ID: 1161196627

View in Genome Browser
Species Human (GRCh38)
Location 19:2990029-2990051
Sequence CAGTTTCCCCACCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1835
Summary {0: 1, 1: 1, 2: 20, 3: 224, 4: 1589}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161196622_1161196627 13 Left 1161196622 19:2989993-2990015 CCTTGCAGCCCAGGGCATTTTAC 0: 1
1: 0
2: 2
3: 22
4: 299
Right 1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG 0: 1
1: 1
2: 20
3: 224
4: 1589
1161196624_1161196627 4 Left 1161196624 19:2990002-2990024 CCAGGGCATTTTACTTTTTGTCT 0: 1
1: 0
2: 8
3: 62
4: 620
Right 1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG 0: 1
1: 1
2: 20
3: 224
4: 1589
1161196623_1161196627 5 Left 1161196623 19:2990001-2990023 CCCAGGGCATTTTACTTTTTGTC 0: 1
1: 0
2: 1
3: 28
4: 339
Right 1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG 0: 1
1: 1
2: 20
3: 224
4: 1589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161196627 Original CRISPR CAGTTTCCCCACCTGGACAC AGG Intronic
900150337 1:1176078-1176100 CAGTCTCTCCACCTGCACAGCGG - Intronic
900416793 1:2539051-2539073 CAGTTTCCTCATCTGTACAATGG - Intergenic
900465142 1:2821796-2821818 CAGTTTCTCCATCTGGGCAAGGG + Intergenic
900536307 1:3179408-3179430 CTGTTTCCCCAGCTGTACAGTGG + Intronic
900665328 1:3811220-3811242 CAGTTTCCTCACCTGTAAAATGG - Intergenic
900792343 1:4688899-4688921 CAGTTTCTCCACCTGTAGAAGGG - Intronic
900831943 1:4971761-4971783 CAGTTTCCCTCCCTGGAGAATGG - Intergenic
900918796 1:5657893-5657915 CAGTTTCCTCATCTGGAAGCTGG - Intergenic
901060831 1:6471233-6471255 CAGTTTCCTCATCAGGAAACAGG - Intronic
901148963 1:7087682-7087704 CAGTTTCCACACCTGTAAAGTGG + Intronic
901504380 1:9675442-9675464 CAGTTTCCCCATCTGTAAAGTGG - Intronic
901527288 1:9831644-9831666 CAGTTTCCTCACCTGTAAAATGG + Intergenic
901664871 1:10820340-10820362 CAGTTTCCCCATCTGTAAAATGG - Intergenic
901671999 1:10861584-10861606 CAGTTTCCCCAGCTTGAGTCTGG + Intergenic
901780690 1:11592763-11592785 CAGTTTCCCCATCTGTACAATGG + Intergenic
901794432 1:11672237-11672259 CAGCCTCCTCACCTGCACACTGG - Intronic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902103812 1:14016415-14016437 CAGTTTCCCCACCTGTGAAATGG - Intergenic
902179869 1:14679714-14679736 CAGTTTCCCTATCTGAACAATGG - Intronic
902197398 1:14807840-14807862 CTATTTCCCCACCCAGACACAGG + Intronic
902233390 1:15042599-15042621 CAGTTTCCCCATCTGTAACCAGG - Intronic
902276640 1:15344826-15344848 CAGTTTCCCTGCCTGTACAACGG - Intronic
902389518 1:16094957-16094979 CAGTTTATCCATCTGGACAATGG + Intergenic
902396642 1:16135531-16135553 CAGTTTCCCCATCTGCAGAAGGG + Intronic
902461947 1:16584411-16584433 CAGTTTCCTCACCTGTTCAGAGG - Intronic
902501571 1:16914581-16914603 CAGTTTCCCCATCCGCACAATGG - Intronic
902519931 1:17010504-17010526 CAGTTTCCCCAGGTGTACAATGG - Intronic
902557899 1:17257815-17257837 CAGTTTCCCCATGTGTAAACAGG + Intronic
902564706 1:17303774-17303796 CGGTTTCCTCACCTGGAAAACGG + Intergenic
902569066 1:17335344-17335366 CAGTTTCCTCACCTGTAAAATGG - Intronic
902617280 1:17630685-17630707 CAGTTTCCTCACCTGGGCAATGG + Intronic
902623473 1:17663754-17663776 CAGTTTCCCCATCTGTAAAATGG - Intronic
902653921 1:17854479-17854501 CAGTCTCCCCTCCTGGAGAAAGG - Intergenic
902661387 1:17906414-17906436 ATGTTTCACCACCTGGAAACTGG + Intergenic
902699809 1:18164145-18164167 CAGTTTCCTCATCTGTACAAGGG - Intronic
902744712 1:18465917-18465939 CAGTTTCCCCATCTGTAAAATGG - Intergenic
902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG + Intergenic
902790859 1:18766922-18766944 CAGTTTCCCCAACTAGAAAATGG - Intergenic
902805205 1:18857039-18857061 CAGTTTCCTCACCTGTAAAGTGG - Intronic
902806428 1:18863927-18863949 CAGTTTCCCTATCTGTATACTGG - Intronic
902812001 1:18893249-18893271 CAGTTTCCTCACCTGGAAAATGG + Intronic
902838989 1:19063566-19063588 CAGTTTCCTCACCTGGAGAGTGG + Intergenic
902882189 1:19379583-19379605 CAGGTTCTCCACGTGAACACAGG + Intronic
902893533 1:19462503-19462525 CAGTTTCCCCACCTGTATTGAGG - Intronic
902924738 1:19688708-19688730 CAGTTTTCACACCTGTACAACGG + Intronic
902932803 1:19743221-19743243 CAGTTTCCTCATCTGGAAAAGGG + Intronic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903027830 1:20442259-20442281 CAGTTTCCTTACCTGGAAAATGG - Intergenic
903158831 1:21469905-21469927 CAGTTTCCTCATCTGTACATAGG + Intronic
903177505 1:21589823-21589845 CAGTTTCCCCATCTGTACAATGG - Intergenic
903193098 1:21667773-21667795 CAGTTTCCTCACCTGTGCAATGG + Intronic
903193598 1:21669513-21669535 CAGTTTCCCCACCTGTAAAATGG - Intergenic
903216239 1:21844722-21844744 CAGTTTCCCCATCTGTAAAATGG + Intronic
903277273 1:22230212-22230234 CAGTTTCCTCACCTGTAAAATGG - Intergenic
903277877 1:22233182-22233204 CAGTTTCCCCACTTTGCTACTGG - Intergenic
903301980 1:22385722-22385744 CAGTTTCCCCATCTGTAAAATGG - Intergenic
903321408 1:22545540-22545562 CAGTTTCCCCGCCTGTGCAGTGG + Intergenic
903351218 1:22717561-22717583 CAGCTTCCTCATCTGGAAACTGG + Intronic
903360295 1:22772757-22772779 CAGTTTCCTCATCTGTACAGTGG + Intronic
903361123 1:22777950-22777972 CAGTTTCCTCACCTGGAAAATGG - Intronic
903376420 1:22869196-22869218 CAGTTTCCTCACCTGGCAAAGGG - Intronic
903471719 1:23592006-23592028 CGGTTTCCCCATCTGGAAAGGGG + Intronic
903474732 1:23611781-23611803 CAGTTTCCACAACTGGAAAATGG - Intronic
903480145 1:23647140-23647162 CAGTTTCCCCATCTGAAAATGGG + Intergenic
903481589 1:23657395-23657417 CTGTTTCCCCACCTGTAAAATGG + Intergenic
903655300 1:24945558-24945580 CAGTTTCCTCATCTGGAAAATGG - Intronic
903661572 1:24981809-24981831 CAGTTTTCCCACCTGGTAAATGG - Intergenic
903670050 1:25030121-25030143 CAGTTTCCCCATCTGCAAAGTGG + Intergenic
903670567 1:25033164-25033186 CAGTTTCCTCACCTGTAGAATGG - Intergenic
903675326 1:25061156-25061178 CAGTTTCCTCATCTGGAAAATGG + Intergenic
903747205 1:25595637-25595659 CAGTTTTCCCATCTAGAAACTGG - Intergenic
903786804 1:25866613-25866635 CAGTTTCCTTACCTGGAAAATGG - Intronic
903809636 1:26028300-26028322 CAGTTTCCCCATCTGTTCAATGG + Intronic
903883176 1:26525994-26526016 CAGTTTCCCCATCTGTACACTGG + Intergenic
904025108 1:27497705-27497727 CAGTTTCCTCATCTGCAAACTGG - Intergenic
904198060 1:28800804-28800826 CAGTTTCCCCACCTGTGAAATGG - Intergenic
904208349 1:28869572-28869594 CAGTTTCCCCATCTGTAAAATGG - Intergenic
904342257 1:29844331-29844353 CAGTTTCCTCATCTGTACAGTGG + Intergenic
904384977 1:30135167-30135189 CAGTTTCCCCATCTGTCCAATGG - Intergenic
904388138 1:30160519-30160541 CAGTTTTCTCACCTGAAAACGGG + Intergenic
904405484 1:30285660-30285682 CAGTTTCCTCACCTGTGCAATGG - Intergenic
904433238 1:30478709-30478731 CAGTTTCCTCATCTGTACAATGG + Intergenic
904489201 1:30847828-30847850 CAGTTTCCTCATCTGGAAAATGG - Intergenic
904489762 1:30851251-30851273 CAATTTCCCCATCTGTACAATGG - Intergenic
904533314 1:31182818-31182840 CAGTTTTCCCACTTGGACTTGGG + Intronic
904534064 1:31187691-31187713 CAGTTTCCTCATCTGGAAAATGG + Intronic
904539430 1:31222853-31222875 CAGTTTCCTCATCTGTACATGGG + Intronic
904565088 1:31424074-31424096 CATTATCGCCCCCTGGACACTGG + Intronic
904568173 1:31440962-31440984 CAGTTTCCCCATCTGCAGAATGG + Intergenic
904580310 1:31538488-31538510 CAGCTTGACCACCAGGACACCGG - Intergenic
904605421 1:31695405-31695427 CAGTTTCCCCATCTGAAAAATGG - Intronic
904812923 1:33175510-33175532 CAGTTTCCCCATCTGCAAAATGG + Intronic
904819251 1:33230179-33230201 CAGTTTCCTCACTTGTAAACTGG + Intergenic
904947737 1:34211991-34212013 CAGTTTCCCCATCTGCAAAATGG - Intronic
905035633 1:34916508-34916530 CAGTTTCCTCACCTGTAAAATGG - Intronic
905037332 1:34926727-34926749 CAGTCTCCCCACCTGTAAAATGG + Intronic
905241132 1:36582293-36582315 CAGTTTGCCCATCTGCACATTGG + Intergenic
905269878 1:36780915-36780937 CAGTTTCCCCAGCTGTAGAAGGG + Intergenic
905270918 1:36786902-36786924 CAGTTTCCTCATCTGGAAAATGG - Intergenic
905280773 1:36847694-36847716 CAGTTTCTCCACCTGAAAAAGGG - Intronic
905286047 1:36881035-36881057 CAGTTTCCTCATCTGAAAACAGG + Intronic
905304359 1:37007241-37007263 CAGTTTCCTCACCTGCAAAATGG - Intronic
905317892 1:37095214-37095236 CTGTTTCCTCACCTGTAAACTGG - Intergenic
905351300 1:37348301-37348323 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905371705 1:37485960-37485982 CAGTCTCCCCACCTGTAAAAGGG + Intergenic
905391020 1:37635212-37635234 CAGTTTCCCCATCAGGAACCTGG + Intergenic
905434534 1:37947453-37947475 CAGTTTCTCCACCTGGAAAATGG - Intergenic
905447582 1:38037085-38037107 CAGTTTCCTCACCTGTAGGCTGG + Intergenic
905462597 1:38131480-38131502 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905528980 1:38661504-38661526 CAGTTTCCTCACCTGTAAAATGG - Intergenic
905557208 1:38896366-38896388 CAGTTTCCCTACCTGCAAAATGG + Intronic
905581251 1:39084046-39084068 CAGTTTCTTCACCTGGAAAATGG - Intronic
