ID: 1161156939

View in Genome Browser
Species Human (GRCh38)
Location 19:2736847-2736869
Sequence GTCCAAACCCCTTGTTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161156933_1161156939 2 Left 1161156933 19:2736822-2736844 CCACCTGTTGGGAATCCCAGGTC 0: 1
1: 0
2: 0
3: 6
4: 174
Right 1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
1161156934_1161156939 -1 Left 1161156934 19:2736825-2736847 CCTGTTGGGAATCCCAGGTCTGG 0: 1
1: 0
2: 2
3: 22
4: 184
Right 1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
1161156931_1161156939 11 Left 1161156931 19:2736813-2736835 CCGACAAGTCCACCTGTTGGGAA 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161156939 Original CRISPR GTCCAAACCCCTTGTTTGGC CGG Intronic
900725408 1:4213321-4213343 GTCCACACCTCATGCTTGGCTGG + Intergenic
902160358 1:14524997-14525019 CTCCAAACCCCATGTGGGGCAGG + Intergenic
912630863 1:111245759-111245781 ATCAAGGCCCCTTGTTTGGCTGG + Intergenic
917429892 1:174955222-174955244 GTCCTCACTCCTTGTTTGGCTGG + Intronic
924866571 1:247988814-247988836 CTCCAAACCCCTTCTTTTGAAGG + Intronic
1062981752 10:1729465-1729487 CTCCAAACCCCAAGTCTGGCTGG - Intronic
1069633899 10:69913850-69913872 CTCCCACCCCCTTGCTTGGCAGG - Intronic
1069813999 10:71181936-71181958 GTGCAGAACCCTTGGTTGGCTGG + Intergenic
1070757058 10:78999827-78999849 GACCAGGCCCCGTGTTTGGCAGG + Intergenic
1076828338 10:132981621-132981643 GTCCAAACCTCTTGTGCTGCTGG - Intergenic
1077144931 11:1040510-1040532 CTCCAAGGCCCTTGTGTGGCTGG + Intergenic
1088238544 11:107750485-107750507 GTCCAAACTCCATGTTCTGCCGG + Intergenic
1089367026 11:117926744-117926766 GTCCAACCCTCTTCTTTGGTGGG + Intronic
1102597215 12:114002027-114002049 ATTCAAACCCCTAGTTTGGGAGG + Intergenic
1106781130 13:33060122-33060144 GTCCAAACCCCGTCTTGGCCCGG - Intronic
1107166888 13:37292850-37292872 TTCCAAAACCCATGTTTGTCAGG + Intergenic
1111638382 13:90934775-90934797 GACCAAACTCCTTGGTTGGTTGG - Intergenic
1111812810 13:93113293-93113315 GTCCAACCCCCTTTTTTTACAGG + Intergenic
1112723522 13:102274661-102274683 GTTTGAACCCCTTGTTTGACAGG - Intronic
1114529489 14:23386817-23386839 GTCCAAACCCTTTTCTTGACAGG - Intronic
1118945439 14:70381938-70381960 GTCAAGACCAGTTGTTTGGCCGG + Intronic
1122456750 14:101859499-101859521 TTCCCTACCCCTTGTTTGTCTGG + Intronic
1123710284 15:22981302-22981324 ATCCAAAGCCCCTGTTTTGCAGG - Intergenic
1128284165 15:66422352-66422374 GTCTAAACCCCTGGTTTAGACGG - Intronic
1130852176 15:87805434-87805456 CCCCAGACCCCTTGTTTGTCTGG - Intergenic
1132122319 15:99187268-99187290 GTCCAACTTCCTTTTTTGGCGGG - Intronic
1132284807 15:100655023-100655045 GTCCAAACCCTTCCTTGGGCAGG + Intergenic
