ID: 1161162482

View in Genome Browser
Species Human (GRCh38)
Location 19:2768915-2768937
Sequence CGACTGTGCTGGCCGCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161162474_1161162482 30 Left 1161162474 19:2768862-2768884 CCAAAAAGCCAGGCGGGGGACCA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 131
1161162480_1161162482 -5 Left 1161162480 19:2768897-2768919 CCAGGTGTCTACACGAGGCGACT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 131
1161162478_1161162482 10 Left 1161162478 19:2768882-2768904 CCAGGCATCTACACACCAGGTGT 0: 1
1: 0
2: 2
3: 32
4: 267
Right 1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 131
1161162476_1161162482 22 Left 1161162476 19:2768870-2768892 CCAGGCGGGGGACCAGGCATCTA 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161162482 Original CRISPR CGACTGTGCTGGCCGCTGCC CGG Intronic
900127359 1:1074447-1074469 CGGCTGTGCTGACCCCTACCCGG - Intergenic
900185368 1:1330853-1330875 AGGCTGTGCTGGCCGGAGCCGGG - Intergenic
900699080 1:4032821-4032843 CGACTGTGCTGTTCACTGCAGGG + Intergenic
901530453 1:9849453-9849475 CTACTGTGCTGGCAGCAGACAGG + Exonic
901530513 1:9849716-9849738 CGCCTCTGCTGGGCGCGGCCTGG + Exonic
902870595 1:19311727-19311749 CGTCGGTGCTGCCCGCGGCCGGG + Intronic
907541032 1:55215431-55215453 CGACCGTGCTCGCCGTTGGCAGG + Intergenic
908169792 1:61493313-61493335 CCACTGTCCCGGTCGCTGCCAGG + Intergenic
912680680 1:111727053-111727075 CGCCTGTGCTCCCCGGTGCCTGG + Exonic
916503780 1:165409284-165409306 CAACTGTGCTGGCCTCTGAGTGG + Intronic
920066536 1:203273489-203273511 CGCCTCTGCCGGCCGCTGCCGGG - Intronic
921222219 1:212981286-212981308 CACCGGTGCTGGCAGCTGCCAGG - Intronic
923451294 1:234120003-234120025 CCACTGTGCTGGCAGGTGCATGG + Intronic
923762906 1:236863364-236863386 TTTCTGTGCTGGCCCCTGCCTGG + Intronic
924810553 1:247397580-247397602 CGACTGTGGTGGCTTATGCCTGG - Intergenic
1063187073 10:3661006-3661028 CGCCTGTGGTTGCAGCTGCCTGG + Intergenic
1063424858 10:5942840-5942862 GCACTGTGCTGGCCGCTTCCTGG - Intronic
1063973553 10:11397778-11397800 CCTCTGTGCTGGCTGCTGGCAGG - Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1073440304 10:103548758-103548780 CACCTGTGACGGCCGCTGCCTGG - Intronic
1073577859 10:104640630-104640652 GGACTCTGCTCGCCGCTCCCTGG - Intergenic
1076238101 10:128881471-128881493 CAACTGCACTGGCCCCTGCCTGG - Intergenic
1076836395 10:133023239-133023261 CGCAGGTGCTGGCCGGTGCCTGG - Intergenic
1077516132 11:3003111-3003133 AGACTGTCCTCGCCCCTGCCCGG - Intronic
1081861013 11:46333311-46333333 GGACTGGGCTGGCGGCGGCCGGG + Intronic
1083220589 11:61249693-61249715 CGCCTGTGCTGAGGGCTGCCAGG + Exonic
1083811373 11:65108619-65108641 GGGCCCTGCTGGCCGCTGCCGGG + Exonic
