ID: 1161169325

View in Genome Browser
Species Human (GRCh38)
Location 19:2805133-2805155
Sequence GGCCTCCTCCACTTTCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 356}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161169325_1161169335 19 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169335 19:2805175-2805197 AGGTGAGAAGGCACGGCCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 268
1161169325_1161169336 20 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169336 19:2805176-2805198 GGTGAGAAGGCACGGCCAGGGGG 0: 1
1: 1
2: 3
3: 46
4: 282
1161169325_1161169327 -4 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169327 19:2805152-2805174 GGCCTTCAACTGCCGGTGCAAGG 0: 1
1: 0
2: 1
3: 3
4: 79
1161169325_1161169334 18 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169334 19:2805174-2805196 GAGGTGAGAAGGCACGGCCAGGG 0: 1
1: 0
2: 3
3: 29
4: 377
1161169325_1161169333 17 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169333 19:2805173-2805195 GGAGGTGAGAAGGCACGGCCAGG 0: 1
1: 1
2: 1
3: 37
4: 320
1161169325_1161169332 12 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169332 19:2805168-2805190 TGCAAGGAGGTGAGAAGGCACGG 0: 1
1: 0
2: 2
3: 56
4: 589
1161169325_1161169329 -1 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169329 19:2805155-2805177 CTTCAACTGCCGGTGCAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 60
1161169325_1161169330 7 Left 1161169325 19:2805133-2805155 CCAGGAGGAAAGTGGAGGAGGCC 0: 1
1: 0
2: 2
3: 51
4: 356
Right 1161169330 19:2805163-2805185 GCCGGTGCAAGGAGGTGAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161169325 Original CRISPR GGCCTCCTCCACTTTCCTCC TGG (reversed) Exonic
900049975 1:588384-588406 AGCTCCCTCCACTTTCCTTCCGG + Intergenic
900094104 1:933436-933458 GCCCTCCCTCACTTTCCTTCTGG + Intronic
900271969 1:1795249-1795271 GCCCTCCTCCACTGGCTTCCTGG + Intronic
900564828 1:3327065-3327087 GGCCTCCTCGCCTTGCCTGCAGG - Intronic
901329444 1:8393965-8393987 GGCCACCTCCAATCTCCACCTGG + Intronic
901359074 1:8680151-8680173 GGCTTTCTCCATTTTCCACCAGG - Intronic
902893085 1:19459094-19459116 GGCCTCCTCCACCTTCAACCAGG + Intronic
903078044 1:20787121-20787143 GGCCTCCGCCACTCGCCTTCGGG + Intronic
905489834 1:38334670-38334692 GACCTTCTCCACTCTCCTCTGGG + Intergenic
906246809 1:44282065-44282087 GGCCTGCTCCACTCTGCTACAGG + Intronic
906282290 1:44562661-44562683 AGCATGCTCCAATTTCCTCCAGG - Intronic
906399978 1:45497694-45497716 GACCCCCTCCACCTCCCTCCCGG - Intronic
906616476 1:47236066-47236088 TGCCTCCACCACTTACCTGCTGG - Intergenic
907309881 1:53533255-53533277 GGCCTTCTCCCCATGCCTCCAGG + Intronic
908331517 1:63075299-63075321 CGTCTCCTCCACTTTCCACCTGG + Intergenic
909565656 1:77050891-77050913 TGCCACCTTAACTTTCCTCCTGG + Intronic
910834454 1:91494221-91494243 GCCCTCCACCCCTTTCCTCAGGG - Intergenic
912857339 1:113181642-113181664 GGCCTGTTCCAGTTTCTTCCTGG - Intergenic
913278275 1:117160122-117160144 TGTCTCCTCCACTCTCCTCTTGG - Intronic
915119216 1:153617919-153617941 GGCCTCCTCCCCTTACCCTCTGG - Intergenic
915318581 1:155043477-155043499 GCTCTCCTGCACTTTCCTGCTGG + Exonic
915487042 1:156228777-156228799 GTGTTCCTCCACGTTCCTCCTGG + Intronic
915500368 1:156312064-156312086 GGCCTGCACCATTCTCCTCCGGG - Exonic
915741612 1:158123037-158123059 GGCCTCCCCCACTTACCCCTGGG + Intergenic
916181102 1:162084501-162084523 GGCCTCCTCCACCTCCTTGCTGG - Intronic
917780921 1:178396092-178396114 AGCCTGCTCCCTTTTCCTCCAGG - Intronic
918011122 1:180587304-180587326 AGGCTCCTCCACCTCCCTCCAGG - Intergenic
919878972 1:201889668-201889690 GGCCTCCTCTTCCTCCCTCCCGG + Intronic
920586876 1:207173112-207173134 TACTTCCTCAACTTTCCTCCAGG - Intergenic
921312560 1:213858719-213858741 GGCACACTCCACATTCCTCCTGG + Intergenic
