ID: 1161160451

View in Genome Browser
Species Human (GRCh38)
Location 19:2758749-2758771
Sequence ATGTGTGGATCAGCACAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161160448_1161160451 -5 Left 1161160448 19:2758731-2758753 CCAAATGTCCATGGATAGATGTG 0: 1
1: 0
2: 1
3: 43
4: 400
Right 1161160451 19:2758749-2758771 ATGTGTGGATCAGCACAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1161160447_1161160451 -4 Left 1161160447 19:2758730-2758752 CCCAAATGTCCATGGATAGATGT 0: 1
1: 1
2: 41
3: 310
4: 1716
Right 1161160451 19:2758749-2758771 ATGTGTGGATCAGCACAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1161160445_1161160451 26 Left 1161160445 19:2758700-2758722 CCGTTCACAACAGACAAAAGGTA 0: 1
1: 1
2: 5
3: 55
4: 362
Right 1161160451 19:2758749-2758771 ATGTGTGGATCAGCACAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161160451 Original CRISPR ATGTGTGGATCAGCACAGCG TGG Intronic
900367968 1:2319053-2319075 ATGTGGGGATCTGCACCTCGGGG - Intergenic
900752674 1:4408633-4408655 ACCTGTAGATCAGCACAGCCTGG + Intergenic
901477200 1:9498000-9498022 GCGTGTGGATCAGAACAGCCTGG - Intergenic
903373466 1:22851514-22851536 ATGTGGGCATCAGCATAGCTGGG + Intronic
904212368 1:28894515-28894537 ATGTATCAATCAGCACAGAGAGG + Intronic
906236714 1:44215796-44215818 CTGTGTAGCTCAGCACAGCACGG + Intronic
912570060 1:110614866-110614888 ATGTGGGGATCAGCAAAGTCTGG - Intronic
919356226 1:196526051-196526073 GTGTGTGAATCAGCACACTGAGG + Intronic
920701158 1:208218973-208218995 ATGTGGGGAGCAGCAAAGGGTGG + Intronic
923460559 1:234206219-234206241 ATGAGTGGAGCAGCAGAGCTGGG + Intronic
1063909027 10:10811040-10811062 ATGTCTGTAGGAGCACAGCGAGG - Intergenic
1065658836 10:27983354-27983376 CTGTGGGGACCAGCACAGCCTGG + Intronic
1066779624 10:38929825-38929847 ATCTGTGAATGAGCATAGCGTGG - Intergenic
1067849496 10:49745732-49745754 ATGGCTGGCTCAGCACAGCAGGG + Intronic
1071302837 10:84269733-84269755 ATGTTTGGATCTGCAGGGCGTGG - Intergenic
1076472546 10:130729011-130729033 TTGTGTGGATTGGCACAGTGTGG + Intergenic
1079081443 11:17415971-17415993 ATATGTGGATGAGAACAGAGTGG - Intronic
1085196232 11:74673482-74673504 AGATGTGAATCAGCACAGCGTGG - Intergenic
1090877532 11:130804431-130804453 ATGTGTGGATCACCTCGGCAGGG + Intergenic
1091091363 11:132774252-132774274 GTGTGTGGATGAGAACAGCAGGG - Intronic
1098159939 12:67640324-67640346 AGGTGTCGAGGAGCACAGCGAGG - Intergenic
1106452746 13:29897892-29897914 ATGTGAGGAGCAGCAGAACGGGG + Intergenic
1110363192 13:74651471-74651493 ATGTGTGCCTTAGCACAGGGAGG + Intergenic
1111132226 13:83992131-83992153 ATGTCTGGACCAGCTCAGCTTGG - Intergenic
1116949796 14:50868909-50868931 ATGAGTGGATAAGCACAATGTGG + Intronic
1118709122 14:68505436-68505458 CTGTGTGGATCTGGACAGAGCGG - Intronic
1120830719 14:88995387-88995409 AAGTGGGGATCAGCACAAGGTGG - Intergenic
1124554252 15:30710499-30710521 ATCTTTGGATGAGCACAGGGTGG - Intronic
1124676992 15:31695170-31695192 ATCTTTGGATGAGCACAGGGTGG + Intronic
1128410214 15:67389378-67389400 CTGTGTGGATCAGCAAAGAGAGG - Intronic
