ID: 1161171636

View in Genome Browser
Species Human (GRCh38)
Location 19:2815196-2815218
Sequence CTGGGACTTCGCTGGGGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161171636_1161171643 1 Left 1161171636 19:2815196-2815218 CCTGGTCCCCAGCGAAGTCCCAG 0: 1
1: 0
2: 3
3: 31
4: 232
Right 1161171643 19:2815220-2815242 TGTGCAAGAGCACCCCAGCTGGG 0: 1
1: 0
2: 1
3: 106
4: 3331
1161171636_1161171644 7 Left 1161171636 19:2815196-2815218 CCTGGTCCCCAGCGAAGTCCCAG 0: 1
1: 0
2: 3
3: 31
4: 232
Right 1161171644 19:2815226-2815248 AGAGCACCCCAGCTGGGCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 330
1161171636_1161171642 0 Left 1161171636 19:2815196-2815218 CCTGGTCCCCAGCGAAGTCCCAG 0: 1
1: 0
2: 3
3: 31
4: 232
Right 1161171642 19:2815219-2815241 TTGTGCAAGAGCACCCCAGCTGG 0: 1
1: 0
2: 2
3: 32
4: 627
1161171636_1161171645 8 Left 1161171636 19:2815196-2815218 CCTGGTCCCCAGCGAAGTCCCAG 0: 1
1: 0
2: 3
3: 31
4: 232
Right 1161171645 19:2815227-2815249 GAGCACCCCAGCTGGGCCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161171636 Original CRISPR CTGGGACTTCGCTGGGGACC AGG (reversed) Exonic
900625045 1:3604142-3604164 CTCGGACTTGACTGGAGACCTGG - Intronic
901625673 1:10623574-10623596 CTGGGCCATCGCTGGGGCACTGG - Intronic
902627382 1:17684496-17684518 CTGGGCCTTCTCTGAGGGCCGGG + Intronic
903226313 1:21895866-21895888 CTGGGGCTTCCCTGGGGGACAGG + Intronic
903278971 1:22239363-22239385 CTGGGACTGGGCTGGTGGCCGGG - Intergenic
903886296 1:26542955-26542977 CTGGGCCTTCCCTGGGGTCATGG + Intronic
905199794 1:36307802-36307824 TTGGGAGGCCGCTGGGGACCAGG - Exonic
905519811 1:38589150-38589172 CTGGGACCTGGCTGGGAATCAGG + Intergenic
905971569 1:42145895-42145917 CTGGGAATTCACGGAGGACCCGG - Intergenic
906216956 1:44047543-44047565 CTGGAGCATTGCTGGGGACCCGG + Intergenic
907329843 1:53663702-53663724 CTGGCACTTCACTGGAGCCCGGG + Intronic
907460893 1:54604818-54604840 CTGGGGCTTGGATGGGCACCTGG + Intronic
912459988 1:109824076-109824098 CTGAGGCTTCGCTCGGGGCCTGG + Intergenic
912703109 1:111893338-111893360 CTAGGAGTTTGCTGGGAACCAGG + Intronic
916021554 1:160797009-160797031 CTGAGGTTTCACTGGGGACCTGG + Intronic
918221021 1:182436746-182436768 CTGGCACTCAGCTGGGGACAGGG - Intergenic
919972754 1:202591492-202591514 CTGGGGCTTCTCTGGGGAGCAGG + Exonic
922450263 1:225731715-225731737 CTGGGATTTCACTGAGGACATGG + Intergenic
922717801 1:227886296-227886318 CTGGGACTCCCCTGTGGCCCTGG + Intergenic
922776051 1:228214670-228214692 TTGGGGCTGCTCTGGGGACCTGG - Intronic
1062814379 10:488954-488976 CTGGGAGTGCGCTGAAGACCTGG + Intronic
1065124693 10:22562921-22562943 CAGGGAAATCGCTGGGGACGTGG + Intronic
1065124889 10:22564835-22564857 CAGGGAAATCGCTGGGGACCTGG - Intronic
1067078194 10:43199840-43199862 CTGAGCCATAGCTGGGGACCAGG - Intronic
1067566843 10:47345733-47345755 CTGGGGCTGCCCTGGAGACCTGG - Intergenic
