ID: 1161195213

View in Genome Browser
Species Human (GRCh38)
Location 19:2982835-2982857
Sequence CTCTGTCCAAAGCAACTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161195213_1161195217 -3 Left 1161195213 19:2982835-2982857 CCGGTCAGTTGCTTTGGACAGAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1161195217 19:2982855-2982877 GAGAGAGCCTGTGATGGGGCAGG 0: 1
1: 0
2: 4
3: 46
4: 477
1161195213_1161195215 -8 Left 1161195213 19:2982835-2982857 CCGGTCAGTTGCTTTGGACAGAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1161195215 19:2982850-2982872 GGACAGAGAGAGCCTGTGATGGG 0: 1
1: 0
2: 1
3: 36
4: 403
1161195213_1161195219 4 Left 1161195213 19:2982835-2982857 CCGGTCAGTTGCTTTGGACAGAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1161195219 19:2982862-2982884 CCTGTGATGGGGCAGGCACCCGG 0: 1
1: 0
2: 6
3: 50
4: 533
1161195213_1161195216 -7 Left 1161195213 19:2982835-2982857 CCGGTCAGTTGCTTTGGACAGAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1161195216 19:2982851-2982873 GACAGAGAGAGCCTGTGATGGGG 0: 1
1: 0
2: 0
3: 46
4: 469
1161195213_1161195214 -9 Left 1161195213 19:2982835-2982857 CCGGTCAGTTGCTTTGGACAGAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1161195214 19:2982849-2982871 TGGACAGAGAGAGCCTGTGATGG 0: 1
1: 1
2: 1
3: 42
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161195213 Original CRISPR CTCTGTCCAAAGCAACTGAC CGG (reversed) Intronic
901566838 1:10123684-10123706 CTCTGTCCAAAGCTGGTGATGGG - Intronic
903304157 1:22400999-22401021 CTCTGTCGAAAGCTGCTGATAGG + Intergenic
906186771 1:43868392-43868414 CTGTGTCAAAAGCCACAGACAGG - Intronic
908077031 1:60531360-60531382 CTCTTTCCTTATCAACTGACTGG - Intergenic
908860095 1:68474914-68474936 GTCTGTCCAAAGCAACAGAAAGG + Exonic
909166480 1:72232712-72232734 CTCTGCCCAAGGCAACAGAATGG - Intronic
911091489 1:94020927-94020949 CTATGTGCAAAGCAGCTGCCAGG - Intronic
911499846 1:98672381-98672403 CATTGTCCAAAGCAAGTAACTGG + Intronic
912611423 1:111049240-111049262 CACTGTCCAAAGCAATTTATAGG - Intergenic
912753265 1:112302970-112302992 CTCTTTCCAGAGCAACTCATGGG + Intergenic
914392477 1:147234919-147234941 CACTGTCCAAGGCAAATCACAGG + Intronic
914792994 1:150895771-150895793 CTCTGGCTAGAGCATCTGACTGG - Intergenic
915287030 1:154859586-154859608 CTCAGCTCAAAGCCACTGACAGG + Intronic
917599335 1:176558991-176559013 CTCTGTGCAGAGCATCAGACAGG - Intronic
917793213 1:178513111-178513133 CACTGTCCTAGGCAACTTACAGG - Exonic
918953377 1:191171576-191171598 CTCTGTCCAGAGCAACATATTGG - Intergenic
920684078 1:208095881-208095903 CTCTGTCCAAACAAAGTGTCAGG + Intronic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
922442147 1:225664719-225664741 CACTGTCCAAAGCAAGTCACAGG - Intergenic
923277790 1:232413928-232413950 CTCTGTCCAGAGCAACCCAGAGG - Intronic
1063096859 10:2915937-2915959 CTCTTTCCACAGGAACAGACAGG + Intergenic
1065961655 10:30738735-30738757 CTCTGTCCAAAGCCGTTGGCTGG - Intergenic
1074265069 10:111893626-111893648 CCCTATCCAAAGCAAGTGAAAGG - Intergenic
1075266271 10:121001759-121001781 CTCTTTCCCAAGCATTTGACAGG + Intergenic
1075866613 10:125727502-125727524 CTCTGACTAAAGCAACTGCCTGG + Intronic
1078707467 11:13759028-13759050 CTCAGTCCAAAACAACAGCCTGG + Intergenic
1079144100 11:17835312-17835334 CTCTGTGCCATGCAACTGCCTGG - Intronic