1084789033 11:71461940-71461962 CGCTTGTGGTGGCCGCAGCCAGG + Intronic
1087912847 11:103773725-103773747 CGAGCGTGGTGGCCGGTGCCTGG - Intergenic
1097227669 12:57488128-57488150 TGCCGGTGCTGGCCGCCGCCGGG + Exonic
1097342389 12:58454078-58454100 CTGTTGTGCTGGCAGCTGCCTGG + Intergenic
1101302223 12:103494878-103494900 CAACTGTGCTGCCCCCTCCCGGG - Intronic
1103998504 12:124845202-124845224 CGTCTGGGCTGGTGGCTGCCGGG - Intronic
1104639368 12:130457629-130457651 CCACTGTGCTGACCGCCCCCCGG + Intronic
1108601243 13:51997008-51997030 CCACAGTGCTGGCCTCTGGCAGG - Intronic
1113896739 13:113769293-113769315 GGACTGTGCAGGCCACAGCCCGG - Intronic
1118770589 14:68940195-68940217 GGAATGTGCTGGCCACTGCTGGG - Intronic
1119725390 14:76919125-76919147 CGCCTGTGCTGGCCAGTTCCAGG - Intergenic
1124618023 15:31256567-31256589 GGGCTGTGCTGGTGGCTGCCAGG + Intergenic
1127842627 15:62844160-62844182 CCACAGTGCTGGCCTCTGCTGGG + Exonic
1129523487 15:76200069-76200091 CGACTGTGCTCCCCGCAGACAGG + Intronic
1130366398 15:83243722-83243744 GGACTCTGCTGGCCGCTGACAGG - Intergenic
1132718453 16:1303957-1303979 CAACTGTGCTGGCCACGACCAGG + Intergenic
1132729751 16:1355636-1355658 GGACTCTGCTGGGCGCTGGCAGG - Intronic
1133307731 16:4821411-4821433 CGGCTGTGCTGTCAGCTGCCTGG + Exonic
1139596019 16:67958765-67958787 AGAATGTGCTGGACTCTGCCTGG + Intronic
1142122003 16:88391107-88391129 CCACTGTGCCAGCTGCTGCCCGG + Intergenic
1142811061 17:2395715-2395737 CGCCTGTCCTGCCCGCAGCCCGG - Intronic
1144381547 17:14703498-14703520 CGAGTGTGGTGGCCCATGCCTGG - Intergenic
1147914802 17:43879883-43879905 CGTCCGTGCTGGGCGCTACCTGG - Exonic
1147927195 17:43953283-43953305 CGCCTGCGCTCACCGCTGCCGGG + Exonic
1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG + Intronic
1152514469 17:80815199-80815221 CTTCTGTCCTGGCCTCTGCCAGG - Intronic
1152771433 17:82172064-82172086 AGACTGTGCTGGTCTCTGGCTGG - Intronic
1156460905 18:37320804-37320826 AGAATGTGCAGGCCCCTGCCAGG - Intronic
1158082122 18:53605186-53605208 CCACTGTGCTGCCCTCTGCATGG - Intergenic
1158958601 18:62567511-62567533 CCTCTGTGCTGGCTCCTGCCAGG + Intronic
1158964545 18:62611490-62611512 CCACTGGGCCTGCCGCTGCCAGG + Intergenic
1160342104 18:78098048-78098070 GGACTGTGCTGGCCTCAGCATGG + Intergenic
1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG + Intronic
1165227423 19:34364986-34365008 CCGCTTTGCTGGCCTCTGCCCGG - Exonic
1166843483 19:45712654-45712676 CCACTGGGCAGGCCGCTGTCTGG + Exonic
1166960778 19:46494770-46494792 CCACGCTGCAGGCCGCTGCCAGG - Exonic
925011065 2:486668-486690 CGACTGTGCTGGGCACTGACAGG + Intergenic
926122805 2:10254067-10254089 CGAGTGTGGTGGCTGCTCCCTGG + Intergenic
927938501 2:27088927-27088949 CGACAGTGCTGATGGCTGCCAGG + Intronic