905732827 1:40308017-40308039 CAGTTTCTTCACCTGTAAACAGG - Intronic
905901827 1:41586407-41586429 CAGTGTTGCCACCTGGACCCAGG + Intronic
905903444 1:41597543-41597565 CAGTTTCCTCACCTGTAAAATGG - Intronic
905905975 1:41618745-41618767 CAGTTTCCTCATCTGGAAAATGG - Intronic
905970732 1:42140399-42140421 CAGTTTCCTCACCTGTAAAATGG - Intergenic
906161302 1:43650760-43650782 CAGTTTCTCCACCTGTAAAATGG - Intronic
906245617 1:44271578-44271600 CAGTTTCCTCACCTGTACAATGG + Intronic
906304957 1:44711900-44711922 CAGTTTCCTCATCTGTAAACTGG - Intronic
906524029 1:46484098-46484120 CAGTTACCCCAGGTGTACACAGG + Intergenic
906550015 1:46657107-46657129 CAGTTTCCTCAACTGTAAACTGG + Intronic
906675776 1:47692891-47692913 CAGTTTCCCCATCTGTAAAATGG + Intergenic
906689636 1:47784119-47784141 CTGTTTCCTCATCTGGAAACTGG - Intronic
906932196 1:50181037-50181059 CAGTTTCCTCACCTGTATAAAGG - Intronic
907268752 1:53278085-53278107 CAGTTTCCCCATCTATAAACTGG - Intronic
907274967 1:53311851-53311873 CAGTGTCCCCATCTGTACAATGG + Intronic
907304448 1:53505981-53506003 CAGTTTGCCCACCTGTCCATGGG + Intergenic
907316236 1:53574518-53574540 CTGTTTCCTCACCTGTACAATGG - Intronic
907334406 1:53690922-53690944 CAGTTGCCCCAGCTGGAAAAAGG - Intronic
907336379 1:53702445-53702467 CAGCTTCCCTACCTGGAACCCGG - Intronic
907517970 1:55005292-55005314 CAGTTTCCTCATCTGTACAATGG - Intronic
907561917 1:55399018-55399040 CAGTTTCCTCATCTGGAAAATGG - Intergenic
907807399 1:57835359-57835381 CAGTTTCCTCATCTGAAAACAGG - Intronic
907837106 1:58120474-58120496 CAGTTTCCACACCTGTACATGGG + Intronic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
907989778 1:59568497-59568519 CAGTTTCCTCATCTAAACACTGG - Intronic
908027297 1:59966436-59966458 CAGTTTCCTCATCTGTAAACTGG - Intergenic
908128789 1:61054241-61054263 CTGTGTCCCCACCCGGACGCAGG + Intronic
908555537 1:65253917-65253939 CAGTTTCCTCATCTGGAAAATGG + Intronic
908577804 1:65479406-65479428 CGGTTTCCTCACCTGTACAAAGG - Intronic
908775855 1:67639312-67639334 CAGTTTCCCCATCTGTAAAATGG - Intergenic
910012582 1:82483515-82483537 CAGCTTCCTCACCTGGAAAACGG + Intergenic
910672578 1:89787948-89787970 CAATTTCCCCATCTGTACAATGG + Intronic
910837415 1:91529730-91529752 CAGTTTCCTCATCTGGAAATGGG + Intergenic
910966184 1:92810252-92810274 CAGTTTCCCTATCTGTACAATGG - Intergenic
911009341 1:93262761-93262783 CAGAGTCCCCACCGGGGCACTGG - Intronic
912510196 1:110184529-110184551 CAGTTTTCCCATCTGCACAGTGG - Intronic
912541492 1:110419733-110419755 CAGTTTCCACATCTGTACAAAGG - Intergenic
912547871 1:110464202-110464224 CAGTTTCCCCATCTGTACAATGG + Intergenic
912629132 1:111231401-111231423 CAGTTTTGCCACCTGGCCAAGGG - Intronic
912633544 1:111270511-111270533 CAGTTTCCTCGCCTGGAAAGTGG - Intergenic
912838111 1:113014708-113014730 CAGTTTCCTCATCTGTACAATGG - Intergenic
912901030 1:113648664-113648686 CAGTTTTCCCACCTAGAAAATGG + Intronic
912906177 1:113710114-113710136 CAGTTTCCTCACCTCTAAACTGG + Intronic
913037543 1:114986175-114986197 CAGTTTCCTCATCTGTAAACTGG - Intronic
913234652 1:116769258-116769280 CAGCTTCCTCTCCTCGACACTGG - Intergenic
913247138 1:116879722-116879744 CAGCCTCTCCACCTGGACAGTGG + Intergenic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
913353420 1:117888806-117888828 CAGTTTCCTCACCTGCAAAATGG + Intronic
913568641 1:120098571-120098593 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
913604257 1:120450443-120450465 CAGTTTCCTCACCTGTTCAGAGG + Intergenic
913641129 1:120813154-120813176 CAGTTTCCTCACCTGTTCAGAGG + Intronic
913990830 1:143610151-143610173 CAGTTTCCTCATCTGTTCACAGG - Intergenic
914084286 1:144438762-144438784 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914277354 1:146137170-146137192 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914289455 1:146259592-146259614 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914364687 1:146967712-146967734 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914365453 1:146973999-146974021 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914451528 1:147796961-147796983 CAGTTTCCTCCCCTGGAAAGAGG - Intergenic
914486992 1:148119440-148119462 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914538402 1:148588118-148588140 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914550491 1:148710345-148710367 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914804721 1:150983627-150983649 CAGTTTCCTCATCTGGAAAATGG - Intronic
915246533 1:154559343-154559365 CAGTTTCCTCATCTGTACAATGG + Intergenic
916189508 1:162165499-162165521 CAGTTTCCTCATCTGGACAATGG - Intronic
916487800 1:165274845-165274867 CAGTTTCCCCATCTGTAAAATGG + Intronic
916583237 1:166127110-166127132 CAGTATCCTCACCTGAACAATGG + Intronic
917791701 1:178503276-178503298 CAGTTTCCTCACCTGCAAAATGG + Intergenic
917976938 1:180245752-180245774 CAGTTTCCTCACCTGTAAAAGGG - Intronic
918136497 1:181678766-181678788 TAGTTTCTCCACCTGGAAAGTGG + Intronic
918243170 1:182637643-182637665 CGGTTTCCTCACCTGTACATGGG + Intergenic
918869166 1:189945427-189945449 CAGTTTCCTCATCTGTAAACTGG + Intergenic
919340803 1:196304076-196304098 CAGTTTCCACATCTGGAAGCAGG + Intronic
919574474 1:199290503-199290525 CAGCTTCCCCATCTGGAAAATGG + Intergenic
919765756 1:201126425-201126447 CAGTTTCCCCATCTGTAAAATGG - Intronic
919766052 1:201127907-201127929 CACTTTCCTCAGCTGGCCACTGG - Intergenic
919833433 1:201557630-201557652 CAGTTAACCCACCTGAAAACTGG - Intergenic
919857872 1:201718033-201718055 CAGTTTCCCCATCTGTACAATGG - Intronic
919878291 1:201886379-201886401 CAGTTTCCTCATCTGTACAATGG + Intergenic
919925158 1:202188378-202188400 CAGTTTCCATACCTGGAGCCTGG + Intergenic
919927198 1:202198328-202198350 TAGTTTCCTCACCTGTAAACAGG + Intronic
920185056 1:204154319-204154341 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
920381884 1:205539557-205539579 CAGTTTCCCCACCTACAAAATGG + Intergenic
920543128 1:206794210-206794232 CAGTTTCCCCACCTGCAACTTGG + Intergenic
920807073 1:209245037-209245059 GAGTTTGCACACCTAGACACTGG + Intergenic
921168861 1:212527736-212527758 CAGTTTCCTCACCTATACAGTGG - Intergenic
921255629 1:213336675-213336697 CAGTTTCCTCACCTGTAAAATGG - Intergenic
921261045 1:213385326-213385348 CAGTTTCCTCACCTGTAGAATGG - Intergenic
921290669 1:213654033-213654055 CAGTTTGCCCATCTGTACAATGG - Intergenic
921413001 1:214856429-214856451 CAGTTTCCTCACCTGCAAAATGG - Intergenic
921767729 1:218992077-218992099 CAGTTTCCTCACTTGTAAACTGG + Intergenic
921845997 1:219882969-219882991 CAGTTTCCACATCTGTAAACTGG + Intronic
922150804 1:223002438-223002460 CTGCTGCCCCAGCTGGACACTGG + Exonic
922719033 1:227890956-227890978 CAGTTTCCCCATCTGCACACAGG - Intergenic
923086534 1:230707110-230707132 CTGTTTCCCCTCCTGCTCACAGG + Intronic
923802579 1:237224894-237224916 CAGTTTCCTCACCTGTAAAGTGG - Intronic
923976120 1:239265406-239265428 CAGTTTCCTCACCTGCAAAATGG - Intergenic
924539040 1:244963648-244963670 CAGTTTCCCCATCTGTAAAATGG - Intergenic
924549225 1:245059057-245059079 CAGTTTCCACACCTGTAAAATGG - Intronic
924714145 1:246556903-246556925 CATTTACCTCACCTGGACACAGG - Intronic
1062823701 10:553149-553171 CAGCATCCCCACATGGGCACTGG + Intronic
1062982735 10:1738757-1738779 CAGTTTCCTCATCTGTAAACTGG + Intergenic
1063117788 10:3084606-3084628 GAGTTTCCCTGCCTGGACCCTGG + Intronic
1063465996 10:6245002-6245024 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1063549302 10:7014574-7014596 CAGGTTCCCCATCTGTAAACTGG - Intergenic
1064248632 10:13690069-13690091 CAGTTGACCCAACTGGACACTGG + Intronic
1064596349 10:16949058-16949080 CAGTTTCCTCACTTGGAAAAAGG + Intronic
1065115791 10:22481268-22481290 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1065214668 10:23438777-23438799 CGCTTCCCCCACCTGGGCACTGG - Intergenic
1065699481 10:28410988-28411010 CAGTTTCTCCCCCTGGATATGGG - Intergenic
1066490111 10:35886176-35886198 CAGTTTTCTCAGCTGGAAACTGG - Intergenic
1067056794 10:43057208-43057230 CAGTTTCCTCATCTGGAAAGTGG - Intergenic
1067699171 10:48556262-48556284 CAGTTTCCACATCTGCACAATGG + Intronic
1067844259 10:49707208-49707230 CAGTTTCCCCACCTGTTAAATGG - Intronic
1068048503 10:51918115-51918137 CAGTCTTCCCACCTGCACATTGG - Intronic
1069022341 10:63503020-63503042 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1069540659 10:69291508-69291530 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1069557140 10:69405973-69405995 CAGTTTCCCCATCTGTAGAGTGG + Intronic
1069704530 10:70449859-70449881 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1069707024 10:70465331-70465353 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1069724459 10:70568321-70568343 CAGTTTCCCCATCTGTAAAATGG + Exonic