1070243301 10:74705201-74705223 CTGGGCCTTCCCTGAGGCCCTGG - Intronic
1070701144 10:78602529-78602551 TTGGGACTTTTCTGGGGACATGG - Intergenic
1070787145 10:79168481-79168503 CAGGGACTGTGCTGGGGACATGG - Intronic
1070808854 10:79287174-79287196 CAGGGAGGTCACTGGGGACCCGG - Intronic
1072460274 10:95612153-95612175 CTGGGACTTCGCTAGGGTACAGG - Intronic
1073030195 10:100519724-100519746 CAGAGATTGCGCTGGGGACCCGG - Intronic
1074082165 10:110176483-110176505 CTGGGACGTGGCTGGGGAGAGGG + Intergenic
1075697838 10:124449160-124449182 CTGGGACTGGGCTGGGGGCGGGG - Intronic
1076730599 10:132437045-132437067 CTGGGACTTCCCCTGGGGCCTGG - Intergenic
1077637822 11:3855569-3855591 CCCGGGCTTCGCTGGGGACCGGG + Intronic
1079406770 11:20154610-20154632 CTGAAGCTTCCCTGGGGACCAGG + Intergenic
1084608354 11:70185540-70185562 GTGGGACTTCGGTGGGGCTCAGG - Intronic
1084755647 11:71236962-71236984 GTGGGACTGCGCTGCGGGCCTGG + Intronic
1084892781 11:72244571-72244593 ATGGGACCTCGCTGGGGGCGGGG - Intronic
1087066449 11:94032192-94032214 CTGGAACATCACTGGGGAGCTGG - Intronic
1089300988 11:117498409-117498431 CAGGGAATTCCCTGGGTACCTGG + Intronic
1089743633 11:120602048-120602070 CTGGGACTGAGCTGGGGAGAGGG - Intronic
1090420712 11:126573158-126573180 CTGTGACTTGGCTGGGGGCAAGG - Intronic
1092274245 12:7047136-7047158 CAGGGACATCGCTGGAGCCCAGG + Intronic
1097446607 12:59679212-59679234 CTGAGCCATGGCTGGGGACCCGG - Intronic
1102497062 12:113327081-113327103 CTGTGGCTTTGCTGGGGCCCAGG + Intronic
1102531640 12:113551024-113551046 CTGGGACCTTGCTGGGGCCATGG + Intergenic
1105600228 13:21879991-21880013 CTGAGACATAGCTGGGGGCCTGG - Intergenic
1108302876 13:49097544-49097566 CTGGCACTTCCCAGGGGAACTGG - Intronic
1108592859 13:51926247-51926269 TCAGGACTTCCCTGGGGACCTGG + Intergenic
1110483632 13:76013242-76013264 ATGGTACTTCCCTGGGTACCAGG - Intergenic
1112771570 13:102799579-102799601 CTGGCCCTCCGCTGGGCACCTGG + Intronic
1113473163 13:110561294-110561316 CTGGGGCTCCGCCGGGGACGGGG - Intronic
1114494969 14:23126243-23126265 CTGGGCCTTGGCTTGGGACCAGG - Exonic
1116742775 14:48777333-48777355 CTGAGATTTCGCTGGGTACATGG - Intergenic
1117618540 14:57559918-57559940 CTGTGACTTTGCTGGGGCACAGG + Intergenic
1118980164 14:70709941-70709963 CTTGGACTTCGCTGCTGCCCTGG - Intergenic
1119848456 14:77847956-77847978 CTGGGGCTCAGCTGGGGACCAGG + Intronic
1120134302 14:80847854-80847876 CAGGTACTGCGCTGGGGACTAGG - Intronic
1121315990 14:92961285-92961307 CAGGGGCTTCGCTGGGGCCAGGG - Intronic
1121370016 14:93347782-93347804 CTGGAACTTCGATGTGGCCCAGG - Intronic
1122211306 14:100175770-100175792 TTGGGCCTGGGCTGGGGACCTGG - Intergenic
1122469230 14:101955058-101955080 CTGGGACTTTGCTGGGCCTCAGG - Intergenic
1122900752 14:104781428-104781450 CTGGGACTTCCCTGTGCACCAGG - Intronic
