ID: 1161171893

View in Genome Browser
Species Human (GRCh38)
Location 19:2816268-2816290
Sequence TCAGCCGGTGTTGCTCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161171893_1161171905 18 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171905 19:2816309-2816331 GGACAGGGGCCTCACTCTCCAGG No data
1161171893_1161171906 19 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171906 19:2816310-2816332 GACAGGGGCCTCACTCTCCAGGG No data
1161171893_1161171903 4 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171903 19:2816295-2816317 CACAGCCTTGAAAGGGACAGGGG No data
1161171893_1161171899 -3 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171899 19:2816288-2816310 TGAAGGCCACAGCCTTGAAAGGG No data
1161171893_1161171902 3 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171902 19:2816294-2816316 CCACAGCCTTGAAAGGGACAGGG No data
1161171893_1161171900 2 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171900 19:2816293-2816315 GCCACAGCCTTGAAAGGGACAGG No data
1161171893_1161171898 -4 Left 1161171893 19:2816268-2816290 CCCCAATGAGCAACACCGGCTGA No data
Right 1161171898 19:2816287-2816309 CTGAAGGCCACAGCCTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161171893 Original CRISPR TCAGCCGGTGTTGCTCATTG GGG (reversed) Intergenic
No off target data available for this crispr