1129751149 15:78065402-78065424 ATCTGTGGCTCAGCCCAGCTGGG - Intronic
1130023560 15:80251623-80251645 AGGTGAGGCTCAGAACAGCGAGG + Intergenic
1134197539 16:12170499-12170521 ATGCGTGTATCAGAACAGAGAGG + Intronic
1141749213 16:85946975-85946997 AGGTGTGGACCAGCACAGGGAGG - Intergenic
1142040400 16:87889997-87890019 AAATGTGGATGAGCACACCGTGG - Intronic
1144848079 17:18230407-18230429 ATGTGTGCATCAGCTCACCAGGG - Intronic
1148216734 17:45837457-45837479 AAGTGTGGATAAGCCCAGCCAGG + Intergenic
1152167995 17:78723399-78723421 ATGTGTGCGCCAGCACAGCAGGG + Intronic
1152346625 17:79756498-79756520 ATGTGTCGACCAGCCCAGGGTGG + Intergenic
1157808047 18:50672894-50672916 ATGAGGGAAGCAGCACAGCGTGG - Intronic
1157995186 18:52546401-52546423 ATGTAGGGAGCAGCACAGCCTGG + Intronic
1160688790 19:450710-450732 ATGAGTGGATCAACACAGTGTGG - Intronic
1160688892 19:451408-451430 ATGAGTGGATCAACACAGCATGG - Intronic
1160877436 19:1303359-1303381 ATGATTGGATAAACACAGCGTGG - Intergenic
1161041351 19:2112244-2112266 ATGAGTGGGTCAGCACAGTGTGG + Intronic
1161148920 19:2696576-2696598 ATGGATGGATGAGCACAGCCCGG + Intronic
1161160451 19:2758749-2758771 ATGTGTGGATCAGCACAGCGTGG + Intronic
1161222631 19:3124782-3124804 ATAGATGGATCAACACAGCGTGG - Intergenic
1161275024 19:3411157-3411179 AGGTGTGCATCACCACAGCCAGG + Intronic
1164914863 19:32044381-32044403 ATGCGTGGGTGAGCACAGCAAGG - Intergenic
926425238 2:12733911-12733933 ATCTGTGGAACAGCACAGGTCGG - Intronic
927475899 2:23414022-23414044 ATCTGGGGAACAGCACAGCTAGG - Intronic
932403212 2:71496320-71496342 CTGTGTGGCCCTGCACAGCGTGG - Intronic
932455808 2:71849256-71849278 ATGTGTGGCTCAGCTCAGGCTGG - Intergenic
932735049 2:74248502-74248524 ATGTGTGGTTCAGCATAGGAAGG + Intronic
937774321 2:125757760-125757782 AGGTGTGGATCACCACACCCTGG + Intergenic
939887301 2:147694895-147694917 AAGTGTGTATCTGCACAGCCTGG + Intergenic
943008453 2:182416358-182416380 ATGTGTGGATTATCACACCCAGG - Intronic
948763135 2:240204814-240204836 AAGTGTGGATGAGGACAGGGAGG - Intergenic
1178128092 21:29537718-29537740 ATGTTTGGATCATCTCAGTGGGG - Intronic
1181031980 22:20152699-20152721 ATGGGTGGACAAGCCCAGCGAGG + Intergenic
1182333631 22:29568926-29568948 CTGGGTGGGACAGCACAGCGAGG + Intronic
1183333661 22:37234667-37234689 TTGTGTGGACCAGCACAGGGAGG - Intronic
1183626592 22:39006800-39006822 ACGTGTGTAACAGCACAGAGCGG - Intergenic
950441350 3:13012530-13012552 ATGTGTTGCTCACCACAGCCTGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
957435672 3:80172543-80172565 AGGCTTGGATCAGCCCAGCGTGG + Intergenic
957941748 3:87014706-87014728 AAGTTTGGATCTGCACAGAGAGG - Intergenic
960215512 3:115031185-115031207 CTGTGTGGACTAGCACAGCTAGG - Intronic
961367012 3:126406529-126406551 CTGTGGGTATCAGCACAGCAAGG + Intronic
962628156 3:137248259-137248281 ATAGGTGGACCAGCACAGTGAGG - Intergenic
964489520 3:157220430-157220452 AGGTGTGAATCAGTACAGTGAGG + Intergenic
966078039 3:175963028-175963050 ATGTGAGGAGCAGCACAGGATGG + Intergenic