1123092710 14:105748905-105748927 ATGGGGCCTCCCTGGGGACCGGG + Intergenic
1123172906 14:106390929-106390951 CTGGGGCATCTGTGGGGACCTGG - Intergenic
1124261143 15:28192742-28192764 CAGGGACTTTGCTTGGAACCTGG - Intronic
1124641373 15:31398530-31398552 CTGGGAGTACCCTGGGGGCCAGG - Intronic
1125386965 15:39147973-39147995 CAGGGACCTCGCTGGGCCCCTGG + Intergenic
1128063059 15:64747411-64747433 CTGGGACCTGGCTGGGGAGCAGG - Intronic
1128334610 15:66777950-66777972 CTGGGGCTAGGCTGGGGACATGG + Intronic
1129824735 15:78627275-78627297 CTGGGAATCTCCTGGGGACCTGG + Intronic
1129876601 15:78979478-78979500 CTGGGAGATCCCTGGGGTCCCGG - Intronic
1131059381 15:89395271-89395293 CTGGGACTTGGCAGGGGACCTGG + Intergenic
1132414845 15:101612748-101612770 CTGGGGCTTGGCTGAGGCCCTGG + Intergenic
1132618141 16:852413-852435 CTGTGACTTCCCAGGGGACCTGG - Intergenic
1132647689 16:1006711-1006733 CTGGAGCTGCGCAGGGGACCTGG + Intergenic
1133421801 16:5652837-5652859 CTGGCAGTTAGCTGGTGACCTGG - Intergenic
1134123427 16:11600451-11600473 GTGGGGTTGCGCTGGGGACCCGG - Intronic
1135184361 16:20302181-20302203 CTGTGACTTCGCTGTTGACAAGG - Intergenic
1136230454 16:28882754-28882776 CTGAGACTCCGCTGGGGAGGGGG - Intronic
1136548944 16:30971595-30971617 CTGGGACTTCTCTGGGGGGCGGG - Exonic
1138087964 16:54151103-54151125 CTGCTGCTTTGCTGGGGACCTGG + Intergenic
1138273067 16:55710005-55710027 CTGGGCCTTCTCTGGGGACAGGG - Intergenic
1138359386 16:56414547-56414569 CTGTGACTTAGCTGGTGAGCTGG - Intronic
1138993164 16:62417270-62417292 CTGAGACTTTGCTGGGGTCAGGG + Intergenic
1139210219 16:65069868-65069890 ATAGGACTGTGCTGGGGACCAGG + Intronic
1141598219 16:85110255-85110277 GAGGGGCTTCGCTGAGGACCTGG - Exonic
1141669981 16:85486626-85486648 GTGGGACGAGGCTGGGGACCAGG - Intergenic
1142155075 16:88529248-88529270 CTGGGGCTTCCCAGGGGAACAGG + Intronic
1142468338 17:148309-148331 CTGGGCCTCCGCCGGGGGCCAGG + Intronic
1142866859 17:2796488-2796510 TTGGGACATCGCTGGGACCCCGG + Exonic
1143028249 17:3953419-3953441 CAGGGACTTCCCTGGGAACGGGG + Exonic
1143551291 17:7631904-7631926 CTGGGCCTTCTCTTTGGACCTGG + Exonic
1144639563 17:16930124-16930146 CTGGCCCTTAGCTGGGGACTTGG + Intronic
1145784057 17:27582745-27582767 CTGGGAGCTCCCTGGGGGCCAGG - Exonic
1147443725 17:40462502-40462524 CTGGGGCTGGGCTGGGGCCCAGG + Intergenic
1147563245 17:41521627-41521649 CTGGCATTTCCCTGGGGAACAGG - Exonic
1147994406 17:44353271-44353293 CTGGGACAGCTCTGGGGACTAGG - Exonic
1148157566 17:45432480-45432502 CTGGGTCGGCGCTGGGGGCCTGG + Intronic
1149431299 17:56596839-56596861 TTGAGACTGCGCTGGGGACCAGG - Intergenic
1151554058 17:74837724-74837746 GTGGGAGGTGGCTGGGGACCTGG - Exonic
1151805922 17:76405359-76405381 CTGGGTCTCCCCTGGTGACCAGG - Intronic
1152130388 17:78472677-78472699 CGGGGACTCGGCTGGGGTCCAGG - Intronic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1157519652 18:48336804-48336826 CTTGGACTTGGCTGGGGACCTGG - Intronic
