ID: 1161170068

View in Genome Browser
Species Human (GRCh38)
Location 19:2808114-2808136
Sequence AGGGAGGTTTAGAACCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161170059_1161170068 20 Left 1161170059 19:2808071-2808093 CCGTGGTTTTCATGCTGCCCTGC 0: 1
1: 0
2: 2
3: 10
4: 247
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1161170061_1161170068 2 Left 1161170061 19:2808089-2808111 CCTGCGCCAAGCCACCTCTGCTG 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1161170066_1161170068 -9 Left 1161170066 19:2808100-2808122 CCACCTCTGCTGAGAGGGAGGTT 0: 1
1: 0
2: 5
3: 20
4: 212
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1161170060_1161170068 3 Left 1161170060 19:2808088-2808110 CCCTGCGCCAAGCCACCTCTGCT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1161170063_1161170068 -4 Left 1161170063 19:2808095-2808117 CCAAGCCACCTCTGCTGAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1161170058_1161170068 25 Left 1161170058 19:2808066-2808088 CCTGGCCGTGGTTTTCATGCTGC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161170068 Original CRISPR AGGGAGGTTTAGAACCTCAG AGG Intronic
900371352 1:2333541-2333563 AGGGAGGTCTCGGACCTCAGGGG + Intronic
901419294 1:9139606-9139628 AGGGAGATTTAGAGCATGAGGGG + Intergenic
904377630 1:30091732-30091754 AGGGAGATTTGGGAACTCAGAGG + Intergenic
907738032 1:57134769-57134791 AGGCAGGATTAGAACCTAGGCGG - Intronic
908433307 1:64080209-64080231 AGGGTGATTTTGACCCTCAGAGG + Intronic
908634968 1:66153461-66153483 AGGGGGGTCAAGAACCTCATGGG + Intronic
908804164 1:67912747-67912769 AGGGTGGTTCAGAGCCTAAGTGG - Intergenic
909482656 1:76142253-76142275 AAAGAGGTTTACAACATCAGCGG + Intronic
911070193 1:93826210-93826232 AGGCAGGTGTGGAACATCAGAGG - Intronic
913353859 1:117896171-117896193 ATGGAGGGTTAGCACCTCATAGG - Intronic
918092037 1:181305437-181305459 AGTGAGGCTCAGAACCTAAGAGG - Intergenic
918240663 1:182617128-182617150 CCGTAGGTGTAGAACCTCAGAGG - Intergenic
919500367 1:198330635-198330657 AGGGAGCCTTTGAACATCAGTGG - Intergenic
920187059 1:204166325-204166347 AGGGAGCCACAGAACCTCAGTGG - Intergenic
922901176 1:229137892-229137914 AGGGTGTCTTAGAAACTCAGAGG + Intergenic
923346985 1:233063788-233063810 AGGGAGGTTAAGAGACTTAGAGG - Intronic
1063629852 10:7723264-7723286 AGGAAGGTCTTGACCCTCAGAGG + Intronic
1063710430 10:8472117-8472139 AGTGAGGTTTAGCAGTTCAGAGG + Intergenic
1065791723 10:29266417-29266439 AGGCATGGTTATAACCTCAGAGG + Intergenic
1071048970 10:81422453-81422475 AGTCAGGCTTAGAACTTCAGTGG - Intergenic
1072325601 10:94295500-94295522 GGAGGGGTTTAAAACCTCAGTGG - Intronic
1073103522 10:101019323-101019345 AGCCAGGGTTAGAACCGCAGTGG + Intronic
1074628532 10:115221758-115221780 AGTAGGGTTTAGAATCTCAGGGG - Intronic
1076726509 10:132416561-132416583 AGGGAGGGCTAGACCCTGAGGGG - Intronic
1077309569 11:1882367-1882389 AGGCTGGTTTAGGGCCTCAGAGG - Intronic
1081075483 11:38667911-38667933 AGGGACGTTTAGACACTGAGGGG - Intergenic
1082693930 11:56337026-56337048 AGGGAGATTTAGAGCCCTAGGGG - Intergenic