966776580 3:183547977-183547999 ATGTGTGTATGAGCACAAGGAGG - Intronic
967318961 3:188177188-188177210 ATGGGTGGGCCAGCCCAGCGAGG + Intronic
968249384 3:197192724-197192746 ATGTGTGTATAAGAACAGAGGGG + Intronic
968484158 4:850679-850701 ACGTGGGGAGCAGCACAGCCTGG + Intronic
969052069 4:4380149-4380171 ATTGGTGGATCAGAACAGCGAGG + Intronic
970213765 4:13737605-13737627 ATGGATGGAACAGGACAGCGTGG + Intergenic
971526400 4:27624002-27624024 ATGTGAAGATAAGCACACCGAGG + Intergenic
973296492 4:48528294-48528316 ATATGGTGATCAGCACAGTGCGG - Exonic
975636068 4:76449991-76450013 ATGTGTGTGTGAGCACAGGGAGG + Intronic
975733086 4:77356512-77356534 ATGTGTGGATATGCTCAGTGTGG + Intronic
986302306 5:6487444-6487466 ATGTGTGGCTCAGGAAAGAGAGG + Intronic
988789922 5:34598243-34598265 ACATGTGGATCAGCTCAGCCTGG - Intergenic
991636703 5:68713201-68713223 TTGTGTGTATCATCACAGGGAGG - Intergenic
992766294 5:80003931-80003953 AAGTGTAGCTGAGCACAGCGAGG + Intronic
993755979 5:91730419-91730441 GTGTGTGGATCACCTCAGGGTGG + Intergenic
1001449655 5:171814775-171814797 ATGTGTGGAAAAGCAGAGCAGGG - Intergenic
1003243217 6:4362292-4362314 ATGTGTGGATCAACAAAATGTGG - Intergenic
1004254705 6:14052306-14052328 CTGTGCGGCTCAGCACTGCGTGG - Intergenic
1005093772 6:22088053-22088075 ATTTGTGCATCAACACAGCAAGG - Intergenic
1006602714 6:35236570-35236592 ATGTGTGGAACAGCCCAACCTGG - Intronic
1006912974 6:37576057-37576079 GTGTGGGGATCAGAAAAGCGGGG + Intergenic
1013637323 6:112041567-112041589 ATGTGTGGATTGGCACTGCATGG - Intergenic
1013989042 6:116231658-116231680 ATGAGAGGATCTGCACAGCCTGG - Intronic
1019357842 7:590252-590274 ATGTGCACATCAGCACAGCACGG + Intronic
1020132869 7:5569578-5569600 ATGTGTGGCAGTGCACAGCGTGG + Intergenic
1023491876 7:40751659-40751681 ATGTGTGGAAGACCACAGCATGG - Intronic
1029181280 7:98703808-98703830 ATGAGTGGATAAACACAACGCGG - Intergenic
1029888611 7:103902016-103902038 ATGTTTGCAACAGCACAGTGTGG + Intronic
1036157303 8:6354678-6354700 TTGTGTGGAACAGAACAGAGGGG + Intergenic
1037745164 8:21637572-21637594 ATGTATGGAGCAGATCAGCGAGG + Intergenic
1039991056 8:42488107-42488129 ATGAATGGATAAGCACAGTGTGG - Intronic
1041409639 8:57539341-57539363 ATGTGTAGATCAGGACACCCAGG + Intergenic
1043413630 8:80026988-80027010 ATGTGTGTGTCAGCACAGGAGGG - Intronic
1044920010 8:97159503-97159525 ATGAATGGATAAGCACAACGTGG - Intergenic
1045473014 8:102529097-102529119 ATGTTCAGAGCAGCACAGCGTGG - Intronic
1048047948 8:130791034-130791056 CTGTGTGGTTCAGCACAGCTGGG + Intronic
1052189999 9:25649115-25649137 ATTTGTGCATCAGCACATAGAGG - Intergenic
1053284595 9:36842079-36842101 CTGTCTGGAACAGCACAGCAAGG - Intronic
1053514814 9:38721850-38721872 ATGGGTGGAGGAGCAGAGCGGGG + Intergenic
1061907503 9:133706223-133706245 ATGAGTGGATCAACAAAGCATGG + Intronic
1185472847 X:395078-395100 ATGGGTGGATTAGCACAATGTGG - Intergenic
1189192489 X:39122556-39122578 ATGTTTGGCCCAGCACAGTGTGG + Intergenic
1190850721 X:54238352-54238374 ATGAGTGGATCATTTCAGCGGGG - Exonic
1194856070 X:98931339-98931361 ATGAGTGGATAAGCAAAACGTGG + Intergenic