ID: 1161155597

View in Genome Browser
Species Human (GRCh38)
Location 19:2730749-2730771
Sequence CTCCTGGAGTGGAAGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 2, 1: 3, 2: 2, 3: 25, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161155581_1161155597 19 Left 1161155581 19:2730707-2730729 CCAGAACAGGCCCCAAGCTTCCA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283
1161155586_1161155597 7 Left 1161155586 19:2730719-2730741 CCAAGCTTCCAACAGCAGTGGGG No data
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283
1161155589_1161155597 -1 Left 1161155589 19:2730727-2730749 CCAACAGCAGTGGGGTAAGGACC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283
1161155584_1161155597 8 Left 1161155584 19:2730718-2730740 CCCAAGCTTCCAACAGCAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 421
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283
1161155582_1161155597 9 Left 1161155582 19:2730717-2730739 CCCCAAGCTTCCAACAGCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283
1161155580_1161155597 20 Left 1161155580 19:2730706-2730728 CCCAGAACAGGCCCCAAGCTTCC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG 0: 2
1: 3
2: 2
3: 25
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161155597 Original CRISPR CTCCTGGAGTGGAAGTTGGG GGG Intronic
900490931 1:2948789-2948811 CTCCTGGAGTGGACAGTGGATGG + Intergenic
900523764 1:3118667-3118689 CTCCAGGACTGGCAGTCGGGGGG + Intronic
901078228 1:6569006-6569028 CTCCCGGAGCGGAAGTGAGGAGG + Intronic
902286415 1:15410881-15410903 TAACTGGAGAGGAAGTTGGGGGG - Intronic
902812303 1:18895376-18895398 CTCCTGCACTGGAAGTTGTCAGG + Intronic
902901836 1:19522695-19522717 CTCCGGGAGGCCAAGTTGGGTGG - Intergenic
903957744 1:27036769-27036791 CTCAGAGAGTGGAATTTGGGGGG - Intergenic
904480389 1:30789628-30789650 CTCCTGGAGTGGGGGTGAGGCGG + Intergenic
905196159 1:36279005-36279027 CTCCGGGAATGGGAGTCGGGGGG + Intronic
905305608 1:37015746-37015768 CTCCTGGACTGCAACGTGGGAGG - Intronic
905416549 1:37808216-37808238 CTCCTGGACCGGAAGCTGGCTGG - Exonic
905791109 1:40790026-40790048 CTCCTAGTGTGGGAGTTGAGAGG + Intronic
906000483 1:42420434-42420456 CACGTGGAGTGGAAGGTGAGTGG - Exonic
906706524 1:47899157-47899179 CACCTGGAGTGGAAGTCAGATGG - Intronic
908132127 1:61083606-61083628 CTCCCGGAGTGAAAGTTTCGGGG + Intronic
910200020 1:84690153-84690175 CTCCTGGAGGAGGAGGTGGGAGG - Intronic
911436737 1:97869591-97869613 CTCCTGGTATGGAAGAAGGGAGG - Intronic
912555800 1:110515140-110515162 ATCATGAAGTGGAAGTTGTGTGG + Intergenic
916168355 1:161982676-161982698 TTCCTGGAAGGGAAGGTGGGAGG + Intergenic
917155377 1:171992035-171992057 CTACTAGATTGGAAGTTGTGAGG - Intronic
918546788 1:185693715-185693737 TTCCTGGAGTGCAAGTAGGATGG - Intergenic
919808150 1:201392970-201392992 CTGTTGGATTGGATGTTGGGTGG + Intronic
920048947 1:203151864-203151886 CCCATGGAGAGGAAGATGGGGGG - Intronic