928024469 2:27728563-27728585 CCCCTGTACTGGCCTCTGCCTGG + Intergenic
932493010 2:72133398-72133420 CATCTGTGCTGGGCCCTGCCTGG + Intronic
932773582 2:74514607-74514629 CGCCCGTGCCAGCCGCTGCCGGG - Exonic
935701229 2:105813667-105813689 CGAGTGTGCTGAGCACTGCCAGG - Intronic
944961678 2:204882006-204882028 CGACTGTGCTGCCTGACGCCAGG - Intronic
946759722 2:222981555-222981577 AGATTGTGCTGGACTCTGCCTGG + Intergenic
948348486 2:237319223-237319245 CAGCTGTGCTGGCTGCTTCCAGG + Intergenic
948793813 2:240392166-240392188 AGACTGTGCTGGCCTCGCCCTGG - Intergenic
1170642549 20:18167206-18167228 GGAATCTGCTGGCTGCTGCCTGG + Intronic
1173928669 20:46800022-46800044 CCCCTTTGCTGGCCCCTGCCAGG + Intergenic
1174332321 20:49830183-49830205 CGGCCGTGCTGTCAGCTGCCCGG - Intronic
1174370401 20:50083204-50083226 CTGCTGGGCTGGCGGCTGCCGGG + Intronic
1174576845 20:51542839-51542861 GGCCTGGGCTGGCCGGTGCCGGG + Intronic
1175939003 20:62529269-62529291 CCAGGGTGCTGGCAGCTGCCAGG + Intergenic
1176046734 20:63096818-63096840 CTGCTGTGCTGGCCTCTGCCAGG + Intergenic
1176180432 20:63747172-63747194 CGACTGTGCTGGCCGCGGCATGG - Exonic
1176672603 21:9748603-9748625 GGACTGTGGAGGCCTCTGCCAGG + Intergenic
1178909664 21:36664340-36664362 TGGCAGTGCTGGCCTCTGCCTGG - Intergenic
1179131124 21:38638288-38638310 CGACTGTGCTGGGCTTTACCTGG - Intronic
1179229610 21:39489506-39489528 CCACTGTGTTGACCCCTGCCAGG - Intronic
1179624827 21:42642981-42643003 CGACTGTGCAGGCCGCAGGTTGG + Intergenic
1180650354 22:17370771-17370793 CCGCTGGGCTGGCCGATGCCTGG - Intronic
1180921115 22:19522212-19522234 AGTCAGTGCTGGCCCCTGCCAGG - Intergenic
1181281888 22:21726428-21726450 GGACTGTGGTGGCCGCTAGCGGG - Intronic
1181583319 22:23839568-23839590 CAAATGTGCCGGCCGCTGTCGGG + Intergenic
1184604386 22:45563751-45563773 CGGGTCTGCTGGCCCCTGCCTGG + Intronic
1184711226 22:46250523-46250545 CCGCTGTCCTGGCCGCTGCGAGG + Exonic
954457194 3:50606219-50606241 TGACTGCCCTGGCCACTGCCAGG - Intergenic
961016728 3:123474108-123474130 CCACTGTGCTGGCTGCTGGCAGG + Intergenic
966878520 3:184336819-184336841 CCACAGTGCTGACCCCTGCCTGG + Intronic
966920728 3:184609932-184609954 GGCCTGTGCTGGCTGCTGCTAGG + Intronic
966943154 3:184759698-184759720 CGTCTGTGCTGGCTGCTGAGGGG - Intergenic
967892488 3:194372960-194372982 CGGCTGTTCTGGGGGCTGCCTGG - Intergenic
969105552 4:4804762-4804784 CAGCTGTGCTGGGCACTGCCTGG + Intergenic
972660617 4:41112453-41112475 AGAGTGTGCAGGGCGCTGCCAGG - Intronic
974771777 4:66423735-66423757 AGCCTGTGGTGGCTGCTGCCTGG - Intergenic
982270802 4:153585238-153585260 GAGCTGTGCTGGCCGCAGCCTGG + Intronic
995146123 5:108788240-108788262 CGCCTGTGCTGGTGCCTGCCTGG + Intronic