921395635 1:214666219-214666241 GACCTCTTCCACTTTCCAACTGG + Intergenic
923553887 1:234985659-234985681 TCCCTCCTCCACTGTCCTCTTGG - Intergenic
1062906621 10:1183856-1183878 GGCCCCATCCTCTTCCCTCCTGG - Intronic
1062922288 10:1289463-1289485 GGCCTCCTCCTCCCTCTTCCAGG - Intronic
1064385765 10:14889696-14889718 GACCTCCTCCACTTTGCTCAAGG - Intronic
1064850093 10:19700340-19700362 TGCCTCCTACCCTTTCCTCATGG - Intronic
1065092785 10:22252203-22252225 GGCCTCCTGCGCTTTCCTTCGGG - Intergenic
1065191131 10:23210152-23210174 AGTTTCCTCCACTTTCCTCCTGG - Intronic
1069841994 10:71345739-71345761 GCCCTCCTCTACTCTCCTCCTGG - Intronic
1071847947 10:89538951-89538973 CTCATCCTCCACTGTCCTCCAGG + Intronic
1072553587 10:96497458-96497480 GGCATCCTCCAGTTTCCCCTCGG + Intronic
1073216683 10:101840348-101840370 GGCCTCTTTCTCCTTCCTCCTGG - Intronic
1074898826 10:117799554-117799576 GGCCTTAGCCACTTTCCCCCTGG - Intergenic
1076603850 10:131676954-131676976 GGCCACTTCCACATTCCTCCTGG - Intergenic
1076857109 10:133122770-133122792 GGCCTCCTTGTCTTTCCTCCCGG + Intronic
1077099471 11:815733-815755 GGCCTCCTCCACTCCTCACCTGG - Intergenic
1077146774 11:1050055-1050077 GGACCCCTCCACTTTCCTCCAGG + Intergenic
1078290600 11:10006711-10006733 GGCTTCCTCCCACTTCCTCCTGG + Intronic
1078755542 11:14205329-14205351 GTCCTCCTCCATCTTCCTCCAGG + Intronic
1078904967 11:15675423-15675445 GGCATCCTCCACAGTCATCCTGG + Intergenic
1083276160 11:61598163-61598185 GGCCTTCTCTTCTCTCCTCCAGG + Intergenic
1083415962 11:62525955-62525977 GGACTTTTCCACTTTCCTTCAGG + Exonic
1083808540 11:65089154-65089176 TGTCCCCTCCACTGTCCTCCTGG - Intronic
1083923713 11:65793684-65793706 GGCCTCATCCACTCTCCTGCAGG - Intronic
1084626668 11:70312937-70312959 GGCCTCCTCTACTTCCCACGTGG - Intronic
1084639758 11:70418191-70418213 GGCCACCGGCACTTTCCTCAGGG - Intronic
1084777994 11:71389748-71389770 GGAATTCTCCACTCTCCTCCAGG + Intergenic
1085311767 11:75521046-75521068 GGTCTCCTCCTCCTCCCTCCAGG + Intronic
1089197359 11:116702060-116702082 GGCCTCCTCCACTGTCCCTGTGG + Intergenic
1089262571 11:117232737-117232759 TCCCTCCCCCACTTTCCTCCCGG + Intronic
1089622250 11:119728801-119728823 CGCCTCCTCCGCTCTCCTCCCGG + Exonic
1090906851 11:131084275-131084297 GGCCCCCACCACCTCCCTCCCGG + Intergenic
1090944727 11:131419772-131419794 GCCCTCCTCCAATTTCCTCTGGG - Intronic
1091392368 12:133441-133463 GGCCTCCTCAGCCTCCCTCCTGG - Intronic
1091442139 12:519521-519543 GGCTCCCTCCCCTTTCATCCTGG + Intronic
1095977422 12:47949304-47949326 GGACTCCTTCCCTTTGCTCCTGG + Intergenic
1096021985 12:48332466-48332488 GACCCCCTCCACCTCCCTCCCGG + Intergenic
1096182445 12:49558154-49558176 GGCCTGCTCCTCTGACCTCCCGG + Exonic
1096253309 12:50047442-50047464 GGCCTTCACCACCTCCCTCCTGG + Intergenic
1098225266 12:68315055-68315077 GTCCTCCTCCTCTTTCTCCCCGG + Exonic
1098676628 12:73296967-73296989 GTCCTCCTCCACTCTCTTACTGG + Intergenic
1098958946 12:76718364-76718386 ATCCTCATCCTCTTTCCTCCAGG - Intergenic
1101521227 12:105484203-105484225 GGCCTCCCACACTGTCCTGCAGG - Intergenic
1102497644 12:113330433-113330455 TGGCTCTGCCACTTTCCTCCTGG + Intronic
1102547015 12:113664560-113664582 GCCCCCCTCCCCTTCCCTCCTGG + Intergenic
1102719472 12:115003695-115003717 GCTATCCTCCACTCTCCTCCTGG + Intergenic
1102742874 12:115223557-115223579 GGCTTCCCCCAGCTTCCTCCAGG - Intergenic
1102887426 12:116532702-116532724 GGCCACCTGCATCTTCCTCCTGG - Intergenic
1102963860 12:117111663-117111685 TCCCTCCCCCACTTCCCTCCTGG + Intergenic
1103457243 12:121076588-121076610 GACCCCCCCCACTTCCCTCCCGG - Intergenic
1104224146 12:126814534-126814556 AGCCTCCTCCACTGTCTTCCTGG - Intergenic
1104395329 12:128427586-128427608 CCCCTTCCCCACTTTCCTCCAGG + Intronic
1105432046 13:20345324-20345346 GGCCTGGACCACTCTCCTCCTGG - Intergenic
1108748805 13:53424841-53424863 GGCCTCCCCTACTTTCTTTCAGG - Intergenic