921910848 1:220547409-220547431 CTCCTGGAGAGGAAGGTAGAAGG - Intronic
922095775 1:222441709-222441731 TTCCTGGAATGACAGTTGGGAGG - Intergenic
922321938 1:224496228-224496250 CTCCTCGAGTGGATGGTGGTTGG - Intronic
923045109 1:230350006-230350028 GTTCTGGAGTGGATGTGGGGAGG + Intronic
924144530 1:241060471-241060493 AACTGGGAGTGGAAGTTGGGGGG - Intronic
1063368302 10:5504784-5504806 CTCCAGGAGAGGGAGTCGGGGGG - Intergenic
1063420273 10:5906918-5906940 CTCCAGGTGGGGAAGGTGGGAGG - Intronic
1063947399 10:11191435-11191457 CTCCTGGTGTTGCAGTGGGGAGG + Intronic
1064008612 10:11717302-11717324 CTCCTGGAGTGTGAGTTGTATGG + Intergenic
1064067257 10:12192960-12192982 CTTCAGGTGTGGCAGTTGGGTGG + Intronic
1064685863 10:17860519-17860541 CTTTGGGAGTCGAAGTTGGGAGG - Intronic
1067540181 10:47145137-47145159 GGGCTGGAGTGGTAGTTGGGAGG + Intergenic
1067777114 10:49171735-49171757 CTCCTGGGGAGGAAGATGGCAGG + Intronic
1068207706 10:53877781-53877803 CTGATGGACTGGAAGTAGGGAGG - Intronic
1069062565 10:63909469-63909491 GTCCTGGAGAGGGAGTCGGGAGG + Intergenic
1070568793 10:77625014-77625036 CTCCTGGAGGGGGAATTTGGAGG + Intronic
1070745239 10:78929794-78929816 AATCTGGAGTGGGAGTTGGGGGG + Intergenic
1070782872 10:79147685-79147707 CTCCTGGAATGGCAGTGGGGTGG - Intronic
1071301771 10:84261463-84261485 CTCCATGAGTGGGAATTGGGGGG - Intergenic
1072942971 10:99783996-99784018 CTTGTGAAGTGGAAGTTGGGGGG - Intronic
1074231234 10:111537928-111537950 CTCCTGAAGTGGAGGTGGGGAGG + Intergenic
1075634300 10:124019856-124019878 CGCCTGGTGTGGGAGATGGGGGG - Intronic
1075635493 10:124027614-124027636 CTCCTGATGTGGATGCTGGGGGG + Intronic
1076164011 10:128267876-128267898 CTTCTGGAGTCCAAGGTGGGGGG + Intergenic
1076573970 10:131451791-131451813 CTGCTGGAGTGGGAGTGAGGAGG - Intergenic
1077537866 11:3133121-3133143 CGCCTGGAGTGGCAGATGGCCGG - Intronic
1079266058 11:18934300-18934322 ATCCTGGAGTGGATGTTATGTGG - Exonic
1081806900 11:45895913-45895935 CAGCTGGGGTGGAAGTGGGGAGG - Intronic
1081862662 11:46342378-46342400 CTCCTGGAGGGGAAGCAGGCAGG - Intronic
1082092330 11:48100106-48100128 CTCCTTGGGTGGAGGTGGGGTGG + Intronic
1084561163 11:69906164-69906186 GTCCTGCACTGGAAGCTGGGAGG + Intergenic
1086766938 11:90707122-90707144 GTCCTGAAGTGGTATTTGGGTGG + Intergenic
1087165042 11:94994702-94994724 CCCCTGGAGCAGAATTTGGGAGG + Intronic
1087368095 11:97247753-97247775 ATACAGGAGTGGGAGTTGGGGGG + Intergenic
1087684587 11:101248770-101248792 ATCCTGGAGTGGATGTGTGGTGG + Intergenic
1089610207 11:119664658-119664680 CTCCTGGAGTGGGAGGTGGGGGG + Exonic
1090417371 11:126549802-126549824 CTCCTGGGGTGGAAGCGGTGTGG + Intronic
1090493892 11:127191105-127191127 CTCCAGGAGTTGGAGTGGGGTGG + Intergenic
1091349629 11:134882526-134882548 CTCCTGTTGTGGAAGGTGAGAGG - Intergenic
1092039398 12:5370703-5370725 CTGCTGGAGGGGAAGCTTGGGGG - Intergenic
1092081622 12:5721096-5721118 CTCCTGGATTAGAAGTTGTAGGG + Intronic
