936856 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
907750728 1:57260767-57260789 CAGTGATGGGGGAAGGTATATGG - Intronic
907796837 1:57726201-57726223 GTGTGATCAGCCAAGGTGGAAGG + Intronic
908279185 1:62512652-62512674 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
908326199 1:63026210-63026232 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
908734652 1:67263327-67263349 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910491263 1:87774318-87774340 CTCTGATGGGCGTGGGTGCATGG + Intergenic
911046905 1:93636223-93636245 CTGTGAAGGGAGAAGCTGCAGGG + Intronic
912128263 1:106568289-106568311 CTGTGATGGTAGAAGCTAGAAGG + Intergenic
912139945 1:106712260-106712282 CAGTGATTGGGGGAGGTGGAGGG + Intergenic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913440192 1:118888848-118888870 CTCTGATGGCCCAAGATGGAAGG + Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914727837 1:150342910-150342932 CTTTGATAGGCCAAGGTGGGAGG - Intronic
915165135 1:153944230-153944252 CTGTGATGGGCTCAGCTGGCCGG + Exonic
915244344 1:154545681-154545703 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
915717907 1:157961816-157961838 CTGTGAAGAGCAAAGCTGGAGGG + Intergenic
916552215 1:165859908-165859930 CTGTGATGGGCAAAGCAGGGTGG - Intronic
916679719 1:167093344-167093366 CTTTGGTGGACGGAGGTGGATGG + Intergenic
916776871 1:167975794-167975816 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
916860606 1:168800505-168800527 CTGTGATGGGGCATGGTGGGTGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917354088 1:174107848-174107870 CTTTGGGGGGCCAAGGTGGACGG - Intergenic
920342615 1:205284893-205284915 CTGTCATGGGCCAGGCTGGAGGG - Intergenic
921134167 1:212245288-212245310 CAATCATGGTCGAAGGTGGAGGG - Intergenic
921939640 1:220826844-220826866 CTGTGGTGAGCGAATGTGGTAGG + Intergenic
922502689 1:226109028-226109050 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
923803092 1:237229473-237229495 CTATGATGGGGAAAGTTGGAAGG + Intronic
923941404 1:238831518-238831540 CAGTCATGGCTGAAGGTGGAGGG - Intergenic
924207924 1:241733229-241733251 CTTTGGGGGGCCAAGGTGGATGG + Intronic
924903596 1:248428368-248428390 CAATCATGGGGGAAGGTGGAGGG - Intergenic
924924273 1:248663610-248663632 CAATCATGGGGGAAGGTGGAGGG + Intergenic
1064173068 10:13051032-13051054 CTTTGAGTGGCTAAGGTGGAAGG - Intronic
1064509782 10:16077311-16077333 CTGTGAGGGGCTGAGGTGGAAGG + Intergenic
1064716823 10:18185080-18185102 TTGGGATGGGCCAAGGTGGGAGG - Intronic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1065667195 10:28075046-28075068 CAGTCATGGGGGAAGGTGAAGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066265049 10:33768665-33768687 CTGTGGGAGGCCAAGGTGGACGG + Intergenic
1066410783 10:35166896-35166918 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1067136308 10:43609927-43609949 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1067141610 10:43662248-43662270 CTGGGATGGAAGAAGGTGGGAGG + Intergenic
1069570581 10:69492354-69492376 CTGTGAGGGGCGATGGTTGGGGG - Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070375769 10:75829984-75830006 CTATGATGAGAGGAGGTGGAAGG - Intronic
1070882394 10:79861421-79861443 TTGGTGTGGGCGAAGGTGGAGGG - Intergenic
1070979064 10:80630022-80630044 CTGTGAAGGACAAAGGGGGAGGG + Intronic
1071450279 10:85787026-85787048 CATTGATGGGAGATGGTGGATGG - Intronic
1071648964 10:87377732-87377754 TTGGTGTGGGCGAAGGTGGAGGG - Intergenic
1072455911 10:95575631-95575653 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1073213978 10:101826554-101826576 TTGTGGTGGGGGAATGTGGATGG - Intronic
1073246296 10:102092544-102092566 GTGTGATAGGAAAAGGTGGATGG - Intergenic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073886644 10:108047421-108047443 CTTTGTGGGGCCAAGGTGGATGG + Intergenic
1074403003 10:113157359-113157381 CTCTGAGGGGCGGAGGTGGGAGG - Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074642548 10:115403693-115403715 CTTTGGTAGGCCAAGGTGGACGG - Intronic
1074976518 10:118586255-118586277 CTTTGGGGGGCCAAGGTGGATGG + Intergenic
1075428824 10:122363914-122363936 CTGTGTTGGGCAAAGGAAGATGG + Intergenic
1075810366 10:125220564-125220586 CTGTGGTAGGCCAAGGTGGGTGG + Intergenic