1113552067 13:111200216-111200238 TGCATCCTTCATTTTCCTCCCGG + Intronic
1116960438 14:50963086-50963108 GGCCTTGTTCACTGTCCTCCAGG + Intergenic
1117623960 14:57616850-57616872 AGCCTCCTCCACTCTTCTCCTGG + Intronic
1118437759 14:65787037-65787059 GGCCTCCTCCTCTATCCACATGG + Intergenic
1118770562 14:68940074-68940096 AGCCTCCTCCCCGGTCCTCCGGG + Intronic
1118922156 14:70159488-70159510 GACCTCTTCTACCTTCCTCCTGG + Intronic
1119113463 14:71996756-71996778 TACCTCCCACACTTTCCTCCTGG - Intronic
1119215240 14:72864398-72864420 GGCCTCCTCCACTGGACTGCGGG + Intronic
1119422698 14:74516979-74517001 CGCCCCCTCCACCATCCTCCAGG - Intronic
1121527908 14:94632338-94632360 GCCCTTCTCCACTCTGCTCCTGG - Intergenic
1122013520 14:98773528-98773550 GGCCACCACCATTTTCCCCCAGG + Intergenic
1122318662 14:100840380-100840402 GGGCTCCCCCACATTCCTCTCGG - Intergenic
1122350648 14:101088010-101088032 TGCCTCCTGCACGTTGCTCCAGG - Intergenic
1122822213 14:104353341-104353363 GGCCTCCTCCTCAGGCCTCCTGG - Intergenic
1122976220 14:105171898-105171920 CCCCTTCTCTACTTTCCTCCTGG + Intergenic
1123415975 15:20095817-20095839 GACCTGCTCCATTTTCATCCTGG + Intergenic
1123525315 15:21102927-21102949 GACCTGCTCCATTTTCATCCTGG + Intergenic
1123710047 15:22980385-22980407 GGCCTCCTCCCCTTCCTCCCGGG + Intronic
1123832366 15:24154005-24154027 GGCCTCCTCCATGTTCCTCAAGG + Intergenic
1123837987 15:24215254-24215276 GGCTGCCTCCACGTTCCTCAAGG - Intergenic
1123847528 15:24317550-24317572 GGCCTCCTCCACATTCCTCAAGG - Intergenic
1123866573 15:24524931-24524953 GGCCTCTTCCACATTCCTCAAGG - Intergenic
1124559668 15:30759830-30759852 GGCCTACTCTTCTTTCTTCCTGG - Intronic
1124591832 15:31060817-31060839 GGCTGCCTCCACCTTCCTCCAGG - Intronic
1124637217 15:31372924-31372946 GGCCCCCTCCACTATCCCCAAGG - Exonic
1124671582 15:31645884-31645906 GGCCTACTCTTCTTTCTTCCTGG + Intronic
1125578783 15:40771544-40771566 GGCCTTCTCCCCTTTCTTCCTGG - Exonic
1125728790 15:41881627-41881649 GGTCCCCTCCACTTTCACCCAGG - Intronic
1126704780 15:51397096-51397118 CGCCCTCTCCACTCTCCTCCAGG - Intronic
1126840350 15:52711563-52711585 GGAATCCTCCAGTTTCCTCCAGG + Intergenic
1127291571 15:57575814-57575836 GTTCCCCTTCACTTTCCTCCAGG + Intergenic
1128390417 15:67179099-67179121 GGCCTCATCCTCTTTACTCTCGG - Intronic
1128581228 15:68811498-68811520 GGCCTCCACCCCTTCCCTCCCGG - Intronic
1129683557 15:77671808-77671830 GGCCTCCTCCAGTTTCCTGGGGG - Intronic
1129765147 15:78160137-78160159 GGGATCATCCACTTTCCTCCAGG - Exonic
1130428216 15:83822001-83822023 GACCTCCCCCACCTCCCTCCCGG + Intronic
1131033524 15:89206114-89206136 AACCTCCTCCACTTTCCCCTGGG + Intergenic
1131164623 15:90133539-90133561 GTCCTCCTGCTCTTTGCTCCAGG + Intergenic
1131557605 15:93413389-93413411 GACCTCCACCCCATTCCTCCTGG + Intergenic
1132888682 16:2193975-2193997 GGGCTCCTGGACTTTCATCCTGG - Intronic
1132988970 16:2783367-2783389 GCCTCCCTCCCCTTTCCTCCTGG - Intergenic
1133552510 16:6870963-6870985 GGCTTCATCCACTTACATCCAGG - Intronic
1133796908 16:9053502-9053524 GCCCTCCTCCTCTGTCCACCTGG + Intergenic
1133966743 16:10537297-10537319 TGCTTCCTCCAAGTTCCTCCAGG + Intronic
1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG + Intronic
1136092603 16:27931244-27931266 AGCCTCCTCTACTTTGTTCCAGG - Intronic
1136428113 16:30182921-30182943 GGGCTCCTCCTCCTTCCCCCAGG + Intronic
1136572518 16:31105320-31105342 GACCCCCCCCACTTCCCTCCCGG - Intergenic
1137597508 16:49734566-49734588 TGGCTCCTCCCCTGTCCTCCTGG + Intronic
1138078755 16:54068611-54068633 AGCCTCCTCCATTTTCAGCCAGG + Intronic
1139328617 16:66170588-66170610 GGCCTCCTCCTATTTCCTTATGG - Intergenic
1139515678 16:67451165-67451187 GGCTTCCCCAGCTTTCCTCCCGG + Intronic
1140132830 16:72179083-72179105 GCCCTCCTCCACCTTCTCCCAGG + Intergenic
1141346924 16:83255301-83255323 GGCCTCCTGCTCCATCCTCCAGG + Intronic