1093760121 12:22900293-22900315 GTACTGGATTGGAAGTAGGGAGG - Intergenic
1094216316 12:27946559-27946581 CTGATGGATTGGAAGATGGGTGG + Intergenic
1095791926 12:46176946-46176968 CTTCTAGGGTGGAAGGTGGGAGG - Intergenic
1096473956 12:51896680-51896702 CATCTGGAGTAGAAGTTGGCAGG - Intergenic
1096719104 12:53507883-53507905 GTCCTGGAGTGGAAGAGGAGTGG + Intronic
1097278636 12:57830536-57830558 CTGCTGGAGTGGAGGAGGGGAGG - Intronic
1102029328 12:109730918-109730940 CTCCTGGGGTGAGAGCTGGGCGG + Intronic
1104600678 12:130151326-130151348 CTCCTGGAGAGGAATCTGAGTGG - Intergenic
1105768116 13:23580162-23580184 CTCCTGGAGATCAAGTTTGGCGG + Intronic
1105781133 13:23706053-23706075 CTCAGGGAGTGGAGGTTGGTGGG - Intergenic
1106197433 13:27506313-27506335 AACCTGGAGTGAAAGTGGGGTGG - Intergenic
1107668564 13:42718372-42718394 CTTCTAGAGTGGTAGTGGGGAGG + Intergenic
1109595624 13:64549854-64549876 CCACTGGAGTGGAAGTATGGAGG - Intergenic
1110921205 13:81088198-81088220 TACCAGGAGTGGAAGGTGGGAGG + Intergenic
1111674243 13:91367412-91367434 GTCCTGGTCTGGAAGTGGGGTGG - Intergenic
1112197456 13:97239954-97239976 CTCCTGGGGTTGGAGTTGGGTGG - Intronic
1113033865 13:106026371-106026393 TTCCAAGAGTGGAAGTCGGGTGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113469837 13:110536478-110536500 CTCGGGGAGAGGAAGTGGGGAGG - Intronic
1113780781 13:112975937-112975959 CTCCTGGGGTGGAAGGAGGGAGG - Intronic
1113840465 13:113356891-113356913 CTCCTGGAAGGGAACCTGGGAGG + Intronic
1119443529 14:74645810-74645832 CTCCTTGAGAGGAAGTAAGGGGG - Intergenic
1119735370 14:76978051-76978073 CTCCTGGAGGGGAATTTCAGAGG + Intergenic
1121329701 14:93042088-93042110 CTCCTGCAGTGGGTGTTGTGAGG - Intronic
1121549250 14:94786193-94786215 CTTCTGGAGGCGAAGGTGGGAGG - Intergenic
1121708922 14:96022389-96022411 GTCCTGGAGTGGAGGATGGCTGG - Intergenic
1122029095 14:98899629-98899651 CACCTGGAGAGGAAGTGTGGCGG - Intergenic
1122879402 14:104683339-104683361 CTCTTGGAGTGGACGGTGGGAGG - Intergenic
1122929114 14:104925376-104925398 CTCCTGCAATGGAACCTGGGAGG - Intronic
1123002969 14:105306231-105306253 CTCCAGGAGGGGAAGTTTGCAGG - Exonic
1124127692 15:26952043-26952065 CTCCTTGAATGGTAGTTGGGGGG - Intergenic
1125732290 15:41899947-41899969 CCCCTGGAAGGGAGGTTGGGAGG + Exonic
1129056335 15:72823074-72823096 CTACTGGTGTGGAAGAAGGGAGG - Intergenic
1129059867 15:72852228-72852250 CTCCTGAGGTGAAAGTTTGGTGG + Intergenic
1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG + Intergenic
1131919089 15:97303342-97303364 CTCCTGGATGGGAAATGGGGTGG - Intergenic
1132568660 16:634711-634733 CTCCTGGAGAGGATGGTAGGTGG - Exonic
1133165341 16:3942961-3942983 CTTCGGGAGTGCGAGTTGGGCGG + Intergenic
1133414836 16:5598289-5598311 TTGCTGGAGTGGAAGGTGGAAGG + Intergenic
1133753667 16:8745223-8745245 CTCTGGGAGTCGAAGGTGGGTGG - Intronic
1135147068 16:19972036-19972058 CAACTGGAGTTGAAGTTGGAAGG + Intergenic
1136164726 16:28445782-28445804 CCCCTGGGTTGGAAGGTGGGAGG - Intergenic