1083147101 11:60767851-60767873 TGGGAGCTTTTGATCCTCAGGGG - Intronic
1083622823 11:64057376-64057398 AGGCAGATTTAAAACCTCATGGG + Intronic
1083775452 11:64892475-64892497 AAGGACGCTTAGGACCTCAGTGG + Intergenic
1084829004 11:71753791-71753813 AGGGTGGTTTTGATCCACAGAGG + Intergenic
1087990688 11:104743220-104743242 AGGGGGGTTTTGAACAGCAGAGG + Intergenic
1089158775 11:116422251-116422273 AGGGAGGACTAAGACCTCAGTGG + Intergenic
1089323535 11:117642279-117642301 AGAGTGGTTCAGAGCCTCAGAGG - Intronic
1091822521 12:3486998-3487020 AGGGAGGAATAGGACCACAGAGG + Intronic
1091842419 12:3630557-3630579 AGGGAGGTTGTGAACCAAAGTGG + Intronic
1092447241 12:8568524-8568546 AGGGAGGCTCAGATCCACAGTGG + Intergenic
1092486762 12:8908757-8908779 AGGGAGGCTGAGAACCCAAGAGG - Intergenic
1093002130 12:14009135-14009157 ATGGAGGTTGAGAAGCCCAGTGG + Intergenic
1093304032 12:17489958-17489980 AGAGAGGATTTGAACCTGAGAGG + Intergenic
1093450844 12:19311728-19311750 TGAGGGGTTTAGAACTTCAGTGG - Intronic
1094691097 12:32770017-32770039 AGGGAGATTTAGCACTGCAGGGG - Intergenic
1096744334 12:53715677-53715699 AGAGGGGTTGAGAACCTTAGAGG - Intronic
1099162095 12:79254776-79254798 TGAGAGGTTCAGAACTTCAGTGG + Intronic
1099712515 12:86245194-86245216 AGGGAGTTGTAGAACCTTGGTGG - Intronic
1100409462 12:94300513-94300535 AGGGAGATGGAGAGCCTCAGAGG + Intronic
1110661813 13:78066106-78066128 AGGGAGGTCTGGACCCTGAGGGG + Intergenic
1113106131 13:106773384-106773406 AGTGAGGGTAAGAACTTCAGTGG - Intergenic
1113515681 13:110895616-110895638 AGGGAAGTTTAGATGCTCAAAGG + Intronic
1114930804 14:27465687-27465709 ATGGAGGTTTGGAATCTCAGTGG + Intergenic
1115507795 14:34109496-34109518 ATGGAGGTGTAGAACCACAAAGG + Intronic
1115710614 14:36046802-36046824 AGGGAGAATGAGAACCCCAGGGG - Intergenic
1117227674 14:53679887-53679909 AGGGAAGTTGAGAACCAGAGAGG - Intergenic
1118174678 14:63426348-63426370 AGAGAGGTTTATCAACTCAGTGG + Intronic
1118620258 14:67608542-67608564 AGGGAGGCTTAGGGCTTCAGTGG + Intergenic
1118810566 14:69270330-69270352 AGGGAGCCATCGAACCTCAGAGG - Intronic
1125802906 15:42466056-42466078 AGGGAACTTGAGAACCTCAAGGG - Intronic
1126739990 15:51768002-51768024 AGGCAGCTTCAGAAACTCAGAGG + Intronic
1127113755 15:55702949-55702971 AGATAGGTTTAGAATGTCAGGGG - Intronic
1127286556 15:57538524-57538546 AGGGAGGTCTTGAACCTGTGGGG + Intronic
1129090181 15:73141638-73141660 AGTGAGGTTTAAAACTTAAGTGG - Intronic
1137513316 16:49120335-49120357 AGTGAGGGCTAGAGCCTCAGAGG + Intergenic
1138049366 16:53760335-53760357 AGGAGGATTTTGAACCTCAGAGG - Intronic
1141237638 16:82233516-82233538 AGGGAGGTGGTCAACCTCAGGGG + Intergenic
1142535790 17:616940-616962 AGGGAGCTATAGGACCACAGAGG - Intronic
1144020348 17:11235505-11235527 AGGGTGCTCTAGAACTTCAGAGG + Intergenic
1144682133 17:17203254-17203276 AGGGACGCTGAGAACCACAGAGG + Intronic
1144945647 17:18968274-18968296 TGGTAGGTTTAGGAACTCAGGGG + Intronic
1148091485 17:45024888-45024910 AGGGAGGCTTGGAAGCTCACTGG + Intronic