1069784175 10:70977390-70977412 CAATTTCCCCACCTTGGCAATGG - Intergenic
1069823837 10:71243306-71243328 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1069894799 10:71673714-71673736 CAGTTTCCCCATCTGTAAATTGG + Intronic
1069894936 10:71674645-71674667 CAGTTTCCCCATCTGTAAATTGG - Intronic
1069948462 10:72003083-72003105 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070379090 10:75863569-75863591 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070502032 10:77081227-77081249 CTGTTTCCTCATCTGGACACTGG + Intronic
1070544614 10:77442554-77442576 CAGCTTCCCCACCTGTACAATGG + Intronic
1070552641 10:77502741-77502763 CAATTTTCCCACCTGGAAAAGGG + Intronic
1070746597 10:78937434-78937456 CAGTATCCCCACCTGTAGAATGG + Intergenic
1070773821 10:79098440-79098462 CAGTTTCCTCACCTGTAAAATGG + Intronic
1070806962 10:79276360-79276382 CACTGTCCCCACGTGGCCACAGG - Intronic
1071498391 10:86186620-86186642 CAGTTTTCCCATCTGGAAAATGG + Intronic
1071533118 10:86403942-86403964 GAGTTACCACACCTGGCCACGGG - Intergenic
1072127822 10:92462745-92462767 CAGTTTCCTCATCTGGAAATTGG + Intronic
1072226442 10:93374339-93374361 CAGTTTCCCCATCTGTAAAATGG - Intronic
1072301774 10:94068710-94068732 CAGTTTCCTCACCTGTAAAATGG - Intronic
1072446191 10:95500840-95500862 CAGTTTCCTCCCCTGTACACAGG + Intronic
1072636363 10:97181069-97181091 CAGTTTCCCCATCTGTAAAACGG - Intronic
1072761124 10:98057692-98057714 TAGTTTCCCCACCTGCAGACTGG + Intergenic
1072848559 10:98860567-98860589 CAGTTTCCCCATCTGTAAATGGG - Intronic
1073051416 10:100669756-100669778 CAGTTTCTCCATCTGTACAGTGG - Intergenic
1073477687 10:103765093-103765115 CAGTTTCCTCATCTGGAAAATGG - Intronic
1074164355 10:110861675-110861697 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1074296450 10:112193561-112193583 CAGTTTCCCCATCTGAAAAATGG - Intronic
1074702296 10:116103132-116103154 CAGTTTCCTTACCTGGAAAATGG + Intronic
1074882007 10:117666877-117666899 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1075247710 10:120838638-120838660 CAATTTCCTCACCTGAACAATGG - Intergenic
1075320975 10:121491542-121491564 CAGCTTCCCCACCTGTAAAATGG - Intronic
1075849354 10:125574569-125574591 CCGTTTCCTCACCTGTACAATGG - Intergenic
1076353108 10:129832178-129832200 CAGTTTCACCACCTGGAAGTGGG + Intergenic
1076376505 10:129991570-129991592 CAGTTTCCCCACATCCTCACCGG - Intergenic
1076382683 10:130036182-130036204 CAGTTTCCCCATCAGAATACAGG - Intergenic
1076401779 10:130189789-130189811 CAGTAGCACCACCTGGACCCTGG - Intergenic
1076528065 10:131125025-131125047 CAGTTTTTCCACCTGGACAGTGG - Intronic
1076722505 10:132398878-132398900 CAGATTCCCCACAAGGACAAGGG - Intronic
1076726080 10:132413941-132413963 CAGAGCCCCCACCGGGACACGGG - Intronic
1077148091 11:1054779-1054801 CAGTTTCCCTGCCTGGTCCCCGG - Intergenic
1077187411 11:1241536-1241558 GAGCTTCCCCAACTGGACCCTGG + Exonic
1077284650 11:1760243-1760265 CAGTTTCCCCGTGTGTACACAGG + Intronic
1077316323 11:1920945-1920967 CAGTTTCCCCACTTGGAGAGTGG + Intronic
1077442901 11:2576983-2577005 CAGTTTCTCCATCTGCACATGGG + Intronic
1077542388 11:3153183-3153205 CAGTGTCCCCACCTGTAAAATGG + Intronic
1077583134 11:3430299-3430321 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1078105198 11:8354022-8354044 CAGTTTCCCCTTCTGCAGACTGG + Intergenic
1078402850 11:11043722-11043744 CAGTTTCCCCATTTGTAAACAGG - Intergenic
1078520871 11:12061911-12061933 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1078530612 11:12134091-12134113 CAGTTTCTTCACCTGGAAAATGG + Intronic
1078577388 11:12513707-12513729 CAGTTCCCCCACCCAGACACTGG + Intronic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1078646243 11:13143351-13143373 CAGAGTCCCCACCTGGAAAATGG + Intergenic
1078659502 11:13275987-13276009 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079244041 11:18740413-18740435 CAGTTTCCTCATCTGGAAAATGG - Intronic
1079244916 11:18744853-18744875 AAGTTTCCCCACCTGGAAGATGG + Intronic
1079322820 11:19465766-19465788 CAGTTTCCCCAACTGTAAAAAGG - Intronic
1079329733 11:19523419-19523441 CAGTTTCCCTACCTGGAAAATGG + Intronic
1079637454 11:22761756-22761778 CAGTTTCCCCATCTGTAAAATGG - Intronic
1079800205 11:24859788-24859810 CAGTTTCCCCTGCTGGATAGTGG - Intronic
1080026757 11:27623242-27623264 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1080299794 11:30771232-30771254 CAGTTTCCTCATCTGTACAAGGG + Intergenic
1080394110 11:31874205-31874227 CAGTTTCCTCACCTGGAAAATGG - Intronic
1080573671 11:33579145-33579167 CATTTTCCCCACCTGTAAAATGG + Intronic
1080653531 11:34241183-34241205 CAGTTTCCTCATCTGTACAGCGG + Intronic
1080834403 11:35927027-35927049 CAGTTTCCTCCTCTGAACACTGG - Intergenic
1080836439 11:35944617-35944639 CAGTTTCCCCACCTGCACCGCGG + Intronic
1081365778 11:42233348-42233370 CAGCTTCCCAAGCTGGAAACTGG - Intergenic
1081516124 11:43831950-43831972 CAGTTTCCTCATCTGTACAATGG - Intronic
1081545817 11:44070932-44070954 CAGTTTCCACCCCAGGTCACAGG - Intronic
1081611682 11:44566613-44566635 CAGTTTCCTCACCTGTAAAATGG + Intronic
1081613296 11:44576349-44576371 CAGTTTCCTCATCTGTACAATGG - Intronic
1081667348 11:44924346-44924368 CAGTTGCCCCATCTGTACAATGG - Intronic
1082767901 11:57183052-57183074 CAGTTTCTTCACCTGGAAAATGG - Intronic
1083268776 11:61560098-61560120 CAGTTTCCCCATCTGTAAAATGG - Intronic
1083275885 11:61596882-61596904 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1083462635 11:62824703-62824725 CAGTTTCCTCACCTGTAAAATGG + Intronic
1083544574 11:63538796-63538818 CAGTTTCCCCATCTGTGCAATGG + Intronic
1083547222 11:63558083-63558105 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1083582404 11:63833221-63833243 CAGTTTCCTCACCTGTATAATGG - Intergenic
1083611546 11:64006803-64006825 CAGTTTCTCCACCTGCAAAATGG + Intronic
1083614294 11:64018738-64018760 CAGTTTCCTCCTCTGGAAACTGG - Intronic
1083624102 11:64063233-64063255 CAGTTTCCTCATCTGAACAATGG + Intronic
1083630283 11:64091710-64091732 CCAACTCCCCACCTGGACACTGG + Intronic
1083671800 11:64304105-64304127 CTGTTTCTCCACCTGCACAGTGG + Intronic
1083965454 11:66041196-66041218 CAGTTCCCTCACCTGGAAAACGG + Intergenic
1084005631 11:66322046-66322068 CAGTTTCCCCATCTGCAAAAAGG - Intergenic
1084030666 11:66478912-66478934 CAGTTTCCCTATCTGTACAATGG + Intergenic
1084118021 11:67053163-67053185 CAGTTTCCCCATCTGAAGAATGG + Intergenic
1084121222 11:67070179-67070201 CAGTTACCGCACCTGTACAGTGG + Intronic
1084227317 11:67725326-67725348 TCCTCTCCCCACCTGGACACTGG - Intergenic
1084240050 11:67813102-67813124 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084266351 11:68007324-68007346 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084270686 11:68027631-68027653 CAGTTTCCCCATCTGTCCAGTGG - Intronic
1084389216 11:68864198-68864220 CAGTTTCCACACCTGGGAAGTGG - Intergenic
1084417782 11:69043388-69043410 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1084433101 11:69122430-69122452 CAGATGCCCCACCTGGAAAAGGG - Intergenic
1084483856 11:69436942-69436964 CAGTTTCCCTCCCTGGAAAGTGG - Intergenic
1084518663 11:69649895-69649917 CAGTTTCCCCATCTGTACAGTGG + Intronic
1084539759 11:69778552-69778574 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1084550712 11:69840206-69840228 CAGTTTCCCCATCTGTAGAATGG - Intergenic
1084679088 11:70655434-70655456 CAGTTTCCCCATCTGTAAAATGG + Intronic
1084784659 11:71435258-71435280 CAGTTTCCTCATCTGTAAACTGG - Exonic
1084807876 11:71591522-71591544 TCCTCTCCCCACCTGGACACTGG + Intronic
1084832396 11:71779739-71779761 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1084878803 11:72154813-72154835 CACTTTCCCCACCTTACCACAGG - Intergenic
1085015725 11:73173025-73173047 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1085038712 11:73314482-73314504 CAGTTTTCCCATCTGTACAGTGG + Intronic
1085048137 11:73365098-73365120 CAGCTTCCCCACCTGTCCAGGGG + Intronic
1085049821 11:73374616-73374638 CAGTTTCCTCATCTGAAAACTGG - Intergenic
1085185504 11:74572682-74572704 CAGTTTCCTCATCTGGAAAATGG - Intronic
1085228139 11:74941215-74941237 CAGTTTCCTCACCTGCAAAATGG + Intronic
1085395074 11:76203084-76203106 CAGTTTCCCCACTTGCACAGTGG - Intronic
1085410751 11:76289008-76289030 CAGTGTCCCCTTCTGTACACTGG - Intergenic
1085454525 11:76658237-76658259 CAGTTTCCCCATCTGTGCAATGG + Exonic
1085530182 11:77187822-77187844 CAGTTTCCCCATCAGGAAAGTGG - Intronic
1085761988 11:79249244-79249266 CAGTTTCCTCACCTGCAGAATGG - Intronic
1085791941 11:79503981-79504003 CAGTTTCCCCATCTGAAAAATGG - Intergenic
1085824720 11:79832862-79832884 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1085829883 11:79888197-79888219 CATCTTCCCTACCTGGTCACTGG - Intergenic
1086181822 11:83961205-83961227 CAGTTTTCTCACCTGTACAAGGG - Intronic