1136198240 16:28669199-28669221 CCCCTGGGTTGGAAGGTGGGAGG + Intergenic
1136214586 16:28783375-28783397 CCCCTGGGTTGGAAGGTGGGAGG + Intergenic
1136259307 16:29063219-29063241 CCCCTGGGTTGGAAGGTGGGAGG + Intergenic
1136299145 16:29321430-29321452 CTCCGGGTGAGGAAGTGGGGTGG + Intergenic
1136532223 16:30877197-30877219 CTCCTGGAGTGGTCATGGGGCGG - Intronic
1138535658 16:57658938-57658960 ATCCTGGAGTGGGGGTGGGGTGG + Intronic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139485859 16:67256249-67256271 CTCCTGGAAGGGAAGGTGGAAGG - Intronic
1140681999 16:77394155-77394177 TTGCTGGGGTGGAAGTGGGGAGG + Intronic
1141137093 16:81473564-81473586 CTTTTGGTGTGGGAGTTGGGCGG + Intronic
1141710657 16:85697105-85697127 CTCCAGGAAGGGAGGTTGGGAGG - Intronic
1142103682 16:88290671-88290693 CTGCTGTAGTTGAGGTTGGGGGG - Intergenic
1142224982 16:88872842-88872864 CTCAAGGAGTGGGTGTTGGGAGG - Intergenic
1142733582 17:1879932-1879954 CTCCTGGAGTTGAGGGAGGGAGG + Intronic
1143070991 17:4293137-4293159 CTGCTGGAGGGGAGGTGGGGGGG - Intronic
1146509437 17:33433394-33433416 GTCATTGAGTGGAAGTTTGGAGG + Intronic
1147326574 17:39672546-39672568 CTCCTGGAGCTGAACTGGGGTGG - Exonic
1147658097 17:42102310-42102332 TTCCTGGAGAGGAAGGGGGGTGG + Exonic
1147795092 17:43036566-43036588 GTCCTGGAGGAGGAGTTGGGAGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148773690 17:50081290-50081312 ATCCTGGATTGGGAGTGGGGTGG - Exonic
1148806356 17:50265978-50266000 CTGCTGGAGTGGAGGTTATGCGG - Intergenic
1149496469 17:57121428-57121450 CTCCTGCAGAGGCAGTTGTGTGG - Intergenic
1149689752 17:58565355-58565377 CTCCAGGAAAGGAATTTGGGTGG + Intronic
1149796073 17:59521316-59521338 CTTCTGGAGTCCAAGGTGGGAGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150628824 17:66861968-66861990 TTTCTGGTGTGGGAGTTGGGTGG + Intronic
1151343028 17:73484127-73484149 CCCCAGGAGTGGGAGCTGGGTGG - Intronic
1151518743 17:74613866-74613888 ACCCTGGGGTGGAAGCTGGGGGG - Intronic
1152024579 17:77800506-77800528 CTCCTGGGGTAGAGGATGGGTGG - Intergenic
1152309102 17:79538391-79538413 CTCATGGACTGCAAGGTGGGAGG - Intergenic
1152864309 17:82713059-82713081 CTGCTGGCTTGGAAGGTGGGTGG + Intergenic
1153231349 18:2939499-2939521 CACATGGAGTGGACGTGGGGCGG - Exonic
1153497000 18:5709836-5709858 CTCCTGGAGGAGAAGTGGGCAGG + Intergenic
1153756842 18:8292655-8292677 TTCCTGGATAAGAAGTTGGGAGG + Intronic
1154268015 18:12895800-12895822 CTCCAGGAGGCCAAGTTGGGAGG - Intronic
1154340866 18:13501029-13501051 CACCTGGAGAGGAAGTTGCAGGG + Intronic
1155081426 18:22414031-22414053 CTCCCAGAATGGAAGTTAGGTGG - Exonic
1157273605 18:46294752-46294774 CTCCAGGAGTGGGGGGTGGGGGG - Intergenic
1158247806 18:55451740-55451762 CTTCTGGACTGGATCTTGGGTGG - Intronic
1158872254 18:61699411-61699433 CACCTTGATTGGAAGTTGGTAGG + Intergenic
1160920091 19:1515492-1515514 CTCCTGGGGTCCCAGTTGGGCGG + Intergenic