1142168484 16:88606836-88606858 GGCCTCCTCAACTCTCCACATGG - Intronic
1142430162 16:90022079-90022101 GGCCTCCTCCCCACTCCTCACGG - Intronic
1143176747 17:4959887-4959909 TGCCTCCTCCTCTTGCCTCTGGG + Exonic
1144509228 17:15860951-15860973 GGCCACTTCCACTTTCCCTCTGG - Intergenic
1144578297 17:16443650-16443672 GGCCCCCTCCAGGGTCCTCCTGG + Exonic
1144682630 17:17205736-17205758 GGCCTCATTTACTTTCCTCGTGG - Intronic
1145173346 17:20678596-20678618 GGCCACTTCCACTTTCCCTCTGG - Intergenic
1145244389 17:21258693-21258715 GGTCTCATCCCCTGTCCTCCAGG - Intergenic
1146214901 17:30971244-30971266 GGCCTGCCCCACTTGCCGCCAGG + Exonic
1146262270 17:31429854-31429876 TCCTTCCTCCACTTGCCTCCTGG + Intronic
1146568127 17:33930789-33930811 GGTCTGCTCCATTTTCCTGCTGG - Intronic
1147302376 17:39540382-39540404 TGCATGCTCCACTATCCTCCAGG - Intronic
1147511778 17:41075784-41075806 GGCCTCCCCCACTTCCAACCAGG + Intergenic
1147733476 17:42618698-42618720 GGCCTCCCTCCCTTTCCACCTGG - Intergenic
1147785171 17:42973356-42973378 GACCCCCCCCACTTCCCTCCCGG - Intronic
1147962366 17:44175854-44175876 ATCCTCCTCCACTTTCCCCTAGG - Intronic
1148150988 17:45396368-45396390 GGCCTCCCGTACTTTCCCCCTGG + Intronic
1148225720 17:45896623-45896645 GGCTTCCTCCCGTGTCCTCCAGG - Intronic
1148748622 17:49932021-49932043 GCCCTCCTCCACTTCTCTCCTGG - Intergenic
1149530265 17:57389446-57389468 GCCCTTCTCCCCTTTCTTCCTGG + Intronic
1151322719 17:73361347-73361369 GGCCTCCTTTACTTCCGTCCTGG - Intronic
1151423271 17:74012806-74012828 CCCCTCCTCCTCTTTCTTCCTGG - Intergenic
1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG + Intronic
1152077363 17:78168102-78168124 GACCCCCTCCCCATTCCTCCTGG - Intergenic
1152439063 17:80294248-80294270 GGCAGCCTGCACCTTCCTCCAGG + Intronic
1152933728 17:83124184-83124206 GGCCTCCTCCCCATTCCCCTTGG - Intergenic
1152950383 17:83226944-83226966 AGCTCCCTCCACTTTCCTTCCGG - Intergenic
1153179149 18:2413463-2413485 GGCCTCCTCCTATTTCCCACTGG + Intergenic
1155223247 18:23704350-23704372 GGCCTGGAACACTTTCCTCCTGG - Intronic
1156478872 18:37423714-37423736 GGCTTCCTCCCCTTTCCTAGAGG - Intronic
1156978047 18:43249455-43249477 TGCCTCATCCACCTTCCTTCAGG + Intergenic
1160157889 18:76447340-76447362 TGCCTCCTCCACCTTTATCCTGG + Intronic
1160850545 19:1189560-1189582 GGTCTCCTCCCTCTTCCTCCAGG + Intronic
1161169325 19:2805133-2805155 GGCCTCCTCCACTTTCCTCCTGG - Exonic
1162196173 19:8986476-8986498 AGCCACCTCCACTGCCCTCCAGG - Intergenic
1163229921 19:15994513-15994535 GGACTCCTGGACTTTCCTCCAGG - Intergenic
1163630414 19:18415450-18415472 GGCCGCCTCCGCCTTCCTCTGGG - Intergenic
1163688651 19:18726319-18726341 GGCCTCCTCTGCTGTCCCCCGGG - Intronic
1165316829 19:35060859-35060881 GGTCCCCTCCTCTGTCCTCCTGG - Intronic
1165947345 19:39452129-39452151 GGCCTCCTCCAATTACCGACAGG - Intronic
1166049859 19:40252211-40252233 GGCCCCCTCCACTCTGCTCCTGG - Intronic
1166213425 19:41321380-41321402 TGCCACCCCCAATTTCCTCCTGG - Intronic
1166689282 19:44813058-44813080 GGCCTCCAGCACCATCCTCCAGG - Intronic
1166713809 19:44953822-44953844 GGTTTCCTCCACTTTCCTCTAGG - Intronic
1166747999 19:45151076-45151098 GGGCTCCCCCACTTTCCCTCTGG - Exonic
1166932324 19:46308669-46308691 GGGGGCCTCCACCTTCCTCCTGG - Exonic
1166983796 19:46648289-46648311 GGGCTCCTCCCCATTCCTCTCGG + Exonic
1167054096 19:47097975-47097997 GGCCTCTTCCCATTTCCTCATGG - Intronic
1167145938 19:47680901-47680923 GGCCGCCACCACTGTCCTCCAGG + Exonic
1167388426 19:49178433-49178455 AGCCTCCCCGACTGTCCTCCTGG - Intronic
1167409769 19:49338037-49338059 CCCCTCCTCCAGTTCCCTCCCGG + Intronic
1167456894 19:49601127-49601149 GGCCTCATCCTCCTCCCTCCAGG - Intronic
925124829 2:1446422-1446444 GGGCTCTTACACTTTGCTCCTGG - Intronic
926061763 2:9808939-9808961 GTACCCCTCCAATTTCCTCCTGG + Intergenic