1086368220 11:86130088-86130110 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1086457885 11:86977277-86977299 CAGTTTCCCCATCTACACAATGG - Intergenic
1086842899 11:91709960-91709982 TACTTTCTCCACCTGTACACTGG - Intergenic
1087197872 11:95318536-95318558 CAGTTTCTCCAACTGTAAACTGG - Intergenic
1087221821 11:95554471-95554493 CAGTTTCCTCATCTGTAGACTGG - Intergenic
1088335028 11:108694278-108694300 CAGTTTCCTCACCTGAAAATAGG - Intronic
1088606038 11:111533306-111533328 CAGTTTCCTCACCTATACAGTGG + Intronic
1088832780 11:113551642-113551664 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1088901565 11:114121619-114121641 CAGTTTCCTCACCTGCAAAATGG - Intronic
1088995107 11:114989325-114989347 CAGTTTCCCCGACTGTACAATGG + Intergenic
1089163682 11:116458600-116458622 CAGTTTCCTCATCTGTACAATGG + Intergenic
1089201221 11:116725785-116725807 CTGTTTCCCCACCTGCAGAGTGG + Intergenic
1089301782 11:117503315-117503337 CAGTTTCCTCACCTGTACGAGGG - Intronic
1089345308 11:117787186-117787208 CAGTTTCCCCATCTATACAAAGG + Intronic
1089391085 11:118102360-118102382 CAGTTTCCTCATCTGTACAATGG - Intronic
1089399609 11:118156781-118156803 CAGTTTCCCCATCCTGAGACCGG - Intergenic
1089605325 11:119638228-119638250 CAGGTTGTCCACCTGGACCCAGG - Intronic
1089635266 11:119807850-119807872 CAGTTTCCCCACCTGTGGAAGGG + Intergenic
1089662562 11:119994876-119994898 CAGTTTCCTTACCTGGAAAATGG + Intergenic
1089743046 11:120598284-120598306 CAGTTTCCTCATCTGCACAAGGG - Intronic
1089788684 11:120926495-120926517 CAGTTTCCTCATCTGGAAAATGG - Intronic
1089921569 11:122213798-122213820 CAGTTTCCCCACCTGTACAATGG + Intergenic
1090364088 11:126191867-126191889 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1090407909 11:126488380-126488402 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1090452719 11:126820838-126820860 TAGTTTCCACACCTGGAAAAGGG - Intronic
1090517146 11:127441003-127441025 CAATTTCCCCATCTGTACAATGG - Intergenic
1090518637 11:127455247-127455269 CCATTTCCCCACCTGGATCCAGG - Intergenic
1090704238 11:129322146-129322168 CAGTTTTCCAAACTGAACACTGG + Intergenic
1091619308 12:2074416-2074438 CAGTTTCCCCACCTGTATGCTGG - Intronic
1091620423 12:2083568-2083590 CAGTTTCCCCAGCTGTAGATTGG + Intronic
1091726146 12:2848053-2848075 CAGGTTCCTCACCTGCACAATGG - Intronic
1091830394 12:3545158-3545180 CAGTTCCCTCATCTGGAAACTGG - Intronic
1091946789 12:4552768-4552790 CAGTTTCCTCACCTAGAAAATGG - Intronic
1092054366 12:5496626-5496648 CAGTTTCCTCGCCTGTAAACTGG - Intronic
1092123830 12:6062512-6062534 CAGATTCTTCCCCTGGACACTGG - Intronic
1092125054 12:6069227-6069249 CAGTTTCCTCATCTGTAAACTGG - Intronic
1092230180 12:6771870-6771892 CAGTTTCCTCATCTGTACAATGG + Intergenic
1092410287 12:8247645-8247667 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1092751901 12:11726940-11726962 CGGTTTCCTCACCTGTAAACTGG - Intronic
1094095008 12:26693935-26693957 CAGTTTCCCCACCTGTGTAATGG - Intronic
1094384444 12:29878724-29878746 CACTTTCCTCACCTGTAAACAGG - Intergenic
1095404323 12:41851158-41851180 CAATTTCCCCACCTGGAGTCTGG - Intergenic
1096200355 12:49677441-49677463 CAGTTTCCTCACCTGTAAAATGG + Intronic
1096337417 12:50766793-50766815 CAGCTTCCCCACCCTGCCACAGG + Intronic
1096459122 12:51812362-51812384 CAGTTTCCCCATCTGTAAAATGG + Exonic
1096518661 12:52172005-52172027 CTGTTTCCCCATCTGGAAAGTGG - Intronic
1096802147 12:54117701-54117723 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1097048503 12:56205844-56205866 CAGTATCCCAACCTGCATACTGG + Exonic
1097285026 12:57870456-57870478 CAGTTTCCCCACCAGTAAAATGG + Intergenic
1097625776 12:61998578-61998600 CAGTTTCCCCATCTGTAAAATGG - Intronic
1098623416 12:72634147-72634169 CAGTTTCCCCTTCTGGAAAATGG - Intronic
1099038229 12:77616563-77616585 CAATTTCCTCACCTGTAAACTGG - Intergenic
1100336665 12:93637569-93637591 CAGTGTTCTCACCTGGAAACTGG + Intergenic
1100600389 12:96107687-96107709 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1100639879 12:96472286-96472308 CAGTTTTCCCATCTGTAAACCGG - Intergenic
1100785885 12:98077400-98077422 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1100800599 12:98226557-98226579 CAGTTTTCTCACCTGTACAATGG - Intergenic
1100865478 12:98852646-98852668 CAGTTTCCCCACCTGTAAACAGG - Intronic
1101125596 12:101630434-101630456 CAGTTTCCCCATCTGTAAAATGG + Intronic
1101187245 12:102292172-102292194 CTGTTTCCCCTGCTGGACTCAGG - Intergenic
1101411301 12:104470724-104470746 CAGTTTCCTCACCTGTATAATGG - Intronic
1101642198 12:106595146-106595168 CAGTTTCCCCATCTGTAAACTGG - Intronic
1101865450 12:108516572-108516594 CAGTTCCCTCACCTGGAGAAGGG + Intronic
1101927157 12:108981653-108981675 CAGTTTCCTCACCTGCAAAATGG + Intronic
1101935728 12:109054709-109054731 CAGTTTCCTCATCTGTACAATGG - Intronic
1102036355 12:109772466-109772488 CAGTTTCCCCATCTAGGAACTGG + Intergenic
1102045398 12:109826798-109826820 CAGTTTCCTCACCTGTAAAAGGG + Intronic
1102045764 12:109829294-109829316 CAGTTTCCTCATCTGGACAATGG - Intronic
1102046663 12:109833607-109833629 CAGTTTCCTCGCCTGGAAAATGG + Intergenic
1102169414 12:110830723-110830745 CAGTTTCCCCATCTGTAGAATGG - Intergenic
1102169506 12:110831391-110831413 CAGTTTCCTCACCTGTAAAGGGG + Intergenic
1102172332 12:110851847-110851869 CATTTTCCTCACCTGGAAAATGG - Intronic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1102183530 12:110931083-110931105 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102208519 12:111107118-111107140 CAGTTTCCTCACCTGTAAAATGG - Intronic
1102213106 12:111141381-111141403 CAGTTTCCCTACCTGTAAAATGG + Intronic
1102251832 12:111392740-111392762 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1102253292 12:111402016-111402038 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1102257382 12:111424250-111424272 CAGTTTCCCCCTCTGTACATTGG + Intronic
1102259937 12:111437555-111437577 CAGTTTCCTCACCTGTAAAATGG - Intronic
1102303810 12:111790142-111790164 CAGTTTCCCCATCTGAAAAGTGG + Intronic
1102391495 12:112552432-112552454 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1102410499 12:112713981-112714003 CAGTTTCCCCACCTGTAAAATGG + Intronic
1102413100 12:112737327-112737349 CAGTTTCCCCACTTGTAAAATGG + Intronic
1102430655 12:112880443-112880465 CTGTTTCCCCATCTGTACAATGG - Intronic
1102430797 12:112881499-112881521 CAGTTTCCCCACCTGTCAAATGG - Intronic
1102459320 12:113090514-113090536 CAGTTTCCCCACCTGTAATGGGG - Intronic
1102462467 12:113108387-113108409 CAGTTTTCTCACCTGGAAAATGG + Intronic
1102462797 12:113110285-113110307 CAGTTTCCCCATCTGTAAACAGG + Intronic
1102475344 12:113185188-113185210 CAGTTTCCCCAGCTGGGGATTGG - Intronic
1102550824 12:113690909-113690931 CAGTTTCCTCACCTTGAAAATGG + Intergenic
1102563266 12:113777811-113777833 CAGTTTCCCCACCTATAAAATGG - Intergenic
1102773079 12:115495461-115495483 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1102806607 12:115786917-115786939 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1102817424 12:115879166-115879188 CACTTTCCCCACCTGTAAAATGG + Intergenic
1102880915 12:116484165-116484187 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1102961425 12:117096001-117096023 CAGTTTCCTCACCTGTAAAATGG + Intronic
1102962716 12:117102999-117103021 CAGTTTCCCCATCTGCAAAGTGG + Intergenic
1103037241 12:117666531-117666553 CAGTTTCCCCTTCTGTACAATGG + Intronic
1103113565 12:118305057-118305079 CAGTTTCCTCATCTGTACAAAGG + Intronic
1103167245 12:118780632-118780654 TAGTTTCCCCATCTGGAAAATGG + Intergenic
1103245287 12:119451475-119451497 CAGTTTCCCCATCTGCAAAATGG + Intronic
1103558635 12:121780629-121780651 CAGTTTCTCCCCCTGTAAACTGG + Exonic
1103611940 12:122129419-122129441 CAGTTTCCCCATCTGTGCACTGG + Intronic
1103700134 12:122844954-122844976 CAGTTTCCCCACCTTCAAAATGG + Intronic
1103700426 12:122846337-122846359 CAGTTTCCTCACCAGGAAAATGG + Intronic
1103718843 12:122962541-122962563 CAGTTTCCCTAACTGTAAACGGG - Intronic
1103748294 12:123141250-123141272 CAGTTTCCTCACCTGTAAAATGG + Intronic
1103881266 12:124167604-124167626 CAGTTTCCCCAACTGCAAATGGG + Intronic
1103931222 12:124452100-124452122 CAGTTTCCCCACCCTGACCCTGG + Intronic
1103933057 12:124460685-124460707 CAGTTTCCCCATCTGTAAAATGG - Intronic
1103946024 12:124526885-124526907 CAGTTTCTCCAACTGTACAATGG + Intronic
1103946934 12:124532078-124532100 CAGTTTCCTCATCTGGAGAATGG + Intronic
1103950733 12:124549667-124549689 CGGTTTCCCCATCTGGAGAAGGG - Intronic
1103951740 12:124555119-124555141 CAGTGTCCCCATCTGTAAACAGG + Intronic
1103973600 12:124687847-124687869 CAGTTTCCTCATCTGTACAATGG + Intergenic
1103981187 12:124738035-124738057 CAGTTTCCCCATCTGTACAATGG + Intergenic
1104967053 12:132513022-132513044 CAGTGTCCCCACCAGGGCGCGGG - Intronic