1081040110 11:38200083-38200105 CTCTGTGAAAAGAAACTGACTGG + Intergenic
1081380617 11:42410105-42410127 CTCTGTCAAAGGCACCTGAGAGG + Intergenic
1082278364 11:50245519-50245541 CTCCTTCCACAGCAACTGGCTGG - Intergenic
1083331021 11:61898428-61898450 CTCTGTCCAAAGCCACAGGAGGG - Intronic
1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG + Intronic
1085486383 11:76867165-76867187 CTCTGTTCAAAGTAGCTGAGAGG + Intronic
1095851301 12:46810139-46810161 CTCTCTCTAAAGCAACTAATGGG - Intronic
1098531706 12:71549128-71549150 CTGTGGACAAAGCAGCTGACAGG - Intronic
1101311814 12:103587435-103587457 CTCTGTGCCAAGCACCTGTCAGG - Exonic
1101799162 12:108005660-108005682 CTCTGTCCAGAGAAAGTGAGGGG + Intergenic
1101920274 12:108927010-108927032 CTCTCTCCAGAGCAAAGGACAGG + Intronic
1105880499 13:24601674-24601696 TACTGCCCAAAGCAATTGACAGG - Intergenic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1109226713 13:59705167-59705189 CTCACTCCAAAGAAACAGACCGG + Intronic
1111801892 13:92991367-92991389 CTCTGTAGAAAGCAACTGGGTGG + Intergenic
1112481312 13:99778062-99778084 ATCTCTCCAAGGTAACTGACAGG + Intronic
1113659071 13:112092203-112092225 ATCAGTCAAAAGAAACTGACTGG - Intergenic
1115251582 14:31354126-31354148 TTATGTCCAAAGCAACCTACAGG + Intronic
1115935664 14:38549158-38549180 GACTGTCAAAAGAAACTGACGGG - Intergenic
1116782868 14:49255475-49255497 TACTGTCCAAAGCAATTAACAGG + Intergenic
1118669688 14:68110313-68110335 CTGTGTCAAAAGGAACTGAAAGG + Intronic
1118785052 14:69038710-69038732 CTGATTCAAAAGCAACTGACTGG + Intergenic
1121362697 14:93276396-93276418 CTCTGTCAAGGGCAACTGAGTGG + Intronic
1122122515 14:99561993-99562015 CTCAGTGCAGAGCCACTGACTGG + Intronic
1122642510 14:103168401-103168423 CACTGTCCAAGTCAACTGAGTGG - Intergenic
1122881785 14:104693572-104693594 CTCTGCCCACAGCAGCTGAATGG - Intronic
1123123683 14:105929687-105929709 CTGGATCCAAAGCAAATGACAGG + Intronic
1128720063 15:69941596-69941618 CTGTGTCCAAAGCTACAGGCAGG + Intergenic
1129789229 15:78329649-78329671 CTCTGTCCGAAGCACTTGCCTGG + Intergenic
1134755298 16:16661832-16661854 GTCTGTCAACAGCAAATGACTGG + Intergenic
1134990767 16:18697338-18697360 GTCTGTCAACAGCAAATGACTGG - Intergenic
1135146557 16:19967653-19967675 CACTGGCCAAAGCAAGTCACAGG - Intergenic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1138183747 16:54961076-54961098 CTCTGTGCAAAGCAAGGGGCCGG - Intergenic
1138234005 16:55364884-55364906 CATTGGCCAAAGCAACTCACAGG - Intergenic
1139141754 16:64272578-64272600 CAATGTCCAAGGCATCTGACAGG + Intergenic
1140438805 16:74970708-74970730 CTGTGTACAAAGCAACTTGCTGG - Intronic
1140465816 16:75181492-75181514 CACTGTCCAAAGCAATCTACAGG + Intergenic
1141850687 16:86643539-86643561 TTCTGTCCAAAGGAAATCACTGG + Intergenic
1143255219 17:5552574-5552596 TTCTGACCAAAGCAACTCATGGG - Intronic
1144273113 17:13638840-13638862 ACTTGTCCAAGGCAACTGACAGG - Intergenic
1146906849 17:36623547-36623569 CTCTCTCCAAAGCACTTGAGGGG + Intergenic
1149518157 17:57296374-57296396 CTCTCTCCACAGCAACTAACTGG - Intronic
1151308212 17:73277435-73277457 CTCTGTAGAAAGCAGCTGATAGG + Intergenic
1153005451 18:494733-494755 CTCTGTCATAAGAAAATGACTGG + Intronic
1154345520 18:13540650-13540672 ATCTGTCCAAGGCAATTCACAGG + Intronic
1155854373 18:30814404-30814426 CTTTGACCAAAGCAAATGAAGGG - Intergenic