1077945589 11:6894264-6894286 CAGTAGTGGGCAAAGGTGGAAGG - Intergenic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079303771 11:19304401-19304423 CAGTCATGGGAGAAGGTGAAGGG + Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1081061495 11:38483461-38483483 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1081181895 11:39994115-39994137 CTTTGAAGGGCCAAGGTGGGTGG + Intergenic
1081245884 11:40765344-40765366 CAATTATGGGAGAAGGTGGAAGG - Intronic
1082051364 11:47773032-47773054 CTTTGGTAGGCTAAGGTGGACGG - Intergenic
1083022499 11:59521429-59521451 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1083165870 11:60887055-60887077 CTGGGGTGGGCGGAGGTGGGAGG + Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083601875 11:63953871-63953893 CTTTGAGGGGCAAAGGTGGGAGG - Intronic
1084030563 11:66478276-66478298 ATGTGATGAGAGAAGGAGGAGGG + Intergenic
1084209622 11:67615004-67615026 CTGTGATGGGGGGAGCTGGAGGG - Intergenic
1084619001 11:70255621-70255643 ATGTGATGGGAGGAGCTGGAGGG + Intergenic
1084725921 11:70941948-70941970 ATTTGAGGGGCCAAGGTGGATGG + Intronic
1085120690 11:73965566-73965588 CTCTGCTGGGCAAAGGTGGAGGG - Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086827916 11:91522426-91522448 CTATGATGGAGAAAGGTGGATGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087409717 11:97776227-97776249 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1087995265 11:104798688-104798710 TTGGGATGGGGGAAGGTAGATGG - Intergenic
1088621868 11:111693088-111693110 CTTTGAGGGGCCAAGGTGGGCGG + Intronic
1088930936 11:114350161-114350183 CTTTGGGGGGCCAAGGTGGAAGG - Intergenic
1089526992 11:119103451-119103473 CTTTGGTAGGCGAAGGTGGGTGG + Intronic
1089643629 11:119863990-119864012 CTGTGATGAGGGCAGGAGGAAGG - Intergenic
1091662552 12:2395460-2395482 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1091666262 12:2420515-2420537 GTGTGTTGGGCCAAGGTGGAAGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1092988859 12:13875283-13875305 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1094397189 12:30020577-30020599 CAGTGATGGTGGAAGGTGAAGGG + Intergenic
1096732961 12:53629113-53629135 CTTTGAGGGGCCAAGGTGGGAGG - Intergenic
1097465209 12:59914497-59914519 GTGTGATGGAGGAAGGTAGAAGG - Intergenic
1097733715 12:63157803-63157825 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1098336847 12:69413167-69413189 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1099207915 12:79749145-79749167 CTGTGATGGGGGAAGAGGAAGGG + Intergenic
1099509276 12:83513229-83513251 CTGTGATGGGGGAGCGTGGTGGG + Intergenic
1101863494 12:108501809-108501831 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1102454832 12:113065033-113065055 CTGTGATGGGAGATAGGGGATGG + Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1103115953 12:118332066-118332088 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1103315770 12:120053927-120053949 CTTTGAGGGGCCAAGGTGGGCGG + Intronic
1103762406 12:123260667-123260689 CTTTGAGAGGCTAAGGTGGAAGG + Intergenic
1103772002 12:123334462-123334484 CTTTGGGGGGCCAAGGTGGAGGG + Intronic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1105484757 13:20817102-20817124 CTTTCATGGGTGAAGGTGCAAGG + Intronic
1107028683 13:35829181-35829203 CTGTGATAGGTGTAGGAGGAAGG + Intronic
1107614418 13:42149651-42149673 CAGTGATGGGCAAAGGTGAAGGG - Intronic
1108039665 13:46328110-46328132 CTTTGAGGGGCCAAGGTGGATGG + Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110855236 13:80289778-80289800 CTTTGAGGGGCGAAGGTGGGAGG + Intergenic
1113598872 13:111554386-111554408 CAGTGCTGGGCGACAGTGGACGG - Intergenic
1113615248 13:111675931-111675953 CAGTCATGGTGGAAGGTGGAGGG + Intergenic
1113620715 13:111760844-111760866 CAGTCATGGTGGAAGGTGGAGGG + Intergenic
1113661812 13:112112814-112112836 ATGTGGTGGGCTAAGGTGGTGGG - Intergenic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1114315371 14:21505057-21505079 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
1114740117 14:25088234-25088256 CTGTGGGAGGCCAAGGTGGAAGG + Intergenic
1116183362 14:41564684-41564706 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1117867183 14:60162130-60162152 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1119193207 14:72698433-72698455 CTTTGAGGGGCCAAGGTGGGAGG + Intronic