1150424851 17:65069062-65069084 AGGATGCTGTAGAACCTCAGAGG - Intergenic
1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG + Intronic
1162385433 19:10357987-10358009 AGGGAGGGTGAGTACCTGAGGGG - Exonic
1164127952 19:22335636-22335658 TGGGAGATTCAGAACCTCAACGG + Intergenic
1164530808 19:29046774-29046796 AGGGAGCTTTGGAGCTTCAGTGG + Intergenic
925045087 2:766906-766928 AGGGAGGTTCAGAACCTTCCAGG + Intergenic
927657218 2:24959405-24959427 ATGCAGGTCTGGAACCTCAGAGG - Intronic
927703658 2:25283851-25283873 AGGGAGGCTGAGAAACTCTGAGG - Intronic
930010640 2:46935702-46935724 AGGAAGCTTAAGAGCCTCAGAGG - Intronic
930746616 2:54890466-54890488 AGGTAGGTTTATAACCTAAGGGG - Intronic
941094887 2:161227878-161227900 ATGGACTTTAAGAACCTCAGAGG + Intronic
941641493 2:167993611-167993633 AGGGTTGTTTAGCATCTCAGTGG - Intronic
944483739 2:200182150-200182172 AGGGAGGCTTGGATCCACAGTGG - Intergenic
946220117 2:218218206-218218228 AGAGAGCATTAGAACCTCAAAGG - Intronic
946274802 2:218623075-218623097 TGAGAGGTCTAGCACCTCAGAGG - Intronic
946497228 2:220206599-220206621 AGGGAAATTTACAACCCCAGTGG + Intergenic
946498307 2:220218622-220218644 AGGAAGGTTCAGAAGGTCAGAGG + Intergenic
1168737809 20:158554-158576 AGGGAGGCCTAAAACCTCACAGG + Intronic
1169499073 20:6141842-6141864 AGTGAGGTTTAGAAGAGCAGAGG - Intergenic
1169767767 20:9166608-9166630 AGGCAGGTGGAGAACTTCAGAGG - Intronic
1170135954 20:13073934-13073956 AGGGAGGTGTGGCACCTGAGTGG + Intronic
1172206415 20:33165924-33165946 GGGGAGGTTGGGATCCTCAGAGG - Intronic
1175492793 20:59390306-59390328 AGGGAGGTTTAGATCCTGCTGGG + Intergenic
1179305169 21:40147121-40147143 AGGGAGGCTTAAAGCCTCACCGG - Intronic
1180750184 22:18119151-18119173 AGGGAGGTGTGGAAGCTGAGGGG - Intronic
1180869400 22:19137868-19137890 AGGGAGGCCCAGCACCTCAGTGG - Intronic
950240918 3:11369302-11369324 AGAGAGGTTTAGAACCAGAGGGG - Intronic
952002190 3:28798864-28798886 AGGGAGTTATAGAAACTCATAGG + Intergenic
953401713 3:42628086-42628108 ATGTAGGTTGAGAACCCCAGAGG + Intronic
957914555 3:86671536-86671558 AGAGTGGTCTGGAACCTCAGTGG + Intergenic
958027521 3:88066178-88066200 ACTGAAGTTTAGAACCTCATTGG - Intronic
959033564 3:101333240-101333262 AGGGAGGTTTTAAAACTCAATGG + Intronic
959510238 3:107202630-107202652 AGGGAAGTTGAGAACTTTAGTGG + Intergenic
966216881 3:177513021-177513043 TGGGAAGTTCAGAACCTGAGTGG + Intergenic
966491352 3:180531596-180531618 AGGGAGGCTCAGATCCACAGTGG - Intergenic
969392698 4:6901811-6901833 GGGGAGGCTTAGAACATCTGTGG + Intergenic
969750856 4:9109573-9109595 AGGGTGGTTTTGATCCACAGAGG + Intergenic
969938426 4:10706257-10706279 CGGGAGGTTTAGGAGTTCAGAGG - Intergenic
973633774 4:52843288-52843310 AGAGAGGTTTGGAAACTCTGGGG + Intergenic
974549500 4:63352618-63352640 AGGAAAATTTAGAACTTCAGTGG - Intergenic
976017084 4:80569263-80569285 AGGGAGGAATAAAATCTCAGAGG + Intronic
977601862 4:98941926-98941948 AGGGAGTTCAAGAACCTGAGAGG - Intergenic
978075863 4:104528814-104528836 AGGGAGGGTAAGAACACCAGAGG + Intergenic
983560863 4:169100191-169100213 GGGGAAGTTCTGAACCTCAGGGG + Intronic