926331341 2:11828488-11828510 GGCCGACTTAACTTTCCTCCAGG - Intergenic
926334274 2:11851509-11851531 GTTCTCCACCACATTCCTCCAGG + Intergenic
926925164 2:17980094-17980116 GGCCTCCTGCATTTTCAGCCTGG - Intronic
926937626 2:18102303-18102325 GTCCTCCTTCACTGTCCTCAAGG + Intronic
927110477 2:19860837-19860859 GCCCTCCTTCTCCTTCCTCCAGG + Intergenic
928103192 2:28451514-28451536 ATCTTCCTCCACTTTCCTGCTGG + Intergenic
928585472 2:32754775-32754797 GACCTCCCCCACCTCCCTCCCGG + Intronic
930242974 2:48955311-48955333 AACCTCCTCAACTTTCCTCCTGG - Intergenic
930278854 2:49345569-49345591 CCATTCCTCCACTTTCCTCCTGG + Intergenic
930523539 2:52497811-52497833 GGCCTTCTCCACATAGCTCCAGG - Intergenic
932476357 2:72008779-72008801 GTCCTCCTCCCTTCTCCTCCTGG - Intergenic
932710600 2:74061146-74061168 GACCCCCCCCACTTCCCTCCCGG + Intronic
932863620 2:75319184-75319206 GGCCTCCACCACTTCCTTACTGG + Intergenic
933287219 2:80397618-80397640 CTCTTCCTCCACCTTCCTCCAGG + Intronic
933935659 2:87201650-87201672 CACCTCCTCCTCTATCCTCCAGG - Intergenic
936357490 2:111764175-111764197 CACCTCCTCCTCTATCCTCCAGG + Intergenic
937320438 2:120957589-120957611 TGCCTCGTCCACTTTCCTATTGG - Intronic
937922216 2:127138461-127138483 TGCCCTCTTCACTTTCCTCCGGG + Intergenic
937934408 2:127231007-127231029 CTCCTCCTCCAATTTCCTGCAGG - Intergenic
938034955 2:128027898-128027920 CGTCTCCTCCCCTTCCCTCCCGG + Intronic
938317328 2:130339232-130339254 GACCTTCTCTCCTTTCCTCCAGG - Exonic
938734726 2:134175788-134175810 GGCCTCCACCCCTTTCTTCCAGG - Intronic
941441141 2:165538320-165538342 GGCCTGTCCCACTTTCCTACTGG - Intronic
944128390 2:196319230-196319252 GGCCGCCTTCACCTTCCTCTGGG + Exonic
945835794 2:214835496-214835518 GACCCCCTCCACCTCCCTCCCGG + Intergenic
946213719 2:218167366-218167388 GTCCTCCTCCTCTTTCCCACTGG - Intergenic
947523679 2:230865990-230866012 GGCTTCCTCCACTTTCCCTCTGG + Intronic
947614482 2:231546434-231546456 GGCCTCCGCCACTGGCCTCCAGG + Intergenic
947619550 2:231580807-231580829 CGCGTCCTCCCCCTTCCTCCAGG - Intergenic
947679554 2:232017613-232017635 ATCCTCCTGCACTCTCCTCCAGG + Intronic
948043405 2:234923180-234923202 GGTCTCCTCCTGTTCCCTCCTGG - Intergenic
948140721 2:235670296-235670318 GGCCTCCTCCTCAAGCCTCCCGG - Intronic
948215638 2:236228183-236228205 AGCATTCTCCACTTTCCACCAGG - Intronic
948296397 2:236863840-236863862 GTCCTCCTCCAGAGTCCTCCAGG - Intergenic
1168794969 20:605354-605376 GGCCTCCTTGACTTCCCTCAGGG + Intronic
1169075134 20:2755655-2755677 TGCCTCCTCCATGTCCCTCCCGG + Exonic
1170623256 20:18011326-18011348 CACCTCCTCCACTATCATCCTGG + Intronic
1171404105 20:24898211-24898233 GGCCTCCTCCACCTGCACCCAGG + Intergenic
1172100903 20:32483587-32483609 TGCCCCCTCCCCCTTCCTCCGGG - Intronic
1172288998 20:33761811-33761833 GGCCTCGTCCCCGTTCCTGCAGG + Intronic
1174061933 20:47839157-47839179 TGGCTCCTCCTCTTTCCTCAGGG - Intergenic
1174069575 20:47890074-47890096 TGGCTCCTCCTCTTTCCTCAGGG + Intergenic
1174263250 20:49312850-49312872 GGCCCCAGCCACTTTCCTCTGGG + Intergenic
1174708194 20:52678276-52678298 GGCCGCCTCCAGCTTCCTGCTGG + Intergenic
1175239141 20:57533866-57533888 GGCCACCTCTCCTTACCTCCTGG + Intergenic
1175353587 20:58344431-58344453 TGCTTCCTCCCCTTTCCTCTGGG + Intronic
1175353594 20:58344468-58344490 TGCCTCCTCCCCTTTGCTCTGGG + Intronic
1175405005 20:58720173-58720195 GCCCTCCTCCAGCTTCCTGCAGG - Intergenic
1175441789 20:58997440-58997462 GTCCTTCGCCACTTTCCTTCTGG - Intronic
1175988054 20:62774001-62774023 GGCCTGCTCCACTGTCCCCTCGG - Intergenic
1176092205 20:63323445-63323467 CGCCTCCTCCTGGTTCCTCCTGG + Intronic
1176884173 21:14234270-14234292 GGCTTCCTTCACTTTCTCCCAGG - Intergenic
1177897219 21:26868009-26868031 GGTCTCTTCCCCTTTCCTCCGGG - Intergenic
1178278130 21:31257658-31257680 GGAGTCCTCCACATTGCTCCTGG - Intronic
1179218371 21:39386165-39386187 GGCCACCTCCTTTTTCCTCTAGG + Intronic