1120400580 14:84025637-84025659 CAGTCATGGGCGAAGGTGAAGGG + Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1121423412 14:93831713-93831735 CTTTGAGAGGCTAAGGTGGACGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122471648 14:101971315-101971337 CTTTGAGGGGCCAAGGTGGGTGG - Intronic
1122811594 14:104292093-104292115 CAGGGAGGGGCGGAGGTGGAGGG - Intergenic
1122944172 14:104998161-104998183 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1123189009 14:106550118-106550140 CAATGATGGCCGAAGGTGAAGGG - Intergenic
1125537980 15:40453704-40453726 CTGTGGGAGGCCAAGGTGGAAGG + Intronic
1125551977 15:40551907-40551929 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127282269 15:57502408-57502430 CAGATATGGGGGAAGGTGGAAGG + Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1128356514 15:66931225-66931247 CTCTGAGAGGCCAAGGTGGACGG + Intergenic
1129361558 15:75027800-75027822 CTGTGATGGGGGGTGGTAGAGGG - Intronic
1129432833 15:75513521-75513543 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1130311278 15:82757573-82757595 CTTTGGGGGGCCAAGGTGGATGG - Exonic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1132137061 15:99351665-99351687 CTCCCATGGGCAAAGGTGGATGG - Intronic
1132381186 15:101368057-101368079 CTTTGAGGGGCCAAGGTGGGTGG - Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133660598 16:7913021-7913043 CTGTGGGGGGCCAAGGTGGGAGG + Intergenic
1134876630 16:17705710-17705732 CTTTGCGGGGCCAAGGTGGATGG - Intergenic
1135148605 16:19985567-19985589 CTGACATAGGCTAAGGTGGAAGG - Intergenic
1135436176 16:22428240-22428262 CTGTGATAGGCCAAGGCGGGAGG - Intronic
1136342279 16:29652467-29652489 CTTTGAGAGGCTAAGGTGGACGG + Intergenic
1137668433 16:50265633-50265655 CTGTGATGGAGGAAGGTGCAGGG + Intronic
1138578878 16:57926642-57926664 CTGTGCTGGGCACAGGAGGATGG - Intronic
1138653787 16:58478145-58478167 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139621912 16:68152117-68152139 CTTTGAGAGGCCAAGGTGGACGG + Intronic
1139700699 16:68706404-68706426 CTGTGCTGGGGGACAGTGGAGGG - Intronic
1140071850 16:71657319-71657341 CTTTGAGGGGCCAAGGTGGGTGG - Intronic
1140261435 16:73383706-73383728 CTGTGAGGGGCAGAGTTGGAGGG - Intergenic
1140358144 16:74323255-74323277 ATGGGATGGGGGTAGGTGGATGG - Intergenic
1140463466 16:75160287-75160309 CTTTGAAGGGCCAAGGTGGGTGG + Intronic
1140805962 16:78532661-78532683 CAGTGATGGCAGAAGGTGAAAGG + Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1142045389 16:87922075-87922097 CCGTGATAGGCCAAGGTGGGAGG - Intronic
1142737235 17:1908672-1908694 CTGGGAGGGGCGAAGGTGTCAGG + Intergenic
1142848430 17:2692968-2692990 CTGTGCTGGGCGCAGCCGGAGGG - Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143781035 17:9229904-9229926 GTGTGGTGGGCGGTGGTGGATGG + Intronic
1144574564 17:16420857-16420879 CTCTGGGGGGCCAAGGTGGAAGG - Intronic
1144665151 17:17097382-17097404 CTGTGGTAGGCCAAGGTGGGCGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145046329 17:19619801-19619823 CAGTGATGGTGGAAGGTGGTAGG - Intergenic
1145743750 17:27297697-27297719 CTTTGGTAGGCCAAGGTGGATGG - Intronic
1145886749 17:28387465-28387487 CTGTGGGGGGCCAAGGTGGGTGG - Intronic
1145900578 17:28488271-28488293 CTGGGATGGGCAAGGGAGGAGGG + Intronic
1146188895 17:30747696-30747718 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1146333782 17:31952016-31952038 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1146374854 17:32287188-32287210 ATGTGAGGGACGCAGGTGGATGG + Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1147001677 17:37367822-37367844 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147386230 17:40083981-40084003 CTGTAAGGGGCCCAGGTGGAGGG + Exonic
1147460313 17:40564089-40564111 TTGTGATGGGGGGTGGTGGAGGG + Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148273114 17:46279425-46279447 CTTTGGAGGGCCAAGGTGGATGG - Intronic
1148282109 17:46356372-46356394 CTCTGGGGGGCCAAGGTGGACGG + Intronic
1148304327 17:46574295-46574317 CTCTGGGGGGCCAAGGTGGACGG + Intronic
1148851835 17:50559380-50559402 GTGTGCTGGGCGCCGGTGGAGGG - Intergenic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG + Intronic
1151452956 17:74210546-74210568 CTGGGATGGGGGGAGGTGCATGG + Exonic
1152223934 17:79083978-79084000 GTGTGATGGGAGAAGCTGGTGGG - Intronic
1152327836 17:79651855-79651877 CAGTGATGGGGGGTGGTGGAGGG - Intergenic