1161171636 19:2815196-2815218 CTGGGACTTCGCTGGGGACCAGG - Exonic
1161373960 19:3929363-3929385 CTGGGGCCTTCCTGGGGACCAGG + Intergenic
1162321420 19:9973114-9973136 CTGGGACTTTTCTGGGGTCAGGG + Intronic
1163146226 19:15380472-15380494 CGGGGACTAAGCTGGGGACAGGG + Intronic
1163221183 19:15922327-15922349 GTGGGACTACGGTGGGGACAGGG - Intronic
1163282636 19:16326503-16326525 TTGGGACTCCTCTGGGGACAAGG + Intronic
1164137783 19:22428768-22428790 CTGGCAGGTGGCTGGGGACCGGG + Intronic
1164654218 19:29909140-29909162 CTGGGCCTTTGCTGAGGGCCTGG - Intergenic
1164918625 19:32071961-32071983 AGGTGACTTCGCTGGGGCCCTGG + Intergenic
1165124340 19:33583285-33583307 CTGGGAATTCCCTTGGCACCCGG + Intergenic
1165128914 19:33620458-33620480 CTGGGGCTGCGCTGGGACCCAGG - Intergenic
1166359491 19:42247175-42247197 CCTGGTCTTCACTGGGGACCTGG + Intronic
1167584432 19:50365613-50365635 TGGAGACATCGCTGGGGACCTGG + Exonic
1167785222 19:51630347-51630369 CTGGGACTGGGCTGGGGCCCTGG - Intronic
1167787321 19:51646771-51646793 CTGGGACTGGGCTGGGGCCCTGG - Exonic
925519461 2:4725876-4725898 CAGAGACTTCGCTGGAGAACAGG - Intergenic
927888142 2:26730922-26730944 CTGGGTCTTTCCTAGGGACCTGG + Exonic
930518284 2:52433904-52433926 CTAGAGCTTCTCTGGGGACCGGG - Intergenic
931119058 2:59196337-59196359 CTGTCACTTCCCTGGGCACCTGG - Intergenic
931432390 2:62218568-62218590 GTGGGACTTCACTGTTGACCTGG + Intronic
931698635 2:64890833-64890855 CAAGAACTTCTCTGGGGACCGGG + Intergenic
932589867 2:73058938-73058960 CTGGGAGAGGGCTGGGGACCAGG - Intronic
935384606 2:102487288-102487310 CTTGGACTTGGCTGGGGAGGTGG + Intronic
937241749 2:120466382-120466404 CGGGGGCGTGGCTGGGGACCTGG + Intergenic
937312512 2:120910801-120910823 CTCTGACTTCGCTGGGTACCTGG + Intronic
937849900 2:126622718-126622740 CTGGGCCTTGGCTGGGTACCTGG - Intergenic
937891076 2:126939469-126939491 CTGGGACTTAGTCTGGGACCAGG + Intergenic
937988493 2:127649440-127649462 CTGGGGCTCCTCTGGGCACCTGG - Intronic
938210044 2:129459560-129459582 CAGTGCCTTCCCTGGGGACCTGG + Intergenic
938639596 2:133265792-133265814 CTCTGACCTCGCTGGGGAGCAGG + Intronic
943535745 2:189147815-189147837 TTGGGACTTTGCTGGGGCCCTGG - Intronic
944271039 2:197785674-197785696 CTCGGACTTCGCTGGGTGCCTGG + Intronic
944643934 2:201758835-201758857 CAGGCACTTCGCTAGGTACCAGG - Intronic
947720178 2:232365372-232365394 CGGGGACTGTGCTGGGGTCCAGG + Intergenic
947732798 2:232440359-232440381 CTGGGACTGTGCTGGGGTCCAGG + Intergenic
948811407 2:240480309-240480331 CTGGGACCTGGCTGGGTTCCCGG - Intronic
1170646633 20:18202757-18202779 GTGAGACTTTGCTGGGGACTGGG + Intergenic
1172191878 20:33066820-33066842 GTGGGACATCGCTGGGAACCTGG - Exonic
1172614818 20:36276012-36276034 CCGGGATTTCCCTGGGAACCGGG + Intergenic