1105278732 13:18951059-18951081 CAGTTTCCCCATCTGTGCAATGG + Intergenic
1105534813 13:21256045-21256067 CAGTTTCCTCACCTGCAAAATGG + Intergenic
1105579292 13:21678408-21678430 CAATTTCCCCATTTGTACACTGG + Intronic
1105819390 13:24066354-24066376 CAGTTTCCCCATCTGCAAACTGG - Intronic
1105956008 13:25283330-25283352 CAGTTTCCTCACCTGTAAAATGG + Intronic
1106716196 13:32390919-32390941 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1106830263 13:33573751-33573773 CAGTTTCCCCAATTGAACAAGGG - Intergenic
1107310463 13:39072514-39072536 CAGCTTCCCCAGCTGGGAACTGG + Intergenic
1107353914 13:39545522-39545544 CAGTTTCATCACCTTGACAACGG + Intronic
1107384355 13:39891932-39891954 CAGTTTCCTCAACTGCACAATGG - Intergenic
1107492771 13:40897932-40897954 CAGTTTCTCTACCTGTAAACTGG + Intergenic
1108546805 13:51503206-51503228 CGGTTTCCCCACCTGTAAAATGG + Intergenic
1108741007 13:53338391-53338413 CATTTTCCCCACCTAAACAAGGG - Intergenic
1108748834 13:53425184-53425206 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1109173039 13:59119344-59119366 CAGCATCCACACCTGGGCACTGG - Intergenic
1110361208 13:74627540-74627562 GAGTTTCCCCACCTTTGCACAGG - Intergenic
1110391191 13:74976202-74976224 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1111853251 13:93603521-93603543 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1111962344 13:94825456-94825478 CAGTTTCCTCACCTGTAAAGGGG - Intergenic
1113459032 13:110468863-110468885 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1113585628 13:111462308-111462330 CAGTTTTCCCACCTAGAAAGTGG + Intergenic
1113633114 13:111901449-111901471 CAGTTTCCCCACCAGAGGACTGG + Intergenic
1114357717 14:21930911-21930933 CATTTTCACCAACAGGACACAGG + Intergenic
1114645883 14:24255852-24255874 CAGTTTCCTCACCTGTAAAAGGG - Intronic
1114647754 14:24264970-24264992 CAGTTTCCTCATCAGTACACTGG + Intergenic
1114789149 14:25636394-25636416 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1116329473 14:43577684-43577706 CACTTTCCCCACCCTGCCACAGG + Intergenic
1117619654 14:57571661-57571683 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1117648025 14:57872918-57872940 CAGTCTCCTCACTTGGTCACTGG + Intronic
1118073467 14:62271451-62271473 CAGTTTCCCCACTTAGCCCCAGG + Intergenic
1118349051 14:64960551-64960573 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1118386636 14:65261124-65261146 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1118704308 14:68466374-68466396 CAGTTTCCCCACCTGTAAAATGG - Intronic
1118813435 14:69291977-69291999 CAGATACCCCTCCTGGGCACAGG + Intronic
1118908419 14:70040876-70040898 CACCTTCCCCACCTGGACCCTGG + Intergenic
1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG + Intergenic
1119182990 14:72616911-72616933 CAGTTTCCCCATCTGGAAAGCGG - Intergenic
1119264478 14:73255909-73255931 CAGTTTGCCCATCTGCACAGTGG + Intronic
1119399580 14:74353368-74353390 CAGTTTCCTCACCTGTAAATTGG + Intronic
1119412079 14:74438864-74438886 CAGTTTCCTCACCTGCAAAATGG - Intergenic
1119615760 14:76098064-76098086 CAGTTTCCTCATCTGCACAAGGG - Intergenic
1119636034 14:76274185-76274207 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1119770920 14:77220252-77220274 CAGTTTCCCCACCTGAAAGATGG + Intronic
1120707685 14:87761439-87761461 CAGTGTCCCCACTGGGGCACTGG + Intergenic
1120766300 14:88329906-88329928 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1121021039 14:90580355-90580377 CAGTTTCCTCATTTGGACAATGG - Intronic
1121052886 14:90830993-90831015 GAGTTTCCCCACCTGGGAAAGGG - Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121182723 14:91941760-91941782 CAGTTTCCCCATCTGTAAAATGG + Intronic
1121255938 14:92530563-92530585 CAGTTTCCTCGCCTGTAAACTGG - Intronic
1121564151 14:94896092-94896114 CAGTTTTCTCATCTGCACACTGG + Intergenic
1121569915 14:94939794-94939816 CCATTTCCCCACCTGGAAAATGG + Intergenic
1121586183 14:95064561-95064583 CAGTTGCCCAAGCTGGAAACTGG - Intergenic
1122074124 14:99224730-99224752 CAGTGTCCCCACCTGTAAAATGG - Intronic
1122146390 14:99691391-99691413 CAGTTTCCTCATCTGTAAACTGG + Intronic
1122262998 14:100533908-100533930 CAGTTTCCTCTGCTGGACAGTGG - Intergenic
1122271219 14:100569135-100569157 CAGTTTCCTCACCTGAAAGCTGG + Intronic
1122293315 14:100691200-100691222 CAGTTTCCTCACCTGCACATGGG + Intergenic
1122353104 14:101108848-101108870 CAGTTTCCTCATCTGTACAATGG + Intergenic
1122428049 14:101623123-101623145 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1122692504 14:103537921-103537943 CAGTTTCCCTACCTGTGCAGTGG - Intergenic
1122892562 14:104739566-104739588 CAGTCTCCCCACCTGCAAATGGG - Intronic
1122960257 14:105090945-105090967 CCGTTTCCCCACCTGTACAGTGG + Intergenic
1123445614 15:20328293-20328315 CAGTTTTCCCCTCTGGACCCAGG - Intergenic
1124700716 15:31909669-31909691 CAGTTTCCCCATGTGCAAACTGG + Intergenic
1124823988 15:33075137-33075159 CAGCTCCCTCACCTGGAAACTGG + Intronic
1125715055 15:41814978-41815000 CAGTTTCCTCACCTGTAAAATGG + Intronic
1126098074 15:45103136-45103158 CAGATACCCCAACTGGACAAGGG - Intronic
1126421354 15:48476531-48476553 CAGTTTCCCCATCTGGTGATTGG + Intronic
1126798749 15:52281648-52281670 CAGTTTCCCCATATGTACAAAGG - Intronic
1127387244 15:58476497-58476519 CAGTTTCCCCAGCTGCATGCAGG - Intronic
1127395368 15:58540424-58540446 CAGTTTTCTCACCTGGAAAATGG - Intronic
1127662117 15:61109795-61109817 CAGTTTCCCCATCTGTAAATGGG + Intronic
1128148910 15:65349027-65349049 CACTTTCCCCACCCTGCCACAGG + Intronic
1128343114 15:66836501-66836523 CAGTTTCCTCAACTGGCCAATGG - Intergenic
1128361196 15:66963002-66963024 CAGTTTCCCCATCTTGAAAGTGG + Intergenic
1128536836 15:68498012-68498034 CAGTTTACCCACCTGTAAAATGG - Intergenic
1128542246 15:68544215-68544237 CAGTTTCCCCATCTGTAAAAGGG + Intergenic
1128740443 15:70079840-70079862 CAGTTTCCCCATCTGAAAAGTGG - Intronic
1128742328 15:70092520-70092542 CAGTTTCCTCACCTATAAACAGG + Intronic
1129107842 15:73321555-73321577 CAGTTTGCCCATCTGTACAGTGG - Exonic
1129150925 15:73687308-73687330 CAGTTTCCCCAACTGTACAATGG - Intronic
1129165921 15:73777414-73777436 CAGTTTCCTCACCTGCAAAATGG - Intergenic
1129172499 15:73816809-73816831 CAGCTTCCCCAGGTGGAGACAGG - Intergenic
1129182052 15:73883802-73883824 CAGTTTCCCCATCTGTAGAATGG - Intronic
1129258718 15:74350469-74350491 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1129342670 15:74896373-74896395 CTGTTTCCCTATCTGGACAAAGG + Intronic
1129464315 15:75715426-75715448 CAGTTTCCTCATCTGGAAGCAGG - Intergenic
1129512325 15:76133564-76133586 CAGTTTCCCCACCTGAAAAATGG - Intronic
1129720932 15:77877586-77877608 CAGTTTCCTCATCTGGAAGCAGG + Intergenic
1129723622 15:77890845-77890867 CAGTTCCCCCATCTGAATACAGG - Intergenic
1129802358 15:78424852-78424874 CAGTTTCCCCAGCTGTAAAGTGG - Intergenic
1129873638 15:78957870-78957892 CAGTTTTCCCACCTGTGCAATGG - Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129894490 15:79093302-79093324 CAGTTTCCCCGTCTGTACAATGG - Intergenic
1129905504 15:79184468-79184490 CAGTTTCCCCATCTGTAATCAGG + Intergenic
1130040223 15:80400198-80400220 CACTTTCCTCACCTGGAAAATGG - Intronic
1130306366 15:82714544-82714566 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1130575708 15:85091325-85091347 CAGTTTCCTCACCTGCAAAATGG - Intronic
1130651550 15:85764854-85764876 CAGCTTCCCCATCTGGACAACGG - Intronic
1130672224 15:85922795-85922817 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1130885366 15:88088175-88088197 CAGTTTCCCCACCTGTAAAATGG + Intronic
1130949293 15:88572977-88572999 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
1131028266 15:89163819-89163841 CAGTTTCCTCACCTGTAAAAGGG - Intronic
1131532714 15:93207396-93207418 CTGTTTCCTCACCTGTACAATGG + Intergenic
1131697216 15:94890809-94890831 CAGTTTCCTCACCTTGAAAGTGG + Intergenic
1131754144 15:95541950-95541972 CAGTTTCCTCACCTGTATAATGG + Intergenic
1131768718 15:95710911-95710933 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1131923429 15:97355010-97355032 CAGTTTCCCCATCTGCAAACTGG + Intergenic
1132196373 15:99917319-99917341 CAGTTTCCCCGCCTGTGCAGCGG + Intergenic
1132231162 15:100185208-100185230 CAGTTTCCCTACCTGTAGAATGG + Intronic
1132238363 15:100238738-100238760 CAGTTTCCCCATCTGCTCACAGG + Intronic
1132317666 15:100901622-100901644 CAGTTTCCTCATCTGGAGAGTGG + Intronic
1132347194 15:101115451-101115473 CAGTTTCCTCACCTGTAGAATGG - Intergenic
1132572696 16:650937-650959 CTGTTTAGCCACCTGAACACAGG - Intronic
1132609379 16:807636-807658 CAGTTTCCCCACCTGTAAGAGGG - Exonic
1132849253 16:2017102-2017124 CAGTTTCCTCATCTGTAAACTGG - Intronic