1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155613 19:2730811-2730833 CCCCTAAAGTGGAAGTTGGGGGG + Intronic
1161155632 19:2730873-2730895 CCCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155650 19:2730935-2730957 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155665 19:2730999-2731021 CCCCTGAAGTGGAAGTTGGCGGG + Intronic
1161155686 19:2731064-2731086 CCCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155705 19:2731126-2731148 CCCCTGGAGTGGAAGTTGGGGGG + Intronic
1161218727 19:3107940-3107962 CTCCTGTCCTGGAACTTGGGTGG + Intronic
1161794016 19:6376162-6376184 TGCCTGGAGTGGAAGTCAGGGGG + Intronic
1162333472 19:10045285-10045307 CTTTTGGGGTGGAAGTTGGAAGG + Intergenic
1162743386 19:12786095-12786117 CTCCTGGAGAGGAAGCTGCTAGG - Intronic
1163174168 19:15552552-15552574 ATGCTGGAATGGAAGTTGAGTGG + Intergenic
1163703921 19:18801326-18801348 CACCTGGTGGGGAAGTGGGGGGG - Intergenic
1165487663 19:36105146-36105168 CTCTTCAAGTGGAAGTGGGGAGG + Intergenic
1165831355 19:38732063-38732085 CTCCTGCAGTGGCAGCTGAGGGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1168721065 19:58555300-58555322 GTCCTCAAGTGGAGGTTGGGTGG - Intergenic
926625095 2:15084619-15084641 CTCCAGAAGTGGAAGATGGAAGG - Intergenic
928854895 2:35791284-35791306 CTCCTGGAGTGTGTGTTGGGGGG - Intergenic
930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG + Intronic
931815709 2:65898458-65898480 ATCCTGTAGTGTCAGTTGGGTGG - Intergenic
932406390 2:71515550-71515572 CTCTTGGGGTGGATGGTGGGTGG + Intronic
933926412 2:87094273-87094295 CTCCAGGACTGGAAGGTGAGAGG - Intergenic
935040797 2:99425231-99425253 CTCATGGTCTGGATGTTGGGAGG - Intronic
935655502 2:105419492-105419514 CTCTTGGTATGGAAGATGGGAGG - Intronic
935672889 2:105570713-105570735 CTCTTGGAGTGGGGTTTGGGGGG + Intergenic
938169197 2:129059753-129059775 GCCCTGGGGTGGAAGTTAGGAGG - Intergenic
938381342 2:130837900-130837922 CTCCCGGAGTTGAAGACGGGAGG + Intronic
938969647 2:136420513-136420535 CTCCCAGAGTGGAAGCTGGAGGG - Intergenic
939694490 2:145307741-145307763 CTCTAGGTGTGTAAGTTGGGCGG + Intergenic
939825941 2:147015603-147015625 CAACTGGAGTGGAAGGAGGGGGG + Intergenic
942219845 2:173758296-173758318 CTCATGGAGTGGGAGGTTGGGGG + Intergenic
947152080 2:227125876-227125898 CTCCAGGAGCAGAGGTTGGGTGG - Intronic
947634768 2:231674361-231674383 CTCTGAGAGTGGAAGTGGGGAGG + Intergenic
948092712 2:235308249-235308271 CTACTGGGTTGGAAGTAGGGTGG - Intergenic
948935500 2:241161713-241161735 GTGCTGGAGGGGAACTTGGGAGG + Intronic
1168792929 20:592079-592101 GGGCTGGACTGGAAGTTGGGAGG - Intergenic
1168995766 20:2132075-2132097 TCTCTGGAGTGGGAGTTGGGGGG - Intronic
1169189870 20:3651772-3651794 CTCCTGTAGGGGAAGATGGCAGG + Intergenic
1169496656 20:6122511-6122533 ATCCTGGGGCGGATGTTGGGTGG + Intronic
1170351594 20:15447600-15447622 CTCCTGGAAAGAAAGCTGGGTGG - Intronic
1171125291 20:22597192-22597214 CTCCTGGAGTTGGGGTTGGGGGG + Intergenic