1173327108 20:42044076-42044098 CTGTGACTTCCTTGAGGACCAGG - Intergenic
1173370547 20:42430656-42430678 CTGGGAGATGACTGGGGACCAGG + Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1175801754 20:61805002-61805024 CTGGGGCTTCTGTGGAGACCGGG - Intronic
1175816683 20:61886733-61886755 CTGGGACTTCCCTGAGGTCAGGG - Intronic
1176143459 20:63555064-63555086 GTGGGCCCTCGCTGTGGACCCGG - Exonic
1178273963 21:31219229-31219251 CTGGGACTTTGCTTGCCACCTGG - Intronic
1178963306 21:37089077-37089099 ATGGTTCTACGCTGGGGACCAGG + Intronic
1179586136 21:42375290-42375312 CTGGAACCTCGCTGGGAGCCAGG - Intronic
1180060223 21:45381248-45381270 CTGGGAGTGCGCTGGGGAAGAGG + Intergenic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1180787159 22:18553523-18553545 CTGGGCCTTTGGTGGGGTCCTGG - Intergenic
1181234581 22:21441783-21441805 CTGGGCCTTTGGTGGGGTCCTGG + Intronic
1181244068 22:21493048-21493070 CTGGGCCTTTGGTGGGGTCCTGG - Intergenic
1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG + Exonic
1181634789 22:24169532-24169554 CTGGCCCTTAGCTGGGGACCAGG - Intronic
1181947155 22:26527346-26527368 CTGGGCCCTCGCTGTGGACTTGG - Intronic
1181974302 22:26717877-26717899 CTGGGACATAGGTGGGGAACAGG + Intergenic
1182238629 22:28896648-28896670 CTGGAATATCGCTGGGTACCTGG + Intronic
1182322899 22:29489889-29489911 CTTGGCCTTCTCTGGGGACTTGG - Exonic
1183254102 22:36749885-36749907 CTGGGACCTCGCTAAGGACAGGG - Intergenic
1183272665 22:36871811-36871833 CTGGGACAGTGCTGGGCACCAGG + Intronic
1183441858 22:37827518-37827540 CTGGGGCAGCCCTGGGGACCTGG + Intergenic
1185179057 22:49348913-49348935 CTGTGAGGTCGGTGGGGACCAGG - Intergenic
950340434 3:12239491-12239513 CTGAGATTTCCCTGGGGACTTGG - Intergenic
950529657 3:13545962-13545984 CTGGGTCTTCGTTGGGCAGCAGG + Intergenic
954643203 3:52114626-52114648 CAAGGACTTGGCTGGGGCCCAGG + Intronic
961167091 3:124770823-124770845 CTGAGACCTGGCTGGGGGCCAGG + Intronic
961291221 3:125848413-125848435 CTGGGGCTTTGATGGGCACCGGG - Intergenic
961724355 3:128916352-128916374 CTGGGACTTAGCTGTGGTGCAGG + Intronic
961740769 3:129031988-129032010 GTGGGACTCCCCTGGGGACGGGG + Intronic
963107735 3:141660690-141660712 CTGGGACTCCGAGGTGGACCAGG + Intergenic
968046987 3:195630099-195630121 CTGCGGCTTCCCTGGGGACGGGG - Intergenic
968307666 3:197659945-197659967 CTGCGGCTTCCCTGGGGACGGGG + Intergenic
968979885 4:3841527-3841549 CTGAGACTCAGCTGGCGACCTGG + Intergenic
969253812 4:5989369-5989391 CAGGAACTTCGCTGGTGCCCAGG + Exonic
969528633 4:7717300-7717322 CTGGGGCATCCCTGGGGACCTGG - Intronic
971213916 4:24646128-24646150 ATAGGACCTCTCTGGGGACCAGG + Intergenic
974472062 4:62331433-62331455 CCTGGGCTTCCCTGGGGACCAGG - Intergenic
980680700 4:136155773-136155795 GTGGGGTTTTGCTGGGGACCAGG + Intergenic
980730967 4:136823947-136823969 GCGGGGCTTCACTGGGGACCCGG + Intergenic