1132871373 16:2117143-2117165 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1132873942 16:2127722-2127744 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1133037028 16:3039243-3039265 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1133326705 16:4946299-4946321 CAGTTTCCCCATCTGCAAAATGG + Intronic
1133457830 16:5958525-5958547 CAGTTTCCCCATCTGAAAAAGGG + Intergenic
1133473095 16:6094693-6094715 CAGTTTCCTCATCTGCACATTGG + Intronic
1133698795 16:8289870-8289892 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1133736779 16:8621907-8621929 CAGTTTCCCCTTCTCAACACGGG + Intronic
1133746098 16:8687801-8687823 CAGTTTCCTCACCTGTAAAATGG + Intronic
1133769995 16:8862247-8862269 CAGTTTCCACATCTGGAAAATGG + Intronic
1133771179 16:8868121-8868143 CAGTTTCCCCATCTGCAGACTGG - Exonic
1133967017 16:10538792-10538814 CAGTTTCCTCACCTGTAAAATGG + Intronic
1133973222 16:10581420-10581442 CAGTTTCCCCATCTGGAAACTGG + Intergenic
1134022868 16:10933532-10933554 CAGTTTCCTCATCTGGAAAAGGG + Intronic
1134100306 16:11447277-11447299 CAGTTTCCCCATCTGTAAAACGG + Intronic
1134116303 16:11551368-11551390 CAGTTTCCCCATCTGTAGACGGG - Intronic
1134124197 16:11605263-11605285 CACATTCCCCACGGGGACACAGG - Intronic
1134131138 16:11651018-11651040 CAGTTTCCCCACCTGGGAAGTGG - Intergenic
1134131483 16:11653305-11653327 CAGTTTCCCCACCTGTTAAATGG + Intergenic
1134178448 16:12028002-12028024 CAGTTTCCTCATCTGTACAGTGG - Intronic
1134308509 16:13055201-13055223 CAGTTTCCCCACCTGTAAAATGG - Intronic
1134448574 16:14349014-14349036 CAGTTTCCTCACCTGCAAAATGG - Intergenic
1134521154 16:14919751-14919773 CAGTTTCCCCATCTGGAAAGGGG + Intronic
1134550417 16:15136221-15136243 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1134553029 16:15146896-15146918 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1134636499 16:15795817-15795839 CAGTTTCCCCATCTGTAAAATGG - Intronic
1134681280 16:16127530-16127552 CAGTTTCCTCACCTGTAAAATGG - Intronic
1134684815 16:16151001-16151023 CAGTTTCCCCACCTGTGAAATGG + Intronic
1134708830 16:16318402-16318424 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134716041 16:16358436-16358458 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134753884 16:16649114-16649136 CAGTTTCTCCACCTGTAAAATGG + Intergenic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1134822735 16:17259665-17259687 CAGTTTCCCCATCTGGAAATAGG + Intronic
1134838590 16:17382860-17382882 CAGTTTCCTCACCTGGGTAATGG - Intronic
1134859336 16:17547144-17547166 GAGTTTCCCCACCTTCTCACAGG - Intergenic
1134892252 16:17851472-17851494 CTGTTTACCCACCTGGAAATGGG + Intergenic
1134950775 16:18350243-18350265 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134958715 16:18393723-18393745 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134992175 16:18709930-18709952 CAGTTTCTCCACCTGTAAAATGG - Intergenic
1135047063 16:19164725-19164747 CAGTTTCCTCACCCGTAAACTGG + Intronic
1135100159 16:19598133-19598155 CAGTTTCTCCACCTGTAGAATGG + Intronic
1135323582 16:21512415-21512437 CAGTTTCCCCAGCTGTAAATTGG + Intergenic
1135330403 16:21555493-21555515 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1135471275 16:22733381-22733403 CAGTTTCCTCATCTGTACAATGG - Intergenic
1135481591 16:22825193-22825215 CAGTTCCTCCATCTGCACACTGG + Intronic
1135545013 16:23359778-23359800 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1135632669 16:24048270-24048292 CAGTTTCCCCATCTGTAAAATGG - Intronic
1135778923 16:25281767-25281789 CAGCTTCCTCACCTGGAGAATGG + Intergenic
1135871106 16:26151387-26151409 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1135905807 16:26510758-26510780 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1135918026 16:26623638-26623660 CAGTTTTCCCATCTGGAGAATGG - Intergenic
1135918329 16:26625813-26625835 CAGTTTTCTCACCTGGAGAATGG - Intergenic
1135927249 16:26706247-26706269 CAGTTTCCTCACCTGTAAAAGGG + Intergenic
1135964443 16:27024194-27024216 CAGTTTTCCCACCTGTAAAATGG - Intergenic
1135985751 16:27182769-27182791 CAGTTTCCCTACCTGTAAAATGG - Intergenic
1136003102 16:27311234-27311256 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1136009573 16:27354667-27354689 CAGTTTCCCCATCTGTATAATGG + Intronic
1136016702 16:27405470-27405492 CAGTTTCCCCATCTGTAAAAGGG - Intronic
1136061773 16:27731510-27731532 CAGTTTCCCCATCTGTAAAATGG - Intronic
1136089616 16:27909064-27909086 GAGTTTCCCCACCTGAAAATGGG + Intronic
1136096417 16:27960314-27960336 CAGTTTCCTCACCTGTAAAATGG + Intronic
1136170781 16:28487935-28487957 CAGTTTCCTCATCTGGAAAATGG + Intronic
1136346847 16:29681238-29681260 CCGTTTCCACATCTGGACAATGG + Intronic
1136534140 16:30889266-30889288 CAGTTTCCCCATCTGTAAAATGG + Intronic
1137264644 16:46858903-46858925 CAGTTTCCTCACCTGTACAATGG - Intergenic
1137707837 16:50548028-50548050 CAGTTTCCCCACCTGTAAATTGG + Intergenic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1137766144 16:50979205-50979227 CAGTTTCCCTACCTGCACAAGGG - Intergenic
1137768800 16:50998026-50998048 CAGTTTCCCCAACTGCAAAATGG - Intergenic
1137870755 16:51947856-51947878 AAGTTTCCCCACCTGCAAAGTGG - Intergenic
1137888983 16:52138223-52138245 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1138188787 16:54997667-54997689 CAGTTTCCCCATCTGTGCAATGG - Intergenic
1138302760 16:55946332-55946354 AAGGCTCCCCACCAGGACACAGG - Intronic
1138431731 16:56973215-56973237 CAGTTTCCCCATCTGCACTCTGG + Intronic
1138436111 16:57000964-57000986 CAGTTTCCCCATCTTTACAATGG + Intronic
1138447956 16:57076618-57076640 AAGTTTTCTCACCTGGACACTGG + Intronic
1138741818 16:59319750-59319772 CAGTTTCCTCATCTGTACAATGG + Intergenic
1139268700 16:65662699-65662721 CAGTTTCCCCACCTTAAGATGGG + Intergenic
1139314781 16:66059009-66059031 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1139347277 16:66312069-66312091 CAGTTTCCCCATCTGTAAACAGG - Intergenic
1139629789 16:68223046-68223068 CAGTTTCCCCATCAGTACAATGG - Intronic
1139635273 16:68254875-68254897 CAGTGTCCCCTCCGGGTCACTGG + Intronic
1139667768 16:68470438-68470460 CAGTTTCCCCACCTGCCAAGTGG - Intergenic
1139692489 16:68650139-68650161 CAGTTTCCCCACCGGGCCCCTGG + Intronic
1139693929 16:68659121-68659143 CAGTTTCCTCACCTGTAAAACGG - Intronic
1139706414 16:68743852-68743874 CAGTTTCCCCACCTGTAAAATGG + Intronic
1139824350 16:69745342-69745364 CAGTTTCCCCATCTGTAAAATGG - Intronic
1140139863 16:72245336-72245358 CAGTTCCCCCACCTGTAAAATGG - Intergenic
1140160728 16:72490089-72490111 AATTTTCCCCACTTAGACACTGG + Intergenic
1140211133 16:72971433-72971455 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1141127123 16:81408717-81408739 CAGTTTCCCCACCTGAAAAATGG - Intergenic
1141130632 16:81434041-81434063 CAGTTTCCTCATCTGCACAACGG + Intergenic
1141170471 16:81687482-81687504 CAGTTCCCCCACCTGGGTTCCGG - Intronic
1141184980 16:81780271-81780293 CTGTTTCCCCCTCTGGATACTGG + Intronic
1141196992 16:81867490-81867512 CAGTTTCCTCACCTGGAAGATGG + Intronic
1141427304 16:83952693-83952715 CAGTTTCCTCATCTGAAAACTGG - Intronic
1141475619 16:84271218-84271240 CAGTTTCCTCATCTGTACAATGG + Intergenic
1141530765 16:84645117-84645139 CAGCTTCCCCATCTGCAAACAGG + Intergenic
1141565068 16:84895888-84895910 CAGTTTCCCCATCTGTAAACTGG - Intronic
1141574385 16:84954726-84954748 CAGTTTCCCCATCTGTGAACTGG - Intergenic
1141628867 16:85276095-85276117 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1141669293 16:85483411-85483433 CAGTTTCCCCACCTGTACCCTGG + Intergenic
1141676176 16:85518592-85518614 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1141744426 16:85915954-85915976 CAGTTTCCTTACCTGGAAAATGG + Intronic
1141746922 16:85932056-85932078 CAGTTTCCTCACCTGGCAAATGG + Intergenic
1141749504 16:85948663-85948685 CAGTTTCCTCACCTGTACAGTGG + Intergenic
1141823971 16:86466357-86466379 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1141838853 16:86561035-86561057 CAGTTTCCTCACCTGCAAAATGG + Intergenic
1141894294 16:86948694-86948716 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1141910280 16:87053808-87053830 CAGTTTCCCCACCTGCTAAAAGG + Intergenic
1141931569 16:87208082-87208104 CAGTTTGCCCTCCTGGGCTCAGG + Intronic
1141981021 16:87550622-87550644 CAGTTTCCCCGCCTGCAAAAGGG - Intergenic
1142003436 16:87677551-87677573 CAGTTTCCTCACCTGTGCAGGGG - Intronic
1142035787 16:87861503-87861525 CAGTTTCCCCAGCTGTAAATTGG + Intronic
1142116176 16:88357251-88357273 CAGTTTCTCAACCTGTACAATGG + Intergenic
1142122015 16:88391158-88391180 CAGTTTCCCCACCTGTTCAGTGG + Intergenic
1142122477 16:88393682-88393704 CAGTTTTCCCACCTGTTCCCTGG + Intergenic
1142123819 16:88400374-88400396 CAGTCTCCCCATCTGGAAAATGG - Intergenic
1142125700 16:88409230-88409252 CAGTTTCCCCACCTGCAAAGAGG + Intergenic
1142138836 16:88463584-88463606 CAGTTTCCCCATCTGCACACTGG - Intronic