1135620372 16:23950373-23950395 GTCCCAACCCATTGTCAGGCAGG + Intronic
1136589211 16:31207261-31207283 CTCCAGAGCCCTTGTTTGGATGG + Intergenic
1137478510 16:48831340-48831362 GTCCAGACCACTTCTTTGGATGG - Intergenic
1139570016 16:67806061-67806083 GTCCAAACCCAGTGCTGGGCCGG - Intronic
1140093858 16:71858766-71858788 AACAAAACCCCTAGTTTGGCGGG + Intronic
1141078830 16:81033399-81033421 ATCAAAATGCCTTGTTTGGCTGG + Intergenic
1148905029 17:50906624-50906646 TTCCAGACCCCTTGTATTGCTGG + Intergenic
1149583456 17:57767848-57767870 GTCCAAACATTTTGTTTTGCAGG + Intergenic
1153942024 18:9986704-9986726 GTTCAAACCTGTTGTTGGGCGGG + Intergenic
1155569866 18:27181480-27181502 GACCAAACCCCTTATTTAGATGG + Intronic
1155995877 18:32331194-32331216 CTCCAAACCCATTTTTTGTCGGG - Intronic
1156539258 18:37893595-37893617 GTGCAAATCCCTTGTTTCTCTGG + Intergenic
1157536959 18:48466735-48466757 CTCCAAACTCCTTGGTTTGCAGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159247990 18:65835086-65835108 GTCCAGGCCCCTTGTTTTCCAGG - Intronic
1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG + Intronic
929682687 2:44007391-44007413 TTCCAAGCCCCTTGGTCGGCAGG - Intergenic
929712050 2:44275589-44275611 GGACAAACCCGTTGTTTGTCTGG - Exonic
931401973 2:61939780-61939802 GAACAAACACCTTGTTTGGAAGG - Intronic
933307795 2:80623624-80623646 CCCCAAACCCCTTGCTTAGCTGG - Intronic
937015148 2:118598362-118598384 ATCCAAGTCCCTTGTTTGGTTGG - Intergenic
939141189 2:138356581-138356603 GGTTAAACCCCTTGTTTGTCTGG - Intergenic
946121131 2:217515832-217515854 GTCTAACCCCCTTGGCTGGCAGG + Intronic
1172097551 20:32467734-32467756 GTGCCAACCCCTTGCTGGGCTGG - Intronic
1176517352 21:7796078-7796100 GTCCAAATCCCTTGTCTGTGTGG - Intergenic
1178651380 21:34426090-34426112 GTCCAAATCCCTTGTCTGTGTGG - Intergenic
1181673760 22:24438758-24438780 GTCCAATCCTCTTGTTTTACAGG - Intronic
1181805574 22:25372669-25372691 GTCCAAACCCCTGGTGTCACTGG + Intronic
1183467122 22:37985375-37985397 GTCCCCACCCCTTGTTGGGGTGG - Intronic
952154871 3:30631783-30631805 GTCCAACCCATTTGTTTGACTGG + Intronic
958862890 3:99466541-99466563 CTCCAAACCCCTAGTTTAGGGGG + Intergenic
962481096 3:135799479-135799501 GTCTAAACCCCTCCTTGGGCAGG + Intergenic
967105564 3:186252409-186252431 GTCCCCACCCCTTTTCTGGCCGG + Intronic
969595665 4:8148128-8148150 CTCCAAACCCCTTCTCTGCCGGG - Intronic
971386721 4:26147411-26147433 CTGCAAACTCCTTGTTTTGCGGG - Intergenic
972430549 4:38977300-38977322 AGCCAAACCGCTGGTTTGGCTGG + Intronic
978582750 4:110248449-110248471 GTCAAAACCCCTAGATAGGCCGG - Intergenic
980606328 4:135095081-135095103 GTCCAAACCCTTTGTGTTTCTGG + Intergenic