1172102778 20:32495542-32495564 CTTCTGGGGAGGAAGTTGAGTGG - Intronic
1173083073 20:39888203-39888225 CTCCTGGAGTGGAAAATCAGAGG + Intergenic
1173226227 20:41163855-41163877 CTCCTGGGGAAGAAGCTGGGTGG - Intronic
1174282118 20:49447012-49447034 CCACTGGAGTGGGGGTTGGGCGG + Intronic
1174505316 20:51013998-51014020 CTGCTGGAGGGAAAGCTGGGAGG - Intronic
1175621934 20:60454718-60454740 CTCCAGGAGTGGAAGTAGGTGGG - Intergenic
1175810111 20:61853246-61853268 CTCCCGGAGTGGGACTGGGGTGG + Intronic
1175887346 20:62299856-62299878 CTCCTCGGGTGAAAGGTGGGCGG - Intergenic
1176081512 20:63275732-63275754 CTCCTGCAGTGGATGGTGGTTGG + Intronic
1177222680 21:18215300-18215322 CTCCTGAGGTGGAAGTTTGTAGG - Intronic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1179294259 21:40046754-40046776 CTTCTGGCATGGAAGTTGGGGGG + Intronic
1179562400 21:42223954-42223976 CTCCTGGGGTGGAGGTGGAGAGG + Intronic
1181282614 22:21730661-21730683 CTCCTGTAATGCAAGTAGGGAGG - Intronic
1181810315 22:25400182-25400204 TTCCTGGGTTGGGAGTTGGGGGG - Intronic
1183285410 22:36959541-36959563 TTCCTGGAGTGGAGGATTGGAGG + Intergenic
1184622582 22:45693462-45693484 CTCCTGTGGTGGAAGGTGGAAGG + Intronic
1184783178 22:46659180-46659202 CTGCTGGAGTGGAGGCTGAGAGG - Intronic
1185309502 22:50146233-50146255 CTCTTGGAGTGGGCGTGGGGAGG + Intronic
949692056 3:6651866-6651888 GCCCTGGAGAGGACGTTGGGTGG - Intergenic
950119953 3:10475149-10475171 CTACTGCAGTGGCAGGTGGGAGG - Intronic
950169869 3:10830946-10830968 CTCCGGAGGTGGAAGCTGGGTGG + Intronic
950832689 3:15890853-15890875 CACGTGGAGTGGAAATTGGCTGG - Intergenic
951499334 3:23366610-23366632 CTCCTAGGGTGGAGGGTGGGAGG + Intronic
951626517 3:24670370-24670392 GTCCTTGAGTGAAGGTTGGGGGG - Intergenic
952128579 3:30332750-30332772 GTCCTGGAGTGAGGGTTGGGAGG + Intergenic
953492353 3:43362721-43362743 CTCCAGGAGTCAAAGTTAGGAGG - Intronic
954296784 3:49678802-49678824 ATCCAGGAGTGGAGGTAGGGAGG - Intronic
954680755 3:52344702-52344724 ATCCTGGAGGGGAAGGTGGGAGG - Intronic
955025608 3:55164495-55164517 CTCCTGGAGAGGAACTTGATTGG + Intergenic
955234827 3:57130348-57130370 CACCTGGAGAGGTAGTTGGAGGG - Intronic
956047247 3:65208877-65208899 CACCTGGAGTGGGAGTTTTGAGG - Intergenic
961493423 3:127273549-127273571 CGCCTGGAAGGGCAGTTGGGAGG + Intergenic
961495220 3:127286708-127286730 ATCCTGGAGTGGCAGCTGGGAGG + Intergenic
962872515 3:139509932-139509954 CTCCTGGAAGGGAAGATGGAGGG - Intergenic
963202323 3:142598207-142598229 TTCCTGGTCGGGAAGTTGGGAGG - Intronic
964031172 3:152140638-152140660 CTCTTGGAGTCTAAGGTGGGAGG + Intergenic
967188020 3:186961875-186961897 CTCCTGGGGTGGAGGTAGAGTGG - Intronic
967761025 3:193226498-193226520 ATCCATGAGTGGAAATTGGGTGG + Intergenic
968089714 3:195892569-195892591 CCCCTGGTGTGGGATTTGGGGGG - Intronic
968962724 4:3753504-3753526 CTCCTGGAGTGGCACCTGTGGGG + Intergenic
969581491 4:8068112-8068134 CTCCTCGGGTGGCAATTGGGAGG - Intronic