1142150536 16:88510676-88510698 CAGTTTCCCCATCTCTAGACGGG - Intronic
1142230417 16:88897615-88897637 CAGTTTCCCCACCTGTAAAATGG - Intronic
1142267822 16:89072620-89072642 CTGTTTCCCCACCATGTCACCGG + Intergenic
1142344336 16:89544562-89544584 CAGGTTCCCCTTCAGGACACAGG - Intronic
1142420652 16:89967469-89967491 CGGTTTCCCCATCTGGAAAATGG + Exonic
1142477508 17:198160-198182 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1142486579 17:251394-251416 CAGTTTCCCCACCTGAAAAGTGG - Intronic
1142503311 17:346118-346140 CAGTTTGCTCACCTGTACAATGG - Intronic
1142581647 17:946772-946794 CAGTGTCCTCACCTGGAAAATGG + Intronic
1142692859 17:1617292-1617314 CAGTCTCCCCACATGGACAGAGG - Intronic
1142956154 17:3524132-3524154 CAGTTTCCCCATCTGAAAAATGG + Intronic
1142956910 17:3528753-3528775 CAGTTTTCCCACCTGCACGTGGG + Intronic
1143090387 17:4446361-4446383 CAGTTTCCTCATCTGTAAACGGG + Intronic
1143175811 17:4954388-4954410 CAGTTTCCCCATCTGTAAAATGG + Intronic
1143262412 17:5609453-5609475 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1143368166 17:6421970-6421992 CAGTTTCCCCATCTGTACAAGGG + Intronic
1143871134 17:9957970-9957992 CAGTTTCCTCATCTGTAAACAGG + Intronic
1143897884 17:10150967-10150989 CAGTTTCCCCACCTGTAAAATGG + Intronic
1143976656 17:10835378-10835400 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1144146539 17:12404566-12404588 CAGTTTCCTCACCTGTAACCTGG + Intergenic
1144160266 17:12551096-12551118 CAGTTTCCCCACCTGCAACATGG + Intergenic
1144268691 17:13596551-13596573 GACATTCCCCACCTGGTCACAGG - Intronic
1144389605 17:14780919-14780941 CAGTTTTCCCACCTGTCCACTGG - Intergenic
1144773950 17:17774853-17774875 CAGTTTCCTCATCTGCAAACAGG - Intronic
1144774392 17:17777735-17777757 CAGTTTCCCCACTGGCACAGTGG - Intronic
1144831333 17:18132845-18132867 CAGTTTCCTCACCTGTAAAATGG + Intronic
1144836466 17:18159016-18159038 CAGTTTCCCCATCTGTAAAATGG + Intronic
1144952015 17:18999513-18999535 CAGTTTCCTCATCTGCACAATGG + Intronic
1145166340 17:20615518-20615540 CGGTTTCCCCATCTGGAAAATGG + Intergenic
1145242364 17:21247510-21247532 CGGTTTCCCCATCTGTACATGGG - Intronic
1145267541 17:21387582-21387604 CAGTTTCCTCACCTGGGAAGTGG + Intronic
1145366007 17:22267457-22267479 GAGTTTTCCCACCTGAACACCGG - Intergenic
1145778547 17:27546349-27546371 CAGTTCACCCACCTGTAAACAGG - Intronic
1145899897 17:28483731-28483753 CAGTTTCCTCATCTGGAAATGGG - Intronic
1146269889 17:31477860-31477882 CAGTTTCCCCATCTGTAAAATGG + Intronic
1146298889 17:31672792-31672814 CAGTTTCCTCACCTGAAAATCGG + Intergenic
1146591182 17:34129242-34129264 CAGTTTCCACACCTGTACGTGGG - Intronic
1146685764 17:34840674-34840696 CAGTTTCTCCACCTGCAAAATGG - Intergenic
1146913706 17:36664796-36664818 CAGTTTCTCCATCTGTACAATGG - Intergenic
1146920481 17:36706855-36706877 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1146931729 17:36782655-36782677 CAGTTTCCCCACATGCAAAAGGG + Intergenic
1146943128 17:36857581-36857603 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1146983359 17:37187638-37187660 CAGTTTTCCTACCTGAAAACGGG + Intronic
1147376274 17:40024001-40024023 CACTTTTCCCACCTGCACAATGG + Intronic
1147448479 17:40489283-40489305 CAGTTTCCACACCTGTAAAGTGG + Intronic
1147584644 17:41647345-41647367 CAGCATCTCCACCTGGACAGAGG - Intergenic
1147842111 17:43379084-43379106 CAGTTTCCCCAGCTGGGAAGTGG + Intergenic
1147911035 17:43856427-43856449 CAGTTTCTCCCCCTGGAAAATGG - Intronic
1147927558 17:43954921-43954943 CAGTTTCCTCATCTGGAAAATGG - Intronic
1148048308 17:44757528-44757550 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1148355799 17:46974830-46974852 CAGTTTCCTCATCTGTACAATGG + Intronic
1148591538 17:48820024-48820046 CAGTTTCCTCATCTGAAAACAGG - Intergenic
1148732657 17:49846921-49846943 CAGTTTCCTCACCTGCAAAACGG - Intronic
1148741028 17:49892723-49892745 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1148747712 17:49927741-49927763 CAGTTTCCTCATCTGTAAACTGG - Intergenic
1148752181 17:49951690-49951712 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1148798877 17:50210792-50210814 CAGTGTCCCCACCTGGGAAATGG - Intergenic
1148847381 17:50537449-50537471 CAGTTTCCTCATCTGTACAGTGG + Intronic
1148991487 17:51670332-51670354 CAGTTTCCCCATCTGGTAAATGG - Intronic
1149576202 17:57715383-57715405 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1150144545 17:62756707-62756729 CAGTTTCCTCATCTGTACAATGG - Intronic
1150222789 17:63506719-63506741 CAGTCTCCCCACCTGTAAAATGG + Intronic
1150244291 17:63662516-63662538 CAGTTTCCCCAGATGTAGACTGG - Intronic
1150285599 17:63952074-63952096 CAGTTTCCCCATCTGCAGAAGGG - Intronic
1150286173 17:63955493-63955515 CAGTTTTCCCATCTGGAAAACGG - Intronic
1150707643 17:67501926-67501948 CAGTTTCCTCATCTGTACAAGGG + Intronic
1150916478 17:69442810-69442832 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1150922627 17:69499426-69499448 GAGTTTCCACACCTGCAAACTGG - Intronic
1151334715 17:73433169-73433191 CAGGTTCCCCATCTGTAAACTGG - Intronic
1151336798 17:73444628-73444650 CAGTTTCCCCATCTGTAAATTGG - Intronic
1151336814 17:73444716-73444738 CAGTTTCCCCATCTGTAAACTGG - Intronic
1151369914 17:73641333-73641355 CAGTTTCCTCATCTGTACACTGG - Intronic
1151413156 17:73944326-73944348 CAGTTTCCCCACCTGGGGTATGG - Intergenic
1151431003 17:74063169-74063191 CAGTTTTCTCACCTGGAAATGGG + Intergenic
1151461943 17:74259701-74259723 CAGTTTCCCTACCTGCAAAATGG - Intronic
1151486706 17:74405503-74405525 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1151578429 17:74964191-74964213 CAGTTTCCCTATCTGTAAACTGG + Intronic
1151705214 17:75763758-75763780 CAGTTTCCTCATCTGTACAATGG + Intronic
1151766439 17:76135726-76135748 CAGTTTCCCCATCAGAACTCCGG + Intergenic
1151821179 17:76497725-76497747 CAGTTTCCCCAGCTGCACAGTGG - Intronic
1151878482 17:76880715-76880737 CAGTCTCCCCACCTGGGGAGGGG - Intronic
1151901820 17:77020995-77021017 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1151930641 17:77229652-77229674 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1152236210 17:79140202-79140224 CAGTTTCCTCACCTGTACAATGG - Intronic
1152324984 17:79630824-79630846 CAGTTTCCACAACTGTAAACTGG - Intergenic
1152381043 17:79942380-79942402 AAGTTTCCCCACCTGCACATGGG + Intronic
1152397644 17:80044122-80044144 CAGTTTCCTCATCTGTACAATGG - Intronic
1152445520 17:80340434-80340456 CGGTTTCTCCACCTGCAGACAGG - Intronic
1152544084 17:80992076-80992098 CAGTTTCCCCATCCGAACGCGGG - Intronic
1152573975 17:81132218-81132240 CAGCTTCCCCACCAGGGCACTGG - Intronic
1152733732 17:81986651-81986673 CAGTTTCCTCACCTGTGCCCCGG + Intronic
1152871624 17:82756930-82756952 CAGTGTCCCCATCTGTAAACTGG - Intronic
1153337306 18:3937918-3937940 CAGTTTCCTCAGCTGTACAGTGG + Intronic
1153758283 18:8305493-8305515 CAGTTTCCCCAACTGTAAAATGG - Intronic
1153819672 18:8822654-8822676 CAGTTTCCTCATCTGTATACAGG + Intronic
1154353536 18:13607250-13607272 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1154486298 18:14874048-14874070 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1156202426 18:34849480-34849502 CAGTCTCCTCATCTGTACACAGG + Intronic
1156225147 18:35098001-35098023 CAGTTTACCCATCTGTACAATGG + Intronic
1156338070 18:36187356-36187378 CCCTTTCCCCACCTGGGCGCGGG - Intergenic
1156384699 18:36594578-36594600 CAGTTTCCTCATCTGCACAATGG + Intronic
1157308911 18:46537319-46537341 CAGTTTCCCCATATTTACACAGG + Intronic
1157328433 18:46685959-46685981 CAGTTTCCACATCTGCACAATGG - Intronic
1157331742 18:46708984-46709006 CAGTTTTCCCATCTGGAAAATGG + Intronic
1157477563 18:48033210-48033232 TAATTTCCTCACTTGGACACAGG + Intronic
1157492653 18:48135466-48135488 CAGTTTCCCCATCTGCAAAGTGG + Intronic
1157504936 18:48219468-48219490 CAGTGTCCCCACCTGGAATGTGG - Intronic
1157891512 18:51422544-51422566 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1158071926 18:53480734-53480756 CAGTTTCCTCATCTGCACAATGG - Intronic
1158563214 18:58532793-58532815 CACTTTCCCCACCTGTAAAATGG - Intronic
1158666379 18:59436550-59436572 CAGTTTCCCCATCTGTAAAACGG + Intronic
1158981536 18:62766552-62766574 CAGTTTCTCTACCTAGTCACAGG - Intronic
1159869629 18:73745677-73745699 CAGTTTCCTCAACTGTACAATGG + Intergenic
1160021626 18:75185927-75185949 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1160101305 18:75922475-75922497 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1160193078 18:76731361-76731383 AAGTATCCCCACATGGTCACAGG + Intergenic
1160272170 18:77397175-77397197 CAGTTTCCCCTCCAGGACAGAGG + Intergenic
1160691227 19:461368-461390 CAGTTTCCCCACTAGGAAATAGG - Intergenic
1160719025 19:589650-589672 CAGTTTCCCCTCCTGGGGAGAGG + Intergenic
1160738845 19:676807-676829 CAGTTTCCCCATCTGGAAGACGG - Intronic