1152418824 17:80181004-80181026 CTTTGAGAGGCGAAGGGGGAAGG - Intronic
1153431029 18:5017304-5017326 CTTTGAGAGGCAAAGGTGGAAGG + Intergenic
1153641703 18:7163191-7163213 CTGTAATGGGGGCATGTGGAAGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154143902 18:11850188-11850210 CTTTGACTGGCGGAGGTGGAGGG + Intronic
1154194571 18:12255916-12255938 CTGGGATGAGCCAAGCTGGAAGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154954115 18:21239025-21239047 CTGTTATGGGAGAGAGTGGAGGG + Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1156171897 18:34494652-34494674 CCGTGAGGGGCGCAGGGGGAGGG + Intronic
1156473256 18:37390559-37390581 CTGTCATGTGCTAGGGTGGAGGG + Intronic
1156782134 18:40863225-40863247 CTTTGAGGGGCGAAGGTGGGTGG - Intergenic
1157559449 18:48636366-48636388 CTGTGCTGGGCTCAGGTGAAGGG + Intronic
1157564429 18:48670348-48670370 GTGTAATGGGGCAAGGTGGATGG + Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1158546793 18:58404194-58404216 GGCTGATGGGCGAAGGTGGTTGG + Intergenic
1160579219 18:79874131-79874153 CTGTGATGGGGAAAGGCGGGAGG - Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161927285 19:7310700-7310722 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1162316564 19:9942537-9942559 CTGGGATGGACTGAGGTGGAAGG - Intergenic
1162330545 19:10026451-10026473 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1162850126 19:13424716-13424738 CTTTGAGAGGCTAAGGTGGAGGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163239236 19:16049542-16049564 CTTTGCGGGGCCAAGGTGGATGG - Intergenic
1163410163 19:17149219-17149241 CTTTGGGGGGCCAAGGTGGAAGG - Intronic
1163450621 19:17375063-17375085 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
1163460495 19:17434619-17434641 CTTTGAGGGGCCAAGGTGGATGG + Intergenic
1163971746 19:20804486-20804508 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1164847860 19:31449749-31449771 CTGTGAGAGGCCAAGGTGGGTGG + Intergenic
1164989504 19:32674373-32674395 CTGTGCTGGGCGAGGGAGCAAGG - Intronic
1165083374 19:33324816-33324838 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1165334393 19:35158881-35158903 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165349418 19:35268195-35268217 CTGCGGTGCGCGAAGGCGGAGGG - Intergenic
1165546517 19:36541578-36541600 CTTTGGTAGGCCAAGGTGGATGG + Intronic
1165818317 19:38657384-38657406 CTTTGTTGGGCCAAGGTGGGTGG - Intronic
1165897887 19:39154476-39154498 CTGAGCTGGGCCAGGGTGGAAGG + Intronic
1166473407 19:43099770-43099792 CTTTGAGGGGCGAAGGTCTAAGG - Intronic
1167021507 19:46879840-46879862 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1168531182 19:57130654-57130676 CTGTGATGTATGAAGATGGAGGG + Exonic
1168638622 19:58015485-58015507 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1168656565 19:58133340-58133362 CTTTGGTAGGCCAAGGTGGATGG + Intronic
925576915 2:5369692-5369714 CTGTGATGGCTGGAGATGGATGG - Intergenic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
926360929 2:12086069-12086091 CTGTGAGAGGCCAAGGTGGATGG + Intergenic
929057173 2:37888411-37888433 ATGTGATGGGGGAAGATGGCGGG + Intergenic
929503500 2:42510080-42510102 CTTTGGGGGGCCAAGGTGGATGG + Intronic
930187464 2:48424610-48424632 CTGGGATGGGGGAAGGGAGAAGG + Intergenic
932154864 2:69407194-69407216 CTTTGAGGGGCCAAGGTAGAAGG - Intronic
932860632 2:75287602-75287624 CTGTGCTGAGCATAGGTGGATGG - Intergenic
933019059 2:77167800-77167822 ATGGGATGGGGGAAGGTGGGAGG + Intronic
934123574 2:88864056-88864078 CTGGGATGGGGGAAGGTAAAAGG + Intergenic
934673384 2:96231402-96231424 CTGTGAGTGGCCAAGGTGGGAGG - Intergenic
935782400 2:106519662-106519684 CTGTGTTACACGAAGGTGGACGG - Intergenic
936267855 2:111023867-111023889 CTGCGATGGTGGAAGGTGGGTGG + Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937210288 2:120264393-120264415 CTTTGAGGGGCGGAGGTGGATGG - Intronic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937439276 2:121903011-121903033 GTGAGATGGGAGAAGGTTGAAGG + Intergenic
937479470 2:122243568-122243590 CTGTGTTGGGAGAAAGTAGAAGG - Intergenic
939772379 2:146337120-146337142 CTTTGACAGGCCAAGGTGGATGG - Intergenic
940207482 2:151219865-151219887 CTTTGAGGGGCTAAGGTGGGAGG - Intergenic
940771222 2:157841297-157841319 CTGTGATTGTCGAAGGAGAAGGG - Intronic
940803674 2:158160356-158160378 CTGATGTGGGCGAAGGTGCAGGG - Intergenic