981103375 4:140854952-140854974 GTTCAAACCCCTTTTATGGGAGG + Intergenic
990363363 5:55044029-55044051 GTCCAAATCACTTATGTGGCAGG - Intergenic
992228621 5:74641838-74641860 GTCCAGCCCCCTTGTTTTACAGG + Intronic
995844671 5:116480994-116481016 GTCCAGACACCTGGTTTGCCTGG + Intronic
996922461 5:128784639-128784661 GTCCCCACCCTTTGTTTGGATGG - Intronic
999529136 5:152442928-152442950 TTCCTAGCCCCTTGTTTGCCAGG + Intergenic
1000187488 5:158873727-158873749 GGCCAAAGTCCTTGTTTGGTGGG - Intronic
1004975031 6:20955734-20955756 TTCAAATCCCCTTCTTTGGCAGG + Intronic
1007240600 6:40422333-40422355 GTCCAAACCCCTGATTTCACTGG + Intronic
1009458080 6:63879873-63879895 GACCACACCCCTGGTTTAGCTGG - Intronic
1009477356 6:64110016-64110038 TTGCAAACACATTGTTTGGCTGG + Intronic
1010951097 6:82038117-82038139 ATCTAAACCCCTTGCTTTGCTGG + Intergenic
1017043107 6:150323567-150323589 GTCCAAATCACTTGTGAGGCAGG - Intergenic
1018891855 6:167988366-167988388 GTCCAAACCCAAGGTGTGGCCGG - Intergenic
1022488216 7:30796607-30796629 ATCCAAACCCTTTATTTGGCAGG + Intronic
1022951074 7:35338530-35338552 GTCCAAGTCCCTTGTTTAACAGG - Intergenic
1025786848 7:64651669-64651691 CTCCAATCCCCTTTTTTGTCAGG - Intergenic
1025924778 7:65948728-65948750 GTCCAAAGACACTGTTTGGCTGG - Intronic
1025932136 7:66004085-66004107 GTCCAAAGACACTGTTTGGCTGG - Intergenic
1027390428 7:77697492-77697514 CTCCACACCCCTTTTTTGACAGG - Intronic
1030515886 7:110537256-110537278 CTCCAAACCCCTTGTTTCTCTGG + Intergenic
1032099644 7:128963272-128963294 CTCCAAACCCCATCTTTGGAGGG + Intronic
1034310152 7:150080201-150080223 ATCCAAACCTCTTGTTGTGCAGG - Intergenic
1034480012 7:151312514-151312536 GTCCAATCCCCTTGTGTAGGTGG + Intergenic
1034796693 7:154020419-154020441 ATCCAAACCTCTTGTTGTGCAGG + Intronic
1036380477 8:8233198-8233220 CTCCAAACCCTTTGGTGGGCAGG - Intergenic
1036849090 8:12189462-12189484 CTCCAAACCCTTTGGTGGGCAGG + Intronic
1036870451 8:12431736-12431758 CTCCAAACCCTTTGGTGGGCAGG + Intronic
1043688805 8:83124471-83124493 GCCCAAACCTGTTGTTTGACTGG - Intergenic
1045302265 8:100922073-100922095 TACAAAACCCCTTGTTTGACAGG - Intronic
1050051139 9:1602832-1602854 GCCCCAACCCATTGTTTGGCTGG + Intergenic
1050701445 9:8344104-8344126 TTTCAAACTCCATGTTTGGCAGG + Intronic
1055718809 9:79148620-79148642 CTCCAAATCCCATGTTTGGAGGG + Intergenic
1057770342 9:97961842-97961864 GTCCCAAGTCCTTGTATGGCAGG - Intergenic
1059637630 9:116186410-116186432 CTCCAAACCCTTTGTTTGACAGG - Intronic
1060086979 9:120712745-120712767 GTCCAAATCCTTTGTCTAGCTGG - Intronic
1060733804 9:126053671-126053693 GACCAAGCCCAGTGTTTGGCTGG + Intergenic
1194959255 X:100216081-100216103 TTCCAAACTCCTTTGTTGGCTGG + Intergenic