ID: 1161170907

View in Genome Browser
Species Human (GRCh38)
Location 19:2812096-2812118
Sequence CCGATCACGCAGATCCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161170907_1161170914 13 Left 1161170907 19:2812096-2812118 CCTTCCGGGATCTGCGTGATCGG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1161170914 19:2812132-2812154 GGCTGAGACAGACCCTTCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 193
1161170907_1161170911 -8 Left 1161170907 19:2812096-2812118 CCTTCCGGGATCTGCGTGATCGG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1161170911 19:2812111-2812133 GTGATCGGCCTCAGAGCCATGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1161170907_1161170915 19 Left 1161170907 19:2812096-2812118 CCTTCCGGGATCTGCGTGATCGG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1161170915 19:2812138-2812160 GACAGACCCTTCTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 233
1161170907_1161170916 24 Left 1161170907 19:2812096-2812118 CCTTCCGGGATCTGCGTGATCGG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1161170916 19:2812143-2812165 ACCCTTCTCTGGAGAAGGCTTGG 0: 1
1: 0
2: 4
3: 16
4: 207
1161170907_1161170910 -9 Left 1161170907 19:2812096-2812118 CCTTCCGGGATCTGCGTGATCGG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1161170910 19:2812110-2812132 CGTGATCGGCCTCAGAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161170907 Original CRISPR CCGATCACGCAGATCCCGGA AGG (reversed) Intronic
904484368 1:30815034-30815056 CCGATCACGCAGAGCCTCGTGGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
1073421499 10:103427364-103427386 CCGAACACTCAGCTCCGGGATGG - Exonic
1085294711 11:75424624-75424646 CCTATCACTCAGCTCCAGGAGGG + Intronic
1112416263 13:99205824-99205846 CCGAGCACGCAGCTTCGGGAGGG - Intronic
1117583042 14:57172140-57172162 CCGATCTTGCAGATCTTGGATGG - Intergenic
1131838056 15:96409786-96409808 CCGATCCCGCAGATCCCGTCTGG - Intergenic
1141973414 16:87497383-87497405 CCCATCACGCAGATACTGAATGG + Intergenic
1161170907 19:2812096-2812118 CCGATCACGCAGATCCCGGAAGG - Intronic
1161998836 19:7730756-7730778 GCGCTCACGCAGTTCCCGCAGGG + Exonic
1162007335 19:7788877-7788899 GCGCTCACGCAGTTCCCGCAGGG - Intergenic
1179647809 21:42785880-42785902 CCGATCGCGCTGCTCCAGGAGGG - Intergenic
1179790908 21:43755503-43755525 CCCACCACGGAGAGCCCGGAGGG - Intronic
953512699 3:43558886-43558908 CAGATCACGCAGAACCCTGCAGG + Intronic
963209524 3:142673715-142673737 CCGAGCACGCAGCTTCGGGAAGG - Intronic
1018899600 6:168044447-168044469 CCCCTCACCCAGGTCCCGGAGGG - Intronic
1020074396 7:5248334-5248356 CTGATCACGCAGATCCGGGTGGG + Intergenic
1025667240 7:63591462-63591484 CTGATCACGCAGATCTGGGTGGG + Intergenic
1029572485 7:101379387-101379409 CCCATCAGGCAGAGCCAGGACGG - Intronic
1035566492 8:644631-644653 CCACTCACGCAGCTCCTGGAAGG - Intronic
1049519311 8:143080159-143080181 CCGGCCAGGCAGATCCAGGAAGG - Intergenic
1059745577 9:117197234-117197256 CCGAGCACGCAGCTTCAGGAGGG - Intronic
1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG + Intergenic
1191830233 X:65407691-65407713 CCGCGCACGCGGATCCCCGAGGG + Intronic
1192203407 X:69081332-69081354 CCGATCAAGCAGGTCCCAGGAGG - Intergenic