1156627706 18:38929523-38929545 CTTTGCCCAAAGCACCTAACTGG + Intergenic
1156788193 18:40940447-40940469 CTCTCCCTAGAGCAACTGACAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159371094 18:67528488-67528510 CTCTCTCAAGAACAACTGACTGG + Intergenic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1162138339 19:8569915-8569937 CTCTGTCCAAAAAAAATAACAGG - Intronic
1166759728 19:45217225-45217247 CACTGTCCAAAGCACTTAACAGG + Intronic
1168563767 19:57405451-57405473 ATCTGTCCTCTGCAACTGACAGG + Intronic
932572942 2:72947447-72947469 CTCTGTCCAGGGCAAATGTCCGG - Intronic
932640999 2:73446640-73446662 CTCTTTCCACTACAACTGACTGG - Intronic
932942733 2:76188065-76188087 GTCTGTCCAGAGCCACGGACTGG + Intergenic
933512550 2:83259466-83259488 TACTGCCCAAAGCAACTTACAGG + Intergenic
934947718 2:98554129-98554151 CACAGTGCAAAGCAACTGAAGGG - Intronic
935161541 2:100533576-100533598 CACTGGCCAGAGCAAGTGACAGG - Intergenic
935294154 2:101634145-101634167 CTCAAACAAAAGCAACTGACTGG + Intergenic
935819693 2:106882449-106882471 ATCTGTGCAAAGCAAATGGCAGG + Intronic
937268407 2:120631750-120631772 CCCTTTCCAGAGCAAGTGACAGG + Intergenic
937515815 2:122654222-122654244 TTCTGTACAAGGCAACTGAATGG + Intergenic
938094360 2:128451932-128451954 CTCAGTCCAAAGCAGCTGCTTGG + Intergenic
939780632 2:146442868-146442890 CACTGTGAAAAGCAACTGGCTGG + Intergenic
942264385 2:174206492-174206514 CTCTGCCCAAAATAGCTGACTGG - Intronic
944203157 2:197129971-197129993 CTATGTGCAAAGCAACTGCCAGG - Intronic
944500767 2:200357439-200357461 CTGTCTCCAAAGAAAGTGACAGG - Intronic
945473619 2:210255878-210255900 TTTTGTCAAATGCAACTGACAGG + Intergenic
948553899 2:238794452-238794474 AACTATCCAAAGCCACTGACAGG + Intergenic
948840822 2:240648059-240648081 CTCTGCCCCAAGCCACTGCCTGG - Intergenic
1169245563 20:4021857-4021879 CTCATCCCAAAGCAACAGACGGG + Intergenic
1171130805 20:22651656-22651678 CTCTGTCTAAGCCAACTTACAGG - Intergenic
1177537175 21:22443032-22443054 CTCTCTCCACAGCAAAGGACAGG - Intergenic
1178000749 21:28159544-28159566 TTCTGTCACAAGGAACTGACAGG - Intergenic
1179274350 21:39878184-39878206 CTCTGTATAAAGCAAGTGCCAGG + Intronic
1182117262 22:27763989-27764011 CTCCTTCCAAAGCAAGAGACTGG + Intronic
1182710294 22:32318477-32318499 CTCTGAGGAGAGCAACTGACAGG - Intergenic
1184307015 22:43611180-43611202 TGCTGTCCAAAGCAATTTACAGG - Intronic
950173180 3:10853228-10853250 ATCTGTCCAAGGCAGCTCACAGG - Intronic
951789521 3:26464706-26464728 CTGTGTAGAAAGCAATTGACTGG + Intergenic
952692463 3:36225996-36226018 CTCTGTTCAAAGCAACACATTGG + Intergenic
959133748 3:102391118-102391140 CTCTCTCCAAAGAAACTGGCAGG - Intronic
960235671 3:115279428-115279450 GTATGTCCAAAGGATCTGACAGG + Intergenic
963396980 3:144747456-144747478 CTCTGTCAAATGCAAGTGATAGG + Intergenic
967764401 3:193262357-193262379 TTCTGGCCAAAGGAACTGGCAGG + Intronic
969060244 4:4428267-4428289 CTGTCCCCAAAGAAACTGACAGG - Intronic
972374384 4:38456914-38456936 CTGTGTCCAATCCAACTCACAGG - Intergenic
974100618 4:57412003-57412025 TTCTATCCAAAGCTATTGACGGG - Intergenic
976202273 4:82591208-82591230 CTGTCTCCAAAGCCAGTGACTGG + Intergenic
976392703 4:84522218-84522240 TTCTGTACAAAGAATCTGACAGG + Intergenic
980490784 4:133525352-133525374 GTCTGTCCCAAGCAGGTGACAGG - Intergenic
982722409 4:158872083-158872105 CTCTGTCAGAAGCAGCTCACTGG - Intronic