969597741 4:8158542-8158564 ATCCTGGAGCAAAAGTTGGGTGG + Intronic
977349109 4:95857715-95857737 TTCCTGAAGTGTAAGGTGGGGGG - Intergenic
980984452 4:139682299-139682321 TTCCTGGGGGGTAAGTTGGGTGG + Intronic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
986098568 5:4584519-4584541 TTCCTGGTGGGCAAGTTGGGAGG + Intergenic
986991388 5:13556964-13556986 CTCATGGACTGAAAGTGGGGAGG + Intergenic
988571289 5:32369560-32369582 CTTCTGGAGGCCAAGTTGGGAGG + Intronic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
992371114 5:76145165-76145187 CTCCTAGAGTGGAAGTTAAAGGG + Intronic
992979732 5:82156379-82156401 CTCCTGGATTAGAATTTTGGGGG + Intronic
996472534 5:123877171-123877193 TTCCTGGAGTGGAGGCCGGGAGG - Intergenic
996480128 5:123966675-123966697 ATCCTGAGGTGGAAGATGGGGGG - Intergenic
996944142 5:129046422-129046444 CTCCAGGAGTGGGAGTTTGGAGG + Intergenic
997655013 5:135548066-135548088 GTCCTGGAGTGGGATCTGGGAGG + Intergenic
998164764 5:139836721-139836743 CTCCTGGAGAGGAGGCTGGTGGG + Intronic
998590919 5:143477267-143477289 TTTCTGGAGTAGAAGTTGGGAGG - Intergenic
998793580 5:145793063-145793085 CTCCTGGAGTGGAAATCTGTGGG - Intronic
998885195 5:146686808-146686830 AGCCTGAAATGGAAGTTGGGTGG - Intronic
999359585 5:150971883-150971905 CTCTAGGAGTGGAGGCTGGGAGG - Intergenic
999519650 5:152338148-152338170 CTCCTGGAATGGAAGACAGGGGG + Intergenic
1000141409 5:158407430-158407452 CTTCTGGAGTGGTAGGTTGGTGG - Intergenic
1002787271 6:411989-412011 CTGCTGGACTGGAAGTTAGTAGG - Intergenic
1003489514 6:6609216-6609238 CTCCTGGACAGGAAGGAGGGAGG - Intronic
1003604719 6:7548748-7548770 CTGCTGGAGTGGGAATGGGGAGG + Intronic
1004620373 6:17325978-17326000 CTCTTGGAGGGGAAGTATGGGGG + Intergenic
1013754267 6:113442536-113442558 CTCATGTAGTGGAGGTTGGGAGG - Intergenic
1015880731 6:137867662-137867684 CTCCTGGACTGGGAGTTTGTTGG + Intronic
1017744832 6:157436930-157436952 TGCCTGGAGTGGAAGGTGGTGGG + Intronic
1018276028 6:162132653-162132675 CACCTGAAGTGGAAATGGGGAGG + Intronic
1018633033 6:165836701-165836723 CTCCTGGAGCTGAAAGTGGGGGG + Intronic
1021837485 7:24694583-24694605 CTACTGGAGTGGGGGGTGGGAGG - Intergenic
1022460105 7:30596373-30596395 TTTGTGGAGTGGAAGGTGGGTGG - Intronic
1022906438 7:34862219-34862241 TTGCGGGAGTGGGAGTTGGGGGG + Intronic
1023863863 7:44229621-44229643 CTCCTGGGGTGGAGGTGGGGTGG + Intronic
1027001208 7:74656036-74656058 GTCGTGGAGTAGAATTTGGGGGG - Intergenic
1027231734 7:76276615-76276637 TTCCTGGAGGGGAGGTTCGGAGG + Intronic
1029185923 7:98738458-98738480 CTCCTGGAGTGAAAGTTCTGGGG - Intergenic
1029283820 7:99452924-99452946 CCTGTGGAGTGGAGGTTGGGAGG + Intronic
1029458578 7:100683082-100683104 CTCCTGGAGTTGCAGCTGGAGGG - Exonic
1030307577 7:108034705-108034727 CTATTGGAGTGGGGGTTGGGAGG + Intronic
1030338748 7:108353425-108353447 CTCCAGGAGTCTAAGGTGGGAGG - Intronic
1030344954 7:108422925-108422947 CTCCTGGAGGCTAAGATGGGGGG - Intronic