1179507289 21:41850281-41850303 GCCCCCCCACACTTTCCTCCTGG + Intronic
1179800874 21:43810988-43811010 GGCCTCCAACCCTTTGCTCCAGG + Intergenic
1179908324 21:44435459-44435481 GGCTGCCTTCACTTTCCTGCCGG + Intronic
1180615174 22:17121564-17121586 CGCCTCCTCCCGCTTCCTCCAGG - Intronic
1180943814 22:19678820-19678842 TCCCTCCTCCACTGGCCTCCTGG - Intergenic
1181124037 22:20691357-20691379 CGCCTCTTCCGCTTTCGTCCCGG - Intergenic
1181169227 22:20998883-20998905 AGCCTCCTCCAAATCCCTCCTGG + Exonic
1181343863 22:22203153-22203175 GGGCTCCTCCACCTGGCTCCTGG + Intergenic
1181855691 22:25780069-25780091 AGCCACCTTCACTGTCCTCCGGG + Exonic
1181960534 22:26618939-26618961 GGCCACCAGCACTGTCCTCCAGG - Intergenic
1182005367 22:26955302-26955324 TGCCTCCTCCACCTTCCACCTGG + Intergenic
1182019466 22:27068858-27068880 GGCCTCTTTCATTTTCCTCTTGG + Intergenic
1182061255 22:27399402-27399424 GGCCTCCTTCGCTTGCCTCCCGG - Intergenic
1183369776 22:37425975-37425997 AGCTTCCACCACATTCCTCCAGG + Intronic
1183490069 22:38111339-38111361 GGACACCTCCTCTTTCCTCTAGG - Intergenic
1183579608 22:38716076-38716098 GGCCTCCTCACCTGACCTCCAGG - Exonic
1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG + Intronic
1184752139 22:46492764-46492786 GGCAACCTCTACTGTCCTCCTGG - Intronic
1184910861 22:47533185-47533207 GGCCTAATTCAATTTCCTCCAGG - Intergenic
1185203585 22:49523523-49523545 GTCCTCCTGCACTGTCCTCCTGG + Intronic
949559680 3:5189288-5189310 GGACTCCACTGCTTTCCTCCAGG - Intronic
950011742 3:9728956-9728978 GGCCTGCTCTACTTCCTTCCAGG + Intronic
950086517 3:10262249-10262271 AGCCTCCTTCACATTTCTCCCGG + Intronic
950185829 3:10944981-10945003 ACCCTCCTCCCCTTTCCTCAAGG - Intergenic
951981105 3:28568062-28568084 GGCCTCCTCCTTTTTCTTTCTGG + Intergenic
952149843 3:30577579-30577601 GCCCTCCTCCTCTTTCACCCAGG + Intergenic
953004488 3:38965495-38965517 AGTCTGCTCCAGTTTCCTCCTGG + Intergenic
953880721 3:46690048-46690070 GGGTTCCTCCACTTGCCTGCTGG - Intronic
953932433 3:47012394-47012416 TACCTCCTCCCCTTTCCTCCTGG + Intergenic
956824765 3:72987662-72987684 AGCCTGCTCCACTTGCCTACAGG + Intronic
956944892 3:74209779-74209801 GGACTCTTCCTCTTTCCTCAAGG + Intergenic
958426114 3:93980280-93980302 GGCCGCCTTCACTTCCCTCCCGG + Exonic
960316094 3:116179060-116179082 GGCCTCCTCCTCCTTCCTGCAGG + Intronic
960482542 3:118211429-118211451 GGCCACCTCTTCTTTCCTCAAGG - Intergenic
961784454 3:129339893-129339915 GACCCCCTCCACCTCCCTCCCGG + Intergenic
962957950 3:140283586-140283608 GGACTCCTCCTCTTGCCTCTAGG + Intronic
962986603 3:140541848-140541870 GACCTCCTCCACCCTCCTCATGG + Intronic
963244388 3:143046950-143046972 GACCTCCCCCACCTCCCTCCCGG + Intronic
964195533 3:154059831-154059853 GGGCTCTTCCTCTTTCCTTCTGG - Intergenic
967109956 3:186284343-186284365 CGCCTCCTGCAATTTCCTGCAGG - Intronic
967124979 3:186415175-186415197 GGCATCCTCCAGTTTTCTCTAGG - Intergenic
967963283 3:194941940-194941962 GGTGTCCTCCACTCCCCTCCAGG + Intergenic
968066726 3:195763047-195763069 GGCCTCCAGCGCCTTCCTCCCGG - Intronic
968232074 3:197010116-197010138 CTGCGCCTCCACTTTCCTCCTGG - Intronic
968411819 4:396133-396155 GACCCCCTCCACCTCCCTCCCGG - Intergenic
968541980 4:1172481-1172503 GGCCTCCTGCACTTTCCCCGCGG - Intronic
968815025 4:2817746-2817768 CACCTTCTCCACTTTCCTGCGGG - Intronic
969531457 4:7733175-7733197 GGACCCCTTCACTCTCCTCCTGG + Intronic
969968469 4:11021496-11021518 GGCCTCCTCCAGTTCCCCACGGG + Intergenic
971243467 4:24909172-24909194 TGCTTCCTCCACTTGCCTCTAGG - Intronic
971775376 4:30956945-30956967 GCCGACCTCCACGTTCCTCCAGG - Intronic
972564591 4:40258676-40258698 GGCCCCCTCCCCTTTCTTCCTGG - Intergenic
972789296 4:42355442-42355464 ACCCTGCTCCCCTTTCCTCCTGG - Intergenic
973650465 4:52992804-52992826 GGCATCCCCCACCTCCCTCCCGG - Intronic
978651821 4:111014823-111014845 ATCCTCCTCCATTTGCCTCCAGG + Intergenic