984706801 4:182853141-182853163 CTGGGATTTTGGTGGGGAGCAGG - Intergenic
985416619 4:189742001-189742023 CCTGGGCTTCGCTGGGGACTGGG - Intergenic
985475078 5:74286-74308 CAGGGTCTTTGCTGGGGAACTGG + Intergenic
985511187 5:315068-315090 CTGGGACCTCCCAGGGTACCGGG + Intronic
985744630 5:1639045-1639067 CTGTGGCTTCCCTGGGGACGGGG + Intergenic
986270422 5:6225404-6225426 CTGGGACTTCTCTCGGGAGGTGG + Intergenic
990636188 5:57730410-57730432 CTGTGACTTTGTTGGGGACAGGG - Intergenic
998372393 5:141670379-141670401 CTGGGAATGGGCTGGGGTCCTGG - Intronic
999945621 5:156592177-156592199 CTTGGACTTCTCTGTGGACCTGG - Intronic
1002132899 5:177092309-177092331 CGGGGACCGCTCTGGGGACCGGG - Exonic
1002569048 5:180129713-180129735 GTGCGCCATCGCTGGGGACCAGG + Intronic
1002664055 5:180810108-180810130 CTGGGCCAGCGCTGGGGATCGGG - Intronic
1002925908 6:1605461-1605483 CTCTGAGTCCGCTGGGGACCTGG + Intergenic
1005496456 6:26392292-26392314 CTGAGACTTCTCTGGGGACCAGG + Intronic
1005505757 6:26467865-26467887 CTGAGACCTCTCTGGGGATCAGG + Intronic
1006788961 6:36686369-36686391 CTAGGGCTGAGCTGGGGACCTGG + Exonic
1006905678 6:37531882-37531904 GTGGGGCTCAGCTGGGGACCAGG + Intergenic
1007116297 6:39345545-39345567 CAGGGAATTCCCAGGGGACCAGG + Intronic
1008137999 6:47799636-47799658 TTGGGTCTTGGCTGGGGCCCTGG + Intronic
1008508918 6:52258119-52258141 CTGGGAGTGCTCTGGGGAGCTGG - Intergenic
1010345283 6:74803380-74803402 CTGGGACTTCCCGGGGGTCTTGG + Intergenic
1012965520 6:105669159-105669181 CTGGGCTCTAGCTGGGGACCAGG - Intergenic
1013010609 6:106116619-106116641 CTGGCACTTCACAGGGGAACTGG - Intergenic
1014045250 6:116877215-116877237 CTGGGGCTCCGCTGGGGAACCGG + Intronic
1016776066 6:147905980-147906002 CTGAGATCTCGCTGTGGACCAGG - Intergenic
1019517189 7:1445239-1445261 CTGGGCCTTCTGTGGGGAACAGG + Exonic
1019518715 7:1451060-1451082 CTGGGCCCTCGCTGAGCACCTGG - Intronic
1019606681 7:1913577-1913599 CTGGGACCTCGCAGGGGCTCTGG + Intronic
1019644065 7:2119836-2119858 CTGGCTCCTCGCTGGGGTCCAGG + Intronic
1020067418 7:5199485-5199507 CTGGGAACTCGCTGGGAACGTGG + Intronic
1021176719 7:17458502-17458524 CTGGGGCATCACTGGGGGCCTGG - Intergenic
1021490587 7:21216026-21216048 CTGGGACTTCCCTGTTGACCTGG - Intergenic
1022500709 7:30880887-30880909 CAGGAATTTCACTGGGGACCTGG + Intronic
1023243083 7:38170051-38170073 ATGGGACTGAGCTGGTGACCCGG - Intergenic
1023435068 7:40134274-40134296 CTGGGACCCCGCGGGGGACCTGG + Exonic
1023832091 7:44045169-44045191 CTGGGACTTCCCTGGAGAAGGGG + Intronic
1023856616 7:44188119-44188141 CTGGGACTTGGTTGGGGCCTCGG + Intronic
1028364150 7:90007431-90007453 CAGTGACTTTGCTGGGGACCAGG - Intergenic
1029692759 7:102193135-102193157 CTGGCACCTACCTGGGGACCAGG - Intronic
1030304060 7:108002243-108002265 CCGGCGCTTCGCTGGGGACGAGG + Intronic
1032091676 7:128914601-128914623 CTGGGACTCCACTGGGGCCCTGG - Intergenic