1031045796 7:116885929-116885951 TCCCTGGAGTGGAGGTTAGGAGG + Intronic
1032371329 7:131356367-131356389 CTCCTGGTGTGCATGTGGGGTGG + Intronic
1033567489 7:142593367-142593389 CTCCTGGATTGGAAGTTATCAGG - Intergenic
1034276161 7:149824708-149824730 GGCCTGGAGTGCAGGTTGGGGGG + Intergenic
1034740368 7:153467836-153467858 ATCCTGGTCTGGAAGTTAGGAGG + Intergenic
1034819572 7:154204322-154204344 CTCCTGGATGGGAAGTGGGGAGG + Intronic
1035969723 8:4234358-4234380 CTGCAGGAGTGGAAGATGTGTGG + Intronic
1036974290 8:13393582-13393604 CTACTGGAGTGGAAGATGGGAGG + Exonic
1037809876 8:22080952-22080974 TTCCTGGTGTTGAAGATGGGAGG + Intronic
1039473665 8:37828332-37828354 GTCCTGGATTGGAAGTTAGGAGG - Intronic
1041329343 8:56707516-56707538 CTCCTGGCGTGTGAGTTGTGGGG - Intergenic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1046888112 8:119391283-119391305 CTTTTGGAGTGGGGGTTGGGGGG + Intergenic
1047288816 8:123511273-123511295 CTCTTGGAGTGGAGGTGGAGTGG - Intronic
1047890431 8:129302920-129302942 CTGCTGCTGTGGAAGATGGGGGG + Intergenic
1048054329 8:130849067-130849089 CTCTGGGAGTGGGAGTGGGGTGG - Intronic
1048773535 8:137920591-137920613 CTCCAGGAGGGGAAGTTGTCAGG + Intergenic
1049189397 8:141278554-141278576 CACCTGCAGTGGAGGTGGGGCGG + Intronic
1054863416 9:69975801-69975823 CTCCTGCTGGGGATGTTGGGAGG - Intergenic
1055936958 9:81612544-81612566 CTCCTGCAGTAGAAATTAGGAGG - Intronic
1056380297 9:86051735-86051757 CTGCGGGGGTGGGAGTTGGGGGG - Intronic
1057388597 9:94625226-94625248 CTCTTGGAATGGCAGTGGGGAGG - Intronic
1058110604 9:101028225-101028247 TTAAAGGAGTGGAAGTTGGGAGG + Intergenic
1059364860 9:113778930-113778952 CTCCTGGAGCGGAGGCTGGCTGG + Intergenic
1059718375 9:116934610-116934632 TTCAGGGAGTGGAAGGTGGGAGG + Intronic
1061398282 9:130355125-130355147 CTCCTGGAGTGGAGGGAGGGTGG + Intronic
1061417404 9:130454561-130454583 CACCTGGATGGGAAGGTGGGTGG - Intronic
1061593789 9:131615595-131615617 TTCCTGGAGTGGAGGTTCTGGGG + Intronic
1061642522 9:131970279-131970301 CGCCCGGAGTGGAAGGAGGGTGG + Intronic
1062242563 9:135548144-135548166 TTCCTGAAGTGGGAGTGGGGTGG + Intronic
1062434826 9:136542269-136542291 CTCCTGCAGAGGACTTTGGGAGG - Intronic
1187033813 X:15516248-15516270 CTGTTGGACTGGACGTTGGGTGG + Intronic
1188525574 X:31084335-31084357 CTACTGGAGGGGAGGGTGGGAGG + Intergenic
1189084041 X:38001424-38001446 GTGCTGGAGGGGAAGTTGGGAGG - Intronic
1189571588 X:42303398-42303420 TTCCTGGAATGCAAGGTGGGTGG + Intergenic
1190267031 X:48832605-48832627 CTCCAGGAGTGGGGGTGGGGAGG - Intronic
1193635707 X:83946823-83946845 TTCCTGGAGTTGAATTTGGCTGG + Intergenic
1195392378 X:104376089-104376111 CTCCTGTAGTGTAAATTGCGTGG - Intergenic
1195684333 X:107571944-107571966 GTCCTGGAGTGGTACGTGGGTGG - Intronic
1199758101 X:150883486-150883508 CTCTGGGGGTGGAATTTGGGAGG - Intronic
1201274716 Y:12286679-12286701 CTCTTGGAGGGGAAGTAAGGGGG + Intergenic