996862746 5:128084025-128084047 CCGCTGCGCTGGCCGCAGCCAGG + Exonic
998576887 5:143326214-143326236 CTACTCTGCAGGCCCCTGCCAGG - Intronic
1000053050 5:157578490-157578512 CTATGGTGCTGGCCACTGCCTGG - Intergenic
1002281148 5:178130841-178130863 CGGCTTTTCTGGCCGCCGCCCGG + Intergenic
1003780061 6:9414991-9415013 CGATTATGCTGGCAGCTTCCCGG - Intergenic
1009882542 6:69586308-69586330 CGACTGGACTGGCAGGTGCCAGG + Intergenic
1016282906 6:142439541-142439563 CCACTGGGGTGGCCACTGCCTGG + Intronic
1019116132 6:169764086-169764108 CGGCTGTGCTGGCCACTGAGTGG - Intronic
1019288110 7:233817-233839 CGACTGAGCTGACCTCTCCCAGG - Intronic
1019365457 7:630376-630398 CGCCTGTGCTGGCAGGTGGCAGG + Intronic
1019501000 7:1364728-1364750 CGGCGGTGCTGGACTCTGCCAGG - Intergenic
1020274343 7:6615619-6615641 CGTCCGTGCGGGCCGCTGGCCGG - Exonic
1021984747 7:26087556-26087578 GGAGTGTGCTAGGCGCTGCCAGG + Intergenic
1023021061 7:36012023-36012045 CGAGGGTGCTGGGGGCTGCCTGG + Intergenic
1024507920 7:50178646-50178668 CATCTGAGCTGGCCTCTGCCTGG + Intergenic
1024974901 7:55104358-55104380 CTACTGTGCTGGATGATGCCTGG + Intronic
1027642859 7:80758395-80758417 AGCCTGTGCTGACTGCTGCCTGG - Exonic
1029117273 7:98243736-98243758 GGACTGTGGGGGCCCCTGCCCGG + Intronic
1034425036 7:151009723-151009745 TGGCTGTGCTGCCCACTGCCGGG + Intronic
1035202499 7:157276432-157276454 AGACTGTGGTGCCCGCGGCCAGG + Intergenic
1035270591 7:157717646-157717668 AGGCTGGGTTGGCCGCTGCCTGG - Intronic
1035363285 7:158328483-158328505 AGGCTGTGCTGGCCGCTCCCAGG - Intronic
1036752945 8:11454808-11454830 GGACTGGGCTGGCCTCTGGCTGG + Intronic
1040801842 8:51350671-51350693 CGGGTGTCATGGCCGCTGCCAGG - Intronic
1049603595 8:143519142-143519164 CGAGTGTGCTGACGGCTGACTGG + Intronic
1049798280 8:144506314-144506336 CGGCTGTGCCCGCCGGTGCCAGG + Exonic
1056693627 9:88828165-88828187 AGACTGTGCCGGCCACTGGCAGG - Intergenic
1057726352 9:97571248-97571270 TCACTGTGGTGGCAGCTGCCAGG + Intronic
1060111780 9:120911647-120911669 TGAATGTGCTGCCCCCTGCCTGG + Intronic
1060187402 9:121572109-121572131 CTCTTATGCTGGCCGCTGCCAGG - Intronic
1061622807 9:131822947-131822969 TGACTGAGGTGGCCGCTGCCTGG - Intergenic
1062080522 9:134621132-134621154 CGACTGGGCTGGCCCCTTCCAGG + Intergenic
1062566107 9:137164658-137164680 CGCCAGTGCTGGCAGCGGCCAGG - Intronic
1191791550 X:64976874-64976896 TGAATGTGCTAGCTGCTGCCTGG + Intronic
1192156087 X:68747709-68747731 TCTCTGTGCTGGCCTCTGCCAGG - Intergenic
1202281994 Y:23199183-23199205 CGTGTGTGCTGGCCAGTGCCTGG + Intergenic
1202283897 Y:23219336-23219358 CGTGTGTGCTGGCCAGTGCCTGG - Intergenic
1202433666 Y:24813568-24813590 CGTGTGTGCTGGCCAGTGCCTGG + Intergenic
1202435573 Y:24833722-24833744 CGTGTGTGCTGGCCAGTGCCTGG - Intergenic