1032382651 7:131501062-131501084 CTGTGACTTTGCTGGGGAGGGGG + Intronic
1032658347 7:133955615-133955637 GTGGGGCTTCACCGGGGACCTGG + Intronic
1033887279 7:145964000-145964022 CTGGAACTTCTCTGGGGAAAGGG + Intergenic
1034272050 7:149808108-149808130 CGTGAACTTCGCAGGGGACCTGG + Intergenic
1034337099 7:150330762-150330784 CTGGGGCTTTGCAGGGGACTTGG - Exonic
1034443699 7:151101144-151101166 CTGGTGCTGGGCTGGGGACCCGG - Intronic
1034494337 7:151410703-151410725 CGCCGACTTCGCTGGGGACGGGG + Intronic
1034990247 7:155543378-155543400 CTTGGACTTGGATGGGGGCCAGG - Intergenic
1036635811 8:10548842-10548864 CAGGCACTGTGCTGGGGACCTGG + Intronic
1037956962 8:23067918-23067940 CTGGAACTGCGCTTGGGGCCAGG - Intronic
1039569388 8:38574963-38574985 CTGAGACTTTGCTGGGGCCGGGG + Intergenic
1039811056 8:41048774-41048796 CTTGGGCTTCTCTGGGGACTGGG - Intergenic
1042600344 8:70493417-70493439 CTGGGACTTGCCTGAGGGCCTGG - Intergenic
1045559959 8:103251842-103251864 TTGGGACTTCATAGGGGACCAGG - Intergenic
1047337673 8:123952208-123952230 CTGGGACTTCTCTGAGCTCCAGG - Intronic
1047690513 8:127348897-127348919 CTGGGTCTGGGGTGGGGACCAGG - Intergenic
1048461267 8:134623548-134623570 CTTGGTTTTGGCTGGGGACCAGG - Intronic
1048702288 8:137105527-137105549 CTGGGACTCCTCTGGGGAATTGG + Intergenic
1048833174 8:138496224-138496246 CTGTGGCTTGGCTGGGGACAGGG - Intronic
1049268781 8:141683350-141683372 CTAGGACTTTGCCGGGGACCTGG - Intergenic
1053070150 9:35096373-35096395 CTGGGCCTCCGCTGGGACCCAGG + Exonic
1053120820 9:35546575-35546597 CTGGGACTTGGCAGTGCACCAGG - Exonic
1056581103 9:87888478-87888500 CTGGGGCTTCAGTGGGGACGAGG + Exonic
1057851958 9:98572812-98572834 TTTGGACTTCTCTGAGGACCTGG - Intronic
1059330212 9:113530346-113530368 CTGGGGCTCAGCTGGGGAACTGG + Intronic
1061502585 9:131012563-131012585 CTGGGGCTGCGCTGGGCCCCCGG - Intronic
1061996418 9:134188476-134188498 CTGTGACCTCCCCGGGGACCTGG - Intergenic
1062722984 9:138054061-138054083 CTGGGAGTTCCCTTGGGACCAGG + Intronic
1186218690 X:7326525-7326547 TGGGGCCTTAGCTGGGGACCCGG - Intronic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1187826292 X:23335280-23335302 CTGGCTCTGCGCTGGGGTCCCGG + Intronic
1190315131 X:49145808-49145830 CAAGGGCTTCTCTGGGGACCAGG + Intergenic
1193618379 X:83718892-83718914 CTGGGGCTTCTCTGGGGGTCGGG - Intergenic
1193771454 X:85592893-85592915 CTTGGGCTTCCTTGGGGACCAGG - Intergenic
1194076533 X:89400699-89400721 CTGGGCTTGAGCTGGGGACCTGG + Intergenic
1195368639 X:104151214-104151236 CTGTGACTGTGCTGGGGACAGGG - Intronic
1196768825 X:119273232-119273254 CTGGGCCTTCGGTAGGGACTGGG - Intergenic
1197709100 X:129653628-129653650 CTGGGGCGTGGTTGGGGACCAGG + Intronic
1200035183 X:153322000-153322022 CTGTGAATACCCTGGGGACCTGG - Intergenic
1200429173 Y:3056219-3056241 CTGGGCTTGAGCTGGGGACCTGG + Intergenic