942352085 2:175063500-175063522 CTATGGTAGGCTAAGGTGGAAGG - Intergenic
944049327 2:195449584-195449606 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
944065623 2:195616546-195616568 CTTTGAGGGGCCAAGGTGGGAGG - Intronic
944841288 2:203626181-203626203 CTTTGAGGGGCCAAGGTGGGCGG + Intergenic
945406455 2:209454578-209454600 CTTTGAGAGGCCAAGGTGGATGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946593162 2:221273970-221273992 CTCTGAAGGGCAAAGGGGGAAGG + Intergenic
948600233 2:239103747-239103769 CTGTGGTGGGCGAAGCTCGAGGG + Intronic
948720932 2:239899424-239899446 GTGTGATGGAGGAATGTGGAGGG + Intronic
948762083 2:240198574-240198596 CAGTGATGGGCGGTGATGGACGG - Intergenic
948993358 2:241565435-241565457 CTGGGATGGACAAAGGTGAAGGG - Intronic
1169696405 20:8392240-8392262 CTCAGATGGGCCAAGGAGGAAGG - Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170193279 20:13664891-13664913 CTTTGATGGGTCAAGGTGGGAGG - Intergenic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171477342 20:25422328-25422350 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1172260211 20:33557748-33557770 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1172368665 20:34369858-34369880 CTTTGTGGGGCGAAGGTGGGAGG + Intronic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1173124860 20:40327094-40327116 CTCTTATGGGTGGAGGTGGAGGG + Intergenic
1173428991 20:42968811-42968833 TTGTGATGACAGAAGGTGGATGG - Intronic
1173934063 20:46845933-46845955 CAGTGATGGTAGAAGGTGAAGGG + Intergenic
1175453973 20:59095737-59095759 CTCTTATGGGGGAAGGTAGAAGG - Intergenic
1175479145 20:59299645-59299667 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1176076542 20:63250929-63250951 CTGGGATGGGGGATGGGGGATGG - Intronic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1178071321 21:28970668-28970690 CTGTGATTCGTGAAGGTGGTCGG - Exonic
1178093464 21:29188973-29188995 CTTTGGTGGGCCAAGGTGGGTGG - Intergenic
1178465344 21:32842676-32842698 CAGTGATGGCGGACGGTGGAAGG - Intergenic
1178917989 21:36719759-36719781 CTGGGATTGGCGCAGGGGGAGGG - Intronic
1179028537 21:37700434-37700456 CTGTGACAGGCAAAGGTGGTTGG + Intronic
1179346703 21:40564960-40564982 GTGGGATGGGCAGAGGTGGAGGG + Intronic
1179355310 21:40653322-40653344 CTTTGATGTGCCCAGGTGGATGG + Intronic
1180194897 21:46187544-46187566 CTTTGAGGGGCCAAGGTGGGAGG - Intergenic
1181523676 22:23465805-23465827 CTTTGGTGGGCCAAGGTGGGCGG + Intergenic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1182354709 22:29717463-29717485 CTGGAATGGGCTAAGGTGGCTGG - Intergenic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183689555 22:39381056-39381078 CTTTGATAGGCCAAGGTGGAAGG - Intronic
1183734128 22:39634542-39634564 CTGGGAGGGGAAAAGGTGGAGGG - Intronic
1183887938 22:40900683-40900705 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1184135390 22:42546061-42546083 CTCTGAGAGGCTAAGGTGGAGGG + Intergenic
1185009351 22:48304647-48304669 TTTTGATGGGGGAAGGGGGATGG - Intergenic
1185319031 22:50192004-50192026 CTTTGGGGGGCCAAGGTGGATGG - Intronic
1185337936 22:50279086-50279108 CTGTGGTGGGCAAAGCTGGCGGG - Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
950391764 3:12702372-12702394 CTTTGATAGGCTAAGGTGGGCGG - Intergenic
950550963 3:13665692-13665714 CTGTGATGGGCGTGGGAGGTAGG + Intergenic
950559113 3:13711795-13711817 CTGTGATGGGAGCATGTGGAGGG + Intergenic
950559126 3:13711856-13711878 CTGTGATGGGAGCATGTGGAGGG + Intergenic
950626787 3:14253198-14253220 CTGTGCTGGGCGAAGTAGGGTGG + Intergenic
951715767 3:25644455-25644477 CTCTGGGGGGCCAAGGTGGATGG + Intronic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952318040 3:32248889-32248911 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
952753434 3:36844468-36844490 CTTTGAGGGGCCAAGGTGGGCGG - Intronic
953323339 3:41991998-41992020 CTTTGGGGGGCCAAGGTGGATGG + Intergenic
953682515 3:45050592-45050614 CTGTCATGGCAGAAGGTGAAGGG - Intergenic
953686982 3:45085714-45085736 TTGGGATGGGAGAAGGTGTACGG + Exonic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
956815255 3:72902591-72902613 CTTTGATAGGCCAAGGTGGGAGG + Intronic
957174336 3:76786417-76786439 CAGTGATGGCAGAAGGTGAAGGG + Intronic
957191911 3:77020959-77020981 CTTTGGTAGGCTAAGGTGGAAGG + Intronic
957954650 3:87169963-87169985 CTTTGGTAGGCCAAGGTGGAAGG - Intergenic
