ID: 1161186765

View in Genome Browser
Species Human (GRCh38)
Location 19:2926598-2926620
Sequence CTGTGGGTGTGGGGGACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161186765_1161186776 6 Left 1161186765 19:2926598-2926620 CCCTCGGTCCCCCACACCCACAG No data
Right 1161186776 19:2926627-2926649 CCACACCCACCCTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161186765 Original CRISPR CTGTGGGTGTGGGGGACCGA GGG (reversed) Intergenic
No off target data available for this crispr