981666457 4:147232494-147232516 AGCCTCCTCCATTTTATTCCTGG + Intergenic
982138259 4:152293490-152293512 GGGCTCCTCAGCTTTCCACCTGG - Intergenic
984934906 4:184881692-184881714 GGCTTCCTCATCTGTCCTCCAGG - Intergenic
985232237 4:187831860-187831882 GTCCTCCTCCAGATTCATCCAGG + Intergenic
985492793 5:189140-189162 GGCCTCTTTTGCTTTCCTCCTGG + Exonic
987073634 5:14360464-14360486 GGCCTCCTCCACATACCTCTGGG + Intronic
989576162 5:42990706-42990728 AGGCTCCTCCAATTGCCTCCTGG - Intergenic
989997654 5:50854847-50854869 GTCCTCTTCCTCTGTCCTCCAGG + Intergenic
990157104 5:52889629-52889651 TGCCCCCACCCCTTTCCTCCAGG - Intronic
995236149 5:109832722-109832744 GGGCCCCCCCACTTCCCTCCCGG + Intronic
995755060 5:115494389-115494411 CCCCTCCTCCCCTTTCCTTCTGG - Intergenic
996569949 5:124922498-124922520 GCCTTCCTCCCCGTTCCTCCCGG - Intergenic
998149236 5:139747509-139747531 GCCCTCCACCACATTCCTTCCGG - Intergenic
998523196 5:142818841-142818863 GGTCCCCTCCACATTACTCCAGG - Intronic
999518146 5:152321602-152321624 GACTTCTTTCACTTTCCTCCGGG - Intergenic
1000435116 5:161198466-161198488 GGCATACTACAGTTTCCTCCTGG + Intergenic
1001519359 5:172379783-172379805 GGCCTCCCTCACTTTGCTTCTGG - Intronic
1002103292 5:176867937-176867959 GGCCCCCTGGAGTTTCCTCCAGG + Intronic
1002345816 5:178546920-178546942 TGCCTCCTCCGTGTTCCTCCAGG - Intronic
1003964876 6:11243191-11243213 GGCCTCCTGCTCAGTCCTCCAGG + Intronic
1004869438 6:19889895-19889917 GGCCTTTTCCATTTTCTTCCTGG + Intergenic
1005372757 6:25152864-25152886 GCCCCTCTCCACTTTCCGCCAGG - Intergenic
1005958999 6:30683376-30683398 GGCTGCCCCCACTTTCCTGCAGG + Intronic
1006232221 6:32595600-32595622 GACCCCCCCCACTTCCCTCCCGG + Intergenic
1006287344 6:33106829-33106851 AGCCACCACCCCTTTCCTCCTGG + Intergenic
1006332900 6:33405083-33405105 GGCCTCCTCCTGTTTCCCTCTGG + Exonic
1006813070 6:36833097-36833119 GGCCTCCACCACCATCCTCCTGG + Intronic
1006860711 6:37170137-37170159 GCGCTCCTCCCCTTTACTCCTGG + Intergenic
1007511991 6:42380892-42380914 TGCCTCCTCCACTTCTGTCCTGG + Intronic
1007922808 6:45626117-45626139 GGCCAAATCCACTTTGCTCCTGG + Intronic
1011405042 6:87009784-87009806 GACCTCCCCCACCTCCCTCCCGG + Intronic
1012284094 6:97367367-97367389 AACCTCCTCCATTTTACTCCTGG - Intergenic
1013112829 6:107078250-107078272 GCCCTCCTGCACTTTCCTTGGGG + Intronic
1013183786 6:107739914-107739936 TGCTTCCTCCACTTTCCCCAAGG + Intronic
1014554501 6:122829544-122829566 ACCCTCCTACACCTTCCTCCAGG - Intergenic
1014634136 6:123824173-123824195 GGCCTCTTCCACTTACTTTCAGG - Intronic
1017002958 6:150008583-150008605 TTTCTCCTTCACTTTCCTCCTGG - Intergenic
1017493723 6:154966231-154966253 GGCCCCCTCCACCTCCCTCCCGG + Intronic
1017695067 6:157006344-157006366 GTCCTCCCCCACCTCCCTCCTGG + Intronic
1018395505 6:163375207-163375229 GTCCTCCTCCTTGTTCCTCCCGG - Intergenic
1019249526 6:170734300-170734322 AGCTCCCTCCACTTTCCTTCCGG - Intergenic
1019393343 7:802317-802339 GGCCGCCTCCACTCAGCTCCGGG + Intergenic
1019528320 7:1491123-1491145 GCCCTCCTCCCGTTTTCTCCCGG - Intronic
1021887196 7:25151059-25151081 GCCCTCCTCCACCATCTTCCTGG + Intronic
1022414048 7:30163138-30163160 TGTCTCCACCACCTTCCTCCCGG + Intergenic
1025232526 7:57212007-57212029 TGGCTCCTCCTCTTTCCTCAGGG + Intergenic
1025979227 7:66393615-66393637 GACCCCCTCCACCTCCCTCCCGG + Intronic
1026853415 7:73738442-73738464 GGCCGCTTCCGCTTTCCTACAGG - Exonic
1027162963 7:75815530-75815552 TCCCTCCTGAACTTTCCTCCTGG - Intronic
1027707510 7:81552855-81552877 GGCCAACTCCACGTTTCTCCTGG - Intergenic
1029465645 7:100723061-100723083 AGTCTACTCCAATTTCCTCCGGG + Exonic
1029708591 7:102287636-102287658 GGCACCCTCCACGATCCTCCCGG - Intronic
1032291402 7:130591764-130591786 TGACCCCTCCACTTCCCTCCCGG - Intronic
1032465523 7:132142055-132142077 ATCCTCCACCACCTTCCTCCAGG - Intronic