958049264 3:88323655-88323677 CTGTGAAGGTTGAAGGTGAATGG + Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
959260461 3:104072919-104072941 CTTTGATGGGCCAAGGTGGGAGG + Intergenic
959891714 3:111563319-111563341 CTGTTATGGGAAAAGGTGAAAGG + Intronic
960798530 3:121514083-121514105 CTGTGGGAGGCCAAGGTGGACGG + Intronic
961255702 3:125549728-125549750 CTTTGGTGGGCCGAGGTGGAAGG - Intronic
961651677 3:128419937-128419959 CTGTGATGGCCGCAGCGGGAGGG + Intergenic
961739174 3:129021999-129022021 CTGTGAGGGGCAGAGGTGGCCGG + Intronic
962063500 3:131954638-131954660 ATGGGATGGGGGAAGGTGGGAGG - Intronic
963311710 3:143716935-143716957 CAGGGATGGGCAAAGGAGGAAGG + Intronic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966569212 3:181422177-181422199 CTTTTATGGGGGAAGATGGAGGG - Intergenic
966614467 3:181898620-181898642 CTTTGATGGGCCGAGGTGGGCGG - Intergenic
966797006 3:183724984-183725006 CTTTGAGAGGCCAAGGTGGATGG - Intronic
966941892 3:184753101-184753123 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966941954 3:184753362-184753384 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966941961 3:184753391-184753413 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966941976 3:184753446-184753468 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942053 3:184753754-184753776 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942078 3:184753851-184753873 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966942085 3:184753880-184753902 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942115 3:184753990-184754012 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
966942140 3:184754087-184754109 AAGTGATGGGAGAAGGTGGTGGG + Intergenic
966942242 3:184754487-184754509 AGGTGATGGGAGAAGGTGGTGGG + Intergenic
967082238 3:186060959-186060981 CTGTGATGGGCACAGCTGCATGG - Intronic
967101089 3:186216241-186216263 CTTTGAGAGGCCAAGGTGGATGG - Intronic
967205670 3:187118577-187118599 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
967325017 3:188230325-188230347 CTTTGGAGGGCCAAGGTGGATGG - Intronic
967879741 3:194293077-194293099 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
969013835 4:4089774-4089796 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
969852123 4:9966410-9966432 CTCTGATGGGCCAAGGTGGGTGG + Intronic
970072391 4:12176061-12176083 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
971094236 4:23380757-23380779 CTTTGAGAGGCTAAGGTGGAAGG - Intergenic
971179615 4:24316935-24316957 CTGCCATGGGTGTAGGTGGAGGG + Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
972442334 4:39106973-39106995 CTCTGAGAGGCCAAGGTGGAAGG - Intronic
972592075 4:40497373-40497395 CTTTGAGAGGCCAAGGTGGAGGG + Intronic
973235716 4:47901936-47901958 CTTTGAGGGGCCAAGGTGGGTGG + Intronic
974605873 4:64148681-64148703 CTTTGGGGGGCCAAGGTGGACGG - Intergenic
974836117 4:67253040-67253062 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
975600355 4:76093318-76093340 CTGTGATGGGCTGAGATGGGAGG + Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977767878 4:100822369-100822391 CTTTGAAGGGCCAAGGTGGGCGG + Intronic
978596258 4:110380132-110380154 CTGGTATGGGCGAATGAGGATGG + Intronic
979270842 4:118759752-118759774 CTGTGATGGACGTGGGTGGGAGG - Intronic
979420888 4:120503585-120503607 CTGTCATGGCGGAAGGTGAAGGG + Intergenic
979835617 4:125363735-125363757 CTTTGAGAGGCCAAGGTGGACGG - Intronic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG + Intronic
982805208 4:159754942-159754964 CTGTGATGGGAGAAGCTGCCTGG - Intergenic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
984647427 4:182234487-182234509 CTTTGAGGGGCCAAGGTGGGTGG + Intronic
984747183 4:183232889-183232911 CTTTGAGAGGCCAAGGTGGATGG - Intronic
985237323 4:187890328-187890350 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
987162032 5:15154803-15154825 CAATCATGGGGGAAGGTGGAGGG + Intergenic
987427273 5:17787402-17787424 CTGTGAAGGGTGAAGGGTGAGGG - Intergenic
988152292 5:27399809-27399831 CTGGGATGGGGGGAGGGGGAAGG + Intergenic
991094698 5:62727571-62727593 CTGTGATGGGTGTTGGTGGAAGG - Intergenic
992969756 5:82044165-82044187 CAGTCATGGGGGAAGGTGAAAGG + Intronic
993795952 5:92268072-92268094 CTGTGTTGGGAGAGAGTGGATGG - Intergenic
