ID: 1161163335

View in Genome Browser
Species Human (GRCh38)
Location 19:2772657-2772679
Sequence TCTAGGGACCCGCCGTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161163335_1161163338 4 Left 1161163335 19:2772657-2772679 CCAGTGTACGGCGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1161163338 19:2772684-2772706 TAACCAATGTCCTTATAAAAAGG 0: 1
1: 1
2: 26
3: 181
4: 830
1161163335_1161163339 5 Left 1161163335 19:2772657-2772679 CCAGTGTACGGCGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1161163339 19:2772685-2772707 AACCAATGTCCTTATAAAAAGGG 0: 1
1: 1
2: 32
3: 157
4: 834
1161163335_1161163340 6 Left 1161163335 19:2772657-2772679 CCAGTGTACGGCGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1161163340 19:2772686-2772708 ACCAATGTCCTTATAAAAAGGGG 0: 1
1: 21
2: 144
3: 563
4: 1618
1161163335_1161163343 14 Left 1161163335 19:2772657-2772679 CCAGTGTACGGCGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1161163343 19:2772694-2772716 CCTTATAAAAAGGGGACATTTGG 0: 8
1: 94
2: 370
3: 792
4: 1431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161163335 Original CRISPR TCTAGGGACCCGCCGTACAC TGG (reversed) Intronic
900119468 1:1042312-1042334 TCCAGGTACCCTCCGCACACAGG - Intronic
900173679 1:1282499-1282521 TCTAGGGTCCCACAGTAGACAGG + Intronic
914927195 1:151898543-151898565 TCTAGGGCCCCGCCCACCACCGG + Intronic
919299656 1:195744081-195744103 GCTAGGGACCCACTGAACACAGG + Intergenic
919761400 1:201100360-201100382 TCTATGGCCACGCCGCACACTGG + Intronic
1065634726 10:27719505-27719527 TCTAGGAACCCCCCTTAGACAGG - Intronic
1067208089 10:44236658-44236680 TCTAGGGACCTGCTGTCCAATGG + Intergenic
1089550171 11:119269026-119269048 TCTAGGGTCCTGCGGAACACTGG + Intronic
1090709820 11:129374646-129374668 TCTAGGGAGCCGGCGGGCACTGG - Intergenic
1142139381 16:88465949-88465971 CCAAGGGGCCCGCCGTGCACGGG + Intronic
1151438624 17:74114153-74114175 TCGAGGGACCCGCCATGCTCAGG + Intergenic
1152813856 17:82395444-82395466 TCTTGGGAACCCCCGAACACAGG + Intronic
1161163335 19:2772657-2772679 TCTAGGGACCCGCCGTACACTGG - Intronic
937216118 2:120314632-120314654 TCCAGGGACCCACCGCATACAGG - Intergenic
944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG + Intronic
947715842 2:232338460-232338482 TCCAGGGACCCGCCATGCTCTGG - Intronic
947734866 2:232449206-232449228 TCCAGGGACCCGCCATGCTCTGG - Intergenic
1169336165 20:4759359-4759381 TCTAGGGACTCACCCAACACCGG - Intergenic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1185343333 22:50301020-50301042 TCTAGGGACGCACCATATACAGG - Intronic
958505636 3:94973746-94973768 TCTAGGGCCCCACCCAACACTGG + Intergenic
964601229 3:158503422-158503444 TCTAGGGCCCCGCCCACCACTGG - Intronic
973782428 4:54300888-54300910 TCTAGGGCTCCGCCCTCCACTGG + Intergenic
976220033 4:82749015-82749037 TCTAGGAACCAGCCTGACACAGG + Intronic
982075025 4:151730381-151730403 TCTAGGGCCCCGCCCACCACTGG + Intronic
984721719 4:182978564-182978586 TCTAGGGCCCCGCCCACCACCGG + Intergenic
986045377 5:4031851-4031873 TCTAGAGTCCCACCCTACACAGG - Intergenic
992771102 5:80049305-80049327 GCTTGGGACCAGCCGGACACAGG - Intronic
1003682763 6:8272084-8272106 TCTAGTGAGCCACAGTACACAGG + Intergenic
1013852609 6:114534477-114534499 TCTAGGGTCCCGCCCACCACTGG - Intergenic
1028182933 7:87747518-87747540 TCTAGGGTCCCGCCCACCACTGG - Intronic
1035579601 8:731613-731635 CCCAGGCACCCGCCGGACACAGG + Intronic
1036082100 8:5568162-5568184 ACTTGGGACCCACCGAACACAGG - Intergenic
1050298151 9:4227880-4227902 TCCAGGGACCCGAGGGACACAGG + Intronic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1059609577 9:115878188-115878210 TCTAGGGCCCCGCCCACCACTGG - Intergenic
1061121226 9:128643764-128643786 TCTGGGGACGCCCCGTCCACAGG - Intronic