983581202 4:169311718-169311740 TTGTGTCCACAGCAACTGGCAGG + Intergenic
986094490 5:4541144-4541166 GTCTGTCCCAAGCAACTTCCAGG - Intergenic
987157350 5:15103252-15103274 CACTGTCACTAGCAACTGACTGG - Intergenic
988268294 5:28980865-28980887 CACTGTCCAAAACCATTGACAGG - Intergenic
990586351 5:57215072-57215094 CTCTGTTCAAAGTATATGACTGG - Intronic
991437887 5:66615076-66615098 CTTTTTACAAAGCAACTGAGAGG - Intronic
998674461 5:144391360-144391382 CTCTGCCCAAAGGAATTGATCGG - Intronic
999564599 5:152843428-152843450 CTGTGTTCAATGCTACTGACAGG + Intergenic
1001885607 5:175287619-175287641 TTCTGACCAGAGCAACTGAGTGG + Intergenic
1001897759 5:175396288-175396310 GTCTGTCCCAAGCAACTGGATGG + Intergenic
1002176823 5:177405340-177405362 CTCTGTCCACAACACCTCACTGG - Exonic
1007736740 6:43986774-43986796 CTGTGTGCAAACCCACTGACAGG + Intergenic
1007747740 6:44053463-44053485 CTCTGTCCAAACCTACAGATCGG - Intergenic
1007749637 6:44064096-44064118 CTCTGTCCAAACCTACAGAGCGG + Intergenic
1010499741 6:76582840-76582862 CTCTGAACAAAGGAACTGAGAGG + Intergenic
1013424606 6:109999374-109999396 CTCTGTTCAGAGCAGTTGACTGG + Intergenic
1014372666 6:120631616-120631638 CTCAGTCCAATGGAACAGACTGG + Intergenic
1017777161 6:157689322-157689344 CTCTGTCCAAAGCCCCAGACAGG + Intergenic
1023201987 7:37708081-37708103 CTATATCCAAAGCATCTGAGAGG - Intronic
1028341720 7:89730505-89730527 ACCAGTCCAAAGCACCTGACAGG + Intergenic
1028733954 7:94185639-94185661 TACTATCCAAAGCAACTTACAGG - Intergenic
1030765398 7:113403024-113403046 CTCTGTTCTAACCAATTGACTGG + Intergenic
1032279443 7:130489335-130489357 ATCTGTCCAGAGGAACTGAAAGG + Intronic
1035102352 7:156411463-156411485 CGCTGTCCAAAGCCATGGACTGG + Intergenic
1035357942 7:158290177-158290199 CTCTGTCCAAAGGGGCTGGCTGG + Intronic
1037386722 8:18351475-18351497 CTCTCTCCATAGGAACTGCCAGG - Intergenic
1038928176 8:32163587-32163609 CTCTTTCCAAAGCTACTGGTGGG - Intronic
1039177861 8:34829563-34829585 CTCTGTCCAAGGGCAGTGACAGG + Intergenic
1039318797 8:36405173-36405195 CTTTGGCCAAAGCAACAGAGTGG + Intergenic
1039967603 8:42294524-42294546 CTCTGTCAAAAGCAGCAGTCAGG - Intronic
1041102720 8:54412704-54412726 CACTGTCCAAGCCCACTGACAGG + Intergenic
1041997465 8:64080999-64081021 CTCTCTGCAAAGCAACTCTCAGG - Intergenic
1042502262 8:69522361-69522383 TGCTGTCCCAAGCAACTGAAAGG + Intronic
1043947712 8:86273333-86273355 CTCTGTCTCAAGCAAATTACAGG + Intronic
1048188122 8:132263228-132263250 CTCTGTCCCTGGCAACTGCCTGG + Intronic
1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG + Intronic
1049142589 8:140969514-140969536 CTCTGTCAGCTGCAACTGACAGG + Intronic
1052589920 9:30478674-30478696 CTCAGTCCCCAGTAACTGACTGG - Intergenic
1054946632 9:70803243-70803265 CTGTGTCTAATGCTACTGACGGG - Intronic
1059809489 9:117839873-117839895 CTCTGTTAAAAGCCACTGGCAGG - Intergenic
1061779755 9:132988640-132988662 CCCTGTGCTAAGCAATTGACAGG + Intronic
1190159506 X:48021221-48021243 CTTTGTGCAAAGCTAGTGACGGG + Intronic
1192556323 X:72092458-72092480 CTCAGTGCAAAGCACCTCACGGG + Intergenic
1192890300 X:75383565-75383587 TTCTGACCAAATCAACTCACGGG + Intronic
1196303789 X:114076923-114076945 CTATGTCCAAAGAAAATGTCTGG + Intergenic
1198558993 X:137827860-137827882 CTATTTCCACAGCAACAGACTGG - Intergenic
1199758746 X:150889271-150889293 CTGTGTCCCAGGCCACTGACCGG + Intronic