994651192 5:102531066-102531088 CTTTGGGGGGCCAAGGTGGAAGG + Intergenic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
995045172 5:107638094-107638116 CTTTGAGAGGCCAAGGTGGACGG - Intronic
995503418 5:112833422-112833444 CTTTGAGGGGCCAAGGTGCACGG - Intronic
995967962 5:117932108-117932130 CTCTGAGAGGCCAAGGTGGACGG - Intergenic
998103562 5:139454477-139454499 GTGTGATGTGTGAAGGTGTATGG + Intronic
999278579 5:150349360-150349382 TGGTGGTGGGAGAAGGTGGAGGG - Intergenic
999333993 5:150699539-150699561 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1000013725 5:157258376-157258398 CTTTGAGGGGCTAAGGTGGGTGG + Intergenic
1000754941 5:165146700-165146722 CTTTGATAGGCCAAGGTGGGTGG - Intergenic
1001085114 5:168694932-168694954 CTGTGCTGGGAGAAAGTGCATGG - Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1002381352 5:178832009-178832031 CTGTGATGGGAGCAGGTTGGGGG - Intergenic
1002627671 5:180542506-180542528 CTGTGGTAGGCCAAGGTGGGTGG - Intronic
1003530593 6:6934378-6934400 CTTTGAGAGGCTAAGGTGGAAGG + Intergenic
1003600281 6:7510615-7510637 CTTTGAGGGGCTGAGGTGGAAGG - Intergenic
1003652143 6:7970597-7970619 CAGTGATGGTGGAAGGTGAAGGG - Intronic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1005365935 6:25077091-25077113 CTTTGAGGGGCCAAGGTGGGTGG + Intergenic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1006869025 6:37233480-37233502 CTCACATGGGAGAAGGTGGAAGG + Intronic
1006930841 6:37687310-37687332 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007905478 6:45455667-45455689 GTGTGATGGACTAGGGTGGAAGG + Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009803196 6:68569027-68569049 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010232443 6:73546811-73546833 CTTTGAAGGGCCAAGGTGGGTGG + Intergenic
1010251096 6:73708140-73708162 GTGGGATGGGGGAAGGGGGAAGG - Intronic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011457806 6:87570794-87570816 CTTTGAGGGGCGGAGGTGGGAGG - Intronic
1013248211 6:108308392-108308414 CTTTGAGGGGCCAAGGTGGGAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1015562341 6:134530116-134530138 CTGTGATGTGGGTAGGTTGATGG - Intergenic
1016592527 6:145762400-145762422 CTGTCACGGGCGAAGGCGGAGGG + Intergenic
1017250494 6:152275003-152275025 CTGGGATGGGAGAAGCTGGGAGG - Intronic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018534238 6:164802801-164802823 TTGTGATGGGGGAAGGGGCAGGG + Intergenic
1018630171 6:165815580-165815602 ATGGGGTCGGCGAAGGTGGACGG + Intronic
1019174540 6:170153582-170153604 CTGGGGTGGGCGTGGGTGGAGGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019691995 7:2420562-2420584 CTTTGGGGGGCCAAGGTGGAAGG + Intronic
1019902688 7:4035226-4035248 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1021056617 7:16056132-16056154 CAGTGATGGTGGAAGGTGAAGGG + Intergenic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1022688060 7:32615426-32615448 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1022806645 7:33829264-33829286 CACTGAAGGGCGAAGGGGGATGG - Intergenic
1023032858 7:36106208-36106230 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1023788584 7:43733535-43733557 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1024482650 7:49880681-49880703 GTGGGATGGGGGAAGGGGGAAGG + Intronic
1024687144 7:51758407-51758429 CTGGGATGGAGGAAGGTGAACGG + Intergenic
1025698937 7:63798215-63798237 CTTTGGTGGGTGAAGGTGGGAGG - Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026563380 7:71469047-71469069 CGGTGTTGGGAGAAGGTGGTTGG + Intronic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026918997 7:74141274-74141296 CTTTGATAGGCCAAGGTGGGCGG - Intergenic
1027553174 7:79627291-79627313 CTTTGAGGGGCCAAGGTGGGAGG - Intergenic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1029267984 7:99357570-99357592 CTTTGAGGGGCTGAGGTGGAAGG - Intronic
1029659745 7:101952142-101952164 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1030244250 7:107363711-107363733 CTTTGAGAGGCCAAGGTGGACGG + Intronic
1030865652 7:114699057-114699079 TGGTGAAGGGAGAAGGTGGAAGG - Intergenic
1031299770 7:120050589-120050611 CTTTGGTGGGCCAAGGTGGGTGG + Intergenic
1031884574 7:127232491-127232513 CTGTGGGAGGCCAAGGTGGATGG - Intronic
1031940627 7:127785150-127785172 CTGTGGGAGGCCAAGGTGGAAGG - Intronic
1033841289 7:145377480-145377502 CAATGATGGCAGAAGGTGGAGGG + Intergenic