985841459 5:2308858-2308880 ACGGAGTTTTAAAACCTCATAGG - Intergenic
987175948 5:15309727-15309749 AGGGAGACTGAGAAACTCAGGGG - Intergenic
988738321 5:34044808-34044830 AGGAAGGTTTAGATGCTCAAGGG - Intronic
991413033 5:66364006-66364028 GGAGGGGTTCAGAACCTCAGTGG - Intergenic
993354642 5:86890896-86890918 AGGCAAGTTTAGAGTCTCAGGGG - Intergenic
993770116 5:91916317-91916339 AAGGAGGTGTAGAAGCTGAGGGG + Intergenic
994738982 5:103594753-103594775 AGTGAGGTCTAGGAGCTCAGTGG - Intergenic
997829161 5:137134096-137134118 GGGGAAGATTAGAACCACAGTGG - Intronic
1001713283 5:173794797-173794819 AGGGAGGTTTTGAAGGTCAAAGG + Intergenic
1002941522 6:1720780-1720802 GGGGAGGATTAGAGCCTTAGAGG + Intronic
1004029197 6:11849490-11849512 AGGGTGCTGTAGAAACTCAGAGG - Intergenic
1004408629 6:15359646-15359668 AGGGTTGATTATAACCTCAGCGG + Intronic
1005689992 6:28295111-28295133 TGAGAGGTTTAGGACTTCAGTGG + Intronic
1007634065 6:43287534-43287556 AGGGAGGTTTGGAATCCCAAGGG - Exonic
1010523773 6:76875751-76875773 AGGGAAGTTTAGAGCTTCATGGG - Intergenic
1010883911 6:81214717-81214739 AGGGAGGCTTGGATCCACAGGGG - Intergenic
1014026404 6:116651661-116651683 AGGAAGGTTTTGATCCTCAGGGG - Exonic
1016858171 6:148692919-148692941 AGGAGGGTATAGAACCTCAGAGG - Intergenic
1026230219 7:68476422-68476444 GGGGAGGTTTAGAAACTGAATGG - Intergenic
1027512262 7:79097549-79097571 AGGCAGAGATAGAACCTCAGGGG + Intronic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1030267818 7:107638496-107638518 AGGGAGATTCAAAACCTGAGAGG - Intergenic
1031773645 7:125879069-125879091 AGGGAGCTTTAAAATGTCAGTGG - Intergenic
1032068511 7:128790627-128790649 AGGGAGATTTGGAAGCCCAGGGG - Intergenic
1033176270 7:139126723-139126745 AGGGAGATTCAAAACCTGAGAGG - Intergenic
1034731772 7:153393120-153393142 AGGGAGATTTTGAACCCCAAAGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035009513 7:155701583-155701605 AGTGAGCGTTAGAATCTCAGAGG + Intronic
1036158126 8:6361407-6361429 AGGGAGGCTGCGAACCCCAGAGG + Intergenic
1038219430 8:25593434-25593456 AGGGAGGGAAAGAACCGCAGTGG - Intergenic
1044400762 8:91768960-91768982 AAGGAGTTCTAGAACTTCAGTGG - Intergenic
1047536350 8:125723637-125723659 ACCCAGGTTTTGAACCTCAGAGG + Intergenic
1048783858 8:138029885-138029907 AAGCAACTTTAGAACCTCAGGGG - Intergenic
1048879311 8:138859697-138859719 TGGGAGGTGCAGCACCTCAGTGG - Intronic
1050760595 9:9065336-9065358 AGGGAGATCTACAACATCAGTGG + Intronic
1056069128 9:82967688-82967710 AGGGAGGTGGGGAACCACAGTGG - Intergenic
1057861670 9:98645599-98645621 AGGGACATTCAGAACCTTAGGGG - Intronic
1061675118 9:132211226-132211248 AGGGATGGTTAGAAGCCCAGAGG - Intronic
1061791474 9:133061418-133061440 AGGGAGGACTAGAGGCTCAGGGG - Intergenic
1061795148 9:133081985-133082007 AGGGAGGACTAGAGGCTCAGGGG - Intronic
1187209247 X:17212578-17212600 AGGGAGGTCTAAAATCTCAGAGG - Intergenic
1194673727 X:96768368-96768390 AGAGAGGTTTACAAGCTCACAGG - Intronic
1199093493 X:143716185-143716207 AAGGAAGTTTAAAACCTGAGTGG - Intronic