1033455140 7:141496251-141496273 GGCCTCCTCCATCTTGCCCCAGG - Intergenic
1034819112 7:154200453-154200475 GGTCTCCTCCAATCTCCACCCGG - Intronic
1035130903 7:156652052-156652074 GGTCTCCTCCGCACTCCTCCAGG - Intronic
1035333654 7:158112436-158112458 GGCCTCCTGCACTCGTCTCCAGG - Intronic
1035498570 8:73356-73378 AGCTCCCTCCACTTTCCTTCCGG + Intronic
1035637290 8:1156343-1156365 CGCCTCCCCAACTCTCCTCCGGG - Intergenic
1035679593 8:1478271-1478293 GCCCTCCTTCCCTTTCCTTCAGG + Intergenic
1036387172 8:8292554-8292576 GGCCTGCTCCTCTTTCCCCTTGG + Intergenic
1037079138 8:14761605-14761627 CACCTCCTCCTCTTACCTCCCGG + Intronic
1037813406 8:22099548-22099570 GGCCTCCTACCCTTCCCTGCAGG + Intronic
1038672959 8:29597043-29597065 GGCCTCCTTCTCTGGCCTCCTGG + Intergenic
1039964978 8:42277633-42277655 CCCCTCCTCCACATTCCTCCAGG + Intronic
1039970713 8:42319606-42319628 AGCCTGCTCCATTTCCCTCCAGG - Exonic
1040550028 8:48430499-48430521 GTCCTCCTCCTCTCGCCTCCAGG + Intergenic
1041646035 8:60253644-60253666 GCCCTCCTCAACTTGACTCCAGG + Intronic
1042216065 8:66430206-66430228 TACTTCCTCCTCTTTCCTCCTGG - Exonic
1042508096 8:69582726-69582748 GGCCTCCTCCTCATCCCTACGGG - Intronic
1044427203 8:92065801-92065823 GGTCTTCTCAACTTTCCTCTCGG + Intronic
1044744778 8:95361574-95361596 GGCCTCCTCCACCTCCGTCATGG + Intergenic
1047104641 8:121719735-121719757 GGCCTCCTCCTCTCTCCTGAGGG - Intergenic
1047214588 8:122865982-122866004 GGCCACCTCCGCTTTCAACCAGG - Intronic
1048845715 8:138602337-138602359 TGCCTTCTCTCCTTTCCTCCTGG + Intronic
1049052807 8:140212037-140212059 GGCATGCTCCTCTGTCCTCCTGG - Intronic
1049097100 8:140555259-140555281 GGTCTCCTCTCATTTCCTCCTGG - Intronic
1049273351 8:141707712-141707734 TGCCTCCTCTACTTCCCTCCTGG + Intergenic
1049579910 8:143406530-143406552 GGCCTCCTCCACTGTCCCTGAGG - Intergenic
1049682037 8:143923587-143923609 GGCCTCTTCCACCTGCCGCCGGG + Exonic
1050117426 9:2276729-2276751 CCCCTTCTCCACTTTCCTGCGGG + Intergenic
1051769482 9:20561094-20561116 TGCCTCCTGTACTTTTCTCCAGG + Intronic
1053139197 9:35671936-35671958 GACCTGCTCCAATTTCCACCTGG - Intronic
1059098833 9:111449854-111449876 GGCCTTCTCCAATTTCCTGAAGG + Intronic
1059120819 9:111640822-111640844 GGCCCCCCCCACCTCCCTCCCGG - Intronic
1059266221 9:113033872-113033894 TGACTCCTCCTCTTTCCTCCTGG - Intergenic
1060397695 9:123327599-123327621 GGCTCCCACCACCTTCCTCCAGG - Intergenic
1061178693 9:129011863-129011885 GGCCTCCTCCTCTATCCTCAGGG + Intronic
1061484110 9:130911737-130911759 GGCCTCCTCCCCCTGCCTTCCGG - Intronic
1061575573 9:131503742-131503764 GGCCTCCTCATCTCTCCTCAAGG - Intronic
1061879191 9:133560241-133560263 GCCCAACTCCACTTTCCTCTGGG - Intronic
1062282180 9:135757037-135757059 AGCCTCATCCACTGACCTCCAGG + Intronic
1062460249 9:136659923-136659945 GGCCTCCTCCCCTCACCTCAGGG - Intronic
1062495126 9:136828019-136828041 GCCCCCCTCTCCTTTCCTCCCGG + Intronic
1203610426 Un_KI270748v1:91238-91260 AGCTCCCTCCACTTTCCTTCCGG - Intergenic
1185623013 X:1464943-1464965 GGCCTTCTCCATTCTCCTCCAGG - Exonic
1187129597 X:16489553-16489575 GTCCTCATCCACTTCCATCCTGG - Intergenic
1189617024 X:42794408-42794430 TGCCTCCCCCACTCCCCTCCTGG - Intergenic
1190478072 X:50847834-50847856 TGCCTCCTCTGCTTTTCTCCAGG + Intergenic
1190708650 X:53049893-53049915 CTCCTCCTCCACTCTCCTCCAGG + Intronic
1191010103 X:55749173-55749195 GACCCCCCCCACTTCCCTCCCGG - Intronic
1194204483 X:90995624-90995646 GGCCTCTGCCACCTTCCTGCAGG + Intergenic
1195615250 X:106906723-106906745 GGCCTCATCCACCTCCTTCCTGG + Intronic
1195674475 X:107497407-107497429 GGCCCCCTCCCCATTTCTCCTGG + Intergenic
1197470658 X:126863563-126863585 GTCCTCCTGCTCTTTGCTCCAGG + Intergenic
1198683235 X:139203810-139203832 AGCCTCCTCCACTTCCCCTCTGG - Intronic
1200358557 X:155578060-155578082 GGCCTCCCCCATCTCCCTCCTGG - Intronic