1034290134 7:149924130-149924152 CTTTGAGGGGCCAAGGTGGGTGG + Intergenic
1034660935 7:152768717-152768739 CTTTGAGGGGCCAAGGTGGGTGG - Intronic
1034820862 7:154215156-154215178 CAGTGATGGCGGAAGGTGGAAGG + Intronic
1034973412 7:155433534-155433556 CAGTCATGGTGGAAGGTGGAGGG - Intergenic
1036047516 8:5160384-5160406 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1036698718 8:10996767-10996789 CTTTGAGGGGCCAAGGTGGGAGG + Intronic
1037315720 8:17597262-17597284 CTTTGAGAGGCCAAGGTGGACGG - Intronic
1037615700 8:20517215-20517237 CTGTCATGGGAGCAGGGGGAGGG + Intergenic
1037965835 8:23133463-23133485 CTGTGGGAGGCCAAGGTGGATGG + Intergenic
1038893676 8:31756349-31756371 CTGTTAAGGGCAAAGGAGGAAGG + Intronic
1038946446 8:32366344-32366366 CTGAGATGGGTGGAGGTGGGGGG - Intronic
1041126598 8:54647170-54647192 CTTTGAGGGGCCAAGGTGGGTGG + Intergenic
1041439037 8:57874263-57874285 CTGTAATTGGTGAAGGTGGGAGG - Intergenic
1042390087 8:68224258-68224280 CTTTGAGGGGCCAACGTGGAAGG - Intronic
1042556943 8:70041642-70041664 CTTTGGGGGGCCAAGGTGGAAGG - Intergenic
1043075466 8:75693343-75693365 CTTTGAGGGGCCAAGGAGGATGG + Intergenic
1044662664 8:94606500-94606522 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1045630073 8:104108540-104108562 CTCTGGGGGGCCAAGGTGGAAGG - Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047181553 8:122593584-122593606 CTGTGCTGGGAGAAGGTTTATGG - Intergenic
1048288058 8:133157864-133157886 GTGTTCTGGGAGAAGGTGGATGG - Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1050704833 9:8385281-8385303 CTTTGGGGGGCCAAGGTGGAAGG + Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052666097 9:31496981-31497003 CTGTGATGGGGCAGGGTGGGGGG + Intergenic
1053068691 9:35087607-35087629 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1055203211 9:73693637-73693659 CGTTGAAGGGCGTAGGTGGAAGG + Intergenic
1055715631 9:79114717-79114739 CTCTGATGGGCGTAGAGGGAGGG - Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056236567 9:84600574-84600596 CTTTGAGGGGCCAAGGTGGGTGG - Intergenic
1056329011 9:85506234-85506256 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1056730074 9:89157863-89157885 CTTTGGTAGGCGAAGGTGGGAGG - Intronic
1057565616 9:96163948-96163970 CTGTGATGGGGCAGGGTGGCAGG - Intergenic
1057595519 9:96412939-96412961 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057865577 9:98677786-98677808 CTGTGAAGGTCGAGGCTGGAGGG - Intronic
1058994614 9:110287571-110287593 CTGTGGGAGGCCAAGGTGGATGG - Intergenic
1059869003 9:118549959-118549981 CTGTCATGGGAGAAAGTAGATGG + Intergenic
1060475167 9:123981253-123981275 CTGTGCTGGGCAAGGGGGGAGGG + Intergenic
1061560654 9:131400653-131400675 CTTTGATAGGCGGAGGCGGAGGG - Intronic
1061601923 9:131676008-131676030 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1186145015 X:6616001-6616023 CTATGATGGCAGAAGGTGAAGGG - Intergenic
1186382847 X:9079019-9079041 CTTTGAGGGGCCAAGGTGGGTGG + Intronic
1186894346 X:13990973-13990995 CTTTGGTGGGCCAAGGTGGAAGG - Intergenic
1188016513 X:25112853-25112875 CTGTGGGAGGCCAAGGTGGAAGG - Intergenic
1188557060 X:31424374-31424396 CTGTGATTGGACAAGGTTGAGGG + Intronic
1188677872 X:32965246-32965268 CTTTGAGGGGCCAAGGTGGGCGG + Intronic
1189169110 X:38891927-38891949 CTGTGTTGGGCTAAAGTGGTTGG - Intergenic
1189486851 X:41441053-41441075 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1190026724 X:46930738-46930760 CTGTGATGGGGGCAAATGGATGG - Intronic
1191749043 X:64521143-64521165 ATGTGAGGAGCGAAGGGGGAAGG - Intergenic
1191798200 X:65046163-65046185 CTGTTATGGGCTAATGTAGATGG - Intergenic
1193315065 X:80055490-80055512 CTGGGATGGGGGGAGGTGAATGG - Intergenic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194078881 X:89433008-89433030 CTGAGATGGTGGAAGGGGGAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196823012 X:119718404-119718426 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1198676995 X:139141637-139141659 CTGGGATGGAAGAATGTGGAGGG - Intronic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1200222272 X:154397095-154397117 CTTTGAGGGGCGGAGGTGGGCGG - Intronic
1201481148 Y:14440896-14440918 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic
1201600161 Y:15719566-15719588 CTTTGAGAGGCCAAGGTGGATGG - Intergenic