1160763191 19:796039-796061 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763201 19:796074-796096 CAGTTTCCCCACCTGTAGGCGGG + Intergenic
1160763262 19:796334-796356 CAGTTTCCCCAGCTGTAAGCGGG + Intergenic
1160763287 19:796438-796460 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763300 19:796488-796510 CAGTTTCCCCACCTGTAGGCGGG + Intergenic
1160763325 19:796592-796614 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763338 19:796644-796666 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160773993 19:846484-846506 CAGTCTCCCCACCTGGAAGGTGG + Intronic
1160774420 19:848472-848494 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1160789810 19:918210-918232 CAGTTTCCACAACTGCAAACTGG - Intronic
1160807393 19:998496-998518 CAGTTTCCCCATCTGTACACGGG - Intergenic
1160816515 19:1038474-1038496 CACTTTCTCCACCTGGCCCCGGG - Exonic
1160820347 19:1054921-1054943 CAGTTTTCCCATCTGGTCCCTGG + Intronic
1160824418 19:1073045-1073067 CAGTTTCCCCATCTGGGAACAGG + Intronic
1160829357 19:1095804-1095826 CAGTTTCCCTACCTGTGCAATGG + Intergenic
1160881962 19:1325010-1325032 CAGTTTCCACAGCGGGACAGGGG + Intergenic
1160907960 19:1460620-1460642 CAGTTTCCCGACCTGAGCATGGG + Intronic
1160918175 19:1507479-1507501 CAGTCTCCCCATCTGTAAACAGG + Intronic
1160919099 19:1511669-1511691 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1160921058 19:1520792-1520814 CAGTTTCCCCATCTGTAAACTGG + Intergenic
1160924097 19:1534880-1534902 CAGTTTCCCCAGGTGTACAGTGG + Intronic
1160935792 19:1593850-1593872 CAGTTTCTCCAGCTGGAGGCAGG - Intergenic
1160940651 19:1619058-1619080 CAGTTTCCCCAACTGGAACCAGG + Intronic
1160948513 19:1654599-1654621 CGGTTTCTCCATCTGGACAGTGG + Intergenic
1160949385 19:1658249-1658271 CGGTTTCCCCATCTGAACAATGG - Intergenic
1160952800 19:1675685-1675707 CAGTTTCCCCATCCGGGCAATGG + Intergenic
1160952993 19:1676461-1676483 CAGTTTCCCCATCTGTATAATGG - Intergenic
1160953636 19:1679492-1679514 CAGTTTCCCCATCTGTCCAGCGG - Intergenic
1160965970 19:1747122-1747144 CAGTTTCCTCACCTGAAAAATGG + Intergenic
1160967423 19:1752867-1752889 CCGTTTCCCCAACTGTACAATGG - Exonic
1160987134 19:1844263-1844285 CAGTTTCCTCATCTGTAAACTGG + Intronic
1161115632 19:2495168-2495190 CAGTTTCCCCATCTGTGCAATGG - Intergenic
1161124970 19:2550746-2550768 CAGTTTCCCCACCTATAAAATGG + Intronic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161209294 19:3057805-3057827 CAGTTTCCTCCCCTGGATAACGG - Intronic
1161225600 19:3143795-3143817 GAGTTTCCCCACATGGAAACAGG + Intronic
1161233070 19:3185067-3185089 CAGTCTCCCCATCTGTACAAAGG + Intergenic
1161258065 19:3320642-3320664 CAGTTTCCCCATCTGTAAAGCGG - Intergenic
1161276994 19:3423920-3423942 CAGTTTCCCCATCTGTAAAACGG + Intronic
1161292080 19:3499924-3499946 CAGTTTCCTCACCTGTAAAATGG - Intronic
1161325642 19:3662486-3662508 CAGTTTCCCTGCCTGTAGACAGG + Intronic
1161377352 19:3946773-3946795 CAGTTTCCCCATCTGCAAAAAGG - Intergenic
1161429648 19:4224256-4224278 CAGTTTCCCCTTCTGTACAGTGG + Intronic
1161438397 19:4277629-4277651 CAGTTTTCCCATCTGGATAATGG + Intergenic
1161451311 19:4347066-4347088 CAGATTCCACACATGGGCACTGG - Intronic
1161482468 19:4517843-4517865 CAATTTCCACACCTGGGCAATGG + Intergenic
1161482489 19:4517944-4517966 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1161489275 19:4552938-4552960 CAGTGTCCCCACATGTACAATGG - Intronic
1161491892 19:4566831-4566853 CAGTTTCCACATCTGCACAGTGG - Intergenic
1161505571 19:4641591-4641613 CAGTTTCCCCATCTGTCCAATGG + Intronic
1161519657 19:4716720-4716742 CAGTTTCCCCACCTGTAGAATGG - Intronic
1161533265 19:4803180-4803202 CAGTTTCTCCATCTGCACAATGG + Intergenic
1161604581 19:5207591-5207613 CAGTTTCCCCATCTGTACATTGG + Intronic
1161609823 19:5236268-5236290 CAGTTTCCTCACCTGTAAAATGG - Intronic
1161631847 19:5360931-5360953 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1161644804 19:5446526-5446548 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1161659607 19:5537908-5537930 CAGTGTCCCTACCTGCACCCTGG - Intergenic
1161662997 19:5558796-5558818 CAGTTTCCCAACCTGGAAAATGG + Intergenic
1161701491 19:5798288-5798310 CAGTCTCCCCACCTGCTCAGGGG - Intergenic
1161709982 19:5842190-5842212 CAGTTTCCCCATCTGTACAGTGG - Intergenic
1161713744 19:5864082-5864104 CACTTTCCCCATCTGCACAGTGG - Intergenic
1161716189 19:5877342-5877364 CGGTTTCCCCATCTGTACAGTGG - Intronic
1161763302 19:6190260-6190282 CAGTTTCCTCACCTGTAAAATGG + Intronic
1161856556 19:6769039-6769061 CAGTTTCTCCATCTGGAAAATGG - Intergenic
1161965140 19:7543573-7543595 CAGTTTCCCCATATGGACAGTGG - Intronic
1162068620 19:8140652-8140674 CAGTTTCCCCATCTGTAAAATGG - Intronic
1162079892 19:8211455-8211477 CAGTTTCTCCACCTGTAAAATGG + Intronic
1162095386 19:8306947-8306969 CAGTTTCCTCACCTGTAAACGGG + Intronic
1162116022 19:8429988-8430010 CAGTTTCCCCATCTGTAAAATGG + Intronic
1162307659 19:9885160-9885182 CACTTTCCCCACCTGCAAAATGG + Intronic
1162312485 19:9915071-9915093 CAGTTTCCCCATCTGCAAAGTGG + Intronic
1162312689 19:9916480-9916502 CAGTTTCCTCACCTGGAAATAGG - Intronic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162390277 19:10385729-10385751 CATTTTCCCAGCCTGCACACTGG + Intergenic
1162446410 19:10725610-10725632 CAGTTTCCTCATCTGGAAAATGG + Intronic
1162452142 19:10761641-10761663 CAGTTTCCCCATCTGTAGAATGG - Intronic
1162514971 19:11142425-11142447 CAGTTTCCCCATCTGTAAAATGG + Intronic
1162531947 19:11241302-11241324 CAGTTTCCCCATCTGTAAAATGG - Intronic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1162550694 19:11356861-11356883 CAGTTTCCACATCTGCACAATGG + Exonic
1162776655 19:12983835-12983857 CAGTTTCCCCATCTGTAAAACGG + Intergenic
1162851623 19:13435455-13435477 CAGTTTCCCCATCTGAAAATTGG - Intronic
1162852647 19:13442637-13442659 CAGTTTTCTCACCTGGAAAAAGG - Intronic
1162868752 19:13569544-13569566 CAGTTTCCTCACCTGTAAAATGG - Intronic
1162896053 19:13765178-13765200 CAGTTTCCCCATCTGTATAGTGG - Intronic
1162908567 19:13837305-13837327 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1162963993 19:14147164-14147186 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1162968977 19:14168901-14168923 CAGTTTTCCCATCTGTAGACAGG - Intronic
1162997908 19:14348193-14348215 CAGTTTCCCCATCTGTAAAACGG + Intergenic
1163041552 19:14606739-14606761 CAGTTTCCTCACCTGTAAAATGG - Intronic
1163052278 19:14693484-14693506 CAGTTTCCTCACCATGACACTGG - Exonic
1163301045 19:16446555-16446577 CAGTTTCCCCACCTGTCAACTGG - Intronic
1163432100 19:17274333-17274355 CAGTTTCCCCATCTGTACTGTGG + Intronic
1163435305 19:17292053-17292075 CAGTTTTCCCATCTGCAGACTGG - Intergenic
1163438668 19:17310465-17310487 CAGTCTCCCCACCTGAAAAGTGG + Intronic
1163455991 19:17405963-17405985 CAGTTTCCCCAGGTGGAGACCGG - Intronic
1163522514 19:17799857-17799879 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1163526644 19:17825398-17825420 CAGTTTTCCCACCTGTCCAATGG - Exonic
1163566082 19:18052111-18052133 CAGTTTCCCCACCTGGAAAGCGG + Intergenic
1163573326 19:18096303-18096325 CAGTTTCCCCTCCTGCAAAATGG + Intronic
1163596771 19:18225198-18225220 CAGTTTACCCCCCTGGCCAATGG - Intronic
1163597216 19:18227151-18227173 CAGTTTCTCCATCTGGAAAATGG - Intronic
1163615137 19:18322744-18322766 CAGTTTCCCCACCTGCAAACTGG + Intronic
1163626310 19:18391883-18391905 CAGTTTCCCCATCTGAAGAATGG - Exonic
1163665550 19:18602277-18602299 CAGTTTCCCCATCTGGAAAGTGG + Intronic
1163690867 19:18737500-18737522 CAGTTTTCCCATCTGGAGAGTGG + Intronic
1163708441 19:18831570-18831592 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1163726273 19:18924833-18924855 CGGTTTCCCCACATGGACAGTGG + Intronic
1163727054 19:18928806-18928828 CAGTTTCCTCATCTGGAGAATGG + Intronic
1163730058 19:18943750-18943772 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1163774748 19:19211693-19211715 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1163775435 19:19214629-19214651 CAGTTTCCCCACCTGTAAAATGG - Intronic
1163820188 19:19492087-19492109 CAGGGTGCCCACCTGGGCACTGG + Intronic
1163891556 19:20020898-20020920 CATTTTCCCCACTTCGAGACTGG - Intronic
1164402613 19:27911995-27912017 CAGTTTCCTCACCTGACCAGGGG + Intergenic
1164885752 19:31777115-31777137 CAGTTTGCCTTCTTGGACACAGG + Intergenic
1164919430 19:32077712-32077734 CAGTTTTCCCACCTGTAGAATGG - Intergenic
1165062162 19:33210253-33210275 CATTTTCGCCATCTGTACACTGG + Intronic
1165160107 19:33811079-33811101 CAGTTGCCCCATCTGTACAATGG + Intronic
1165186508 19:34026993-34027015 CAATTTCCTCATCTGGACAATGG - Intergenic
1165272256 19:34720716-34720738 CAGGTTCTTCACATGGACACAGG - Intergenic
1165322330 19:35093778-35093800 CAGTTTCCCCCTCTGCACATTGG - Intergenic
1165404408 19:35620942-35620964 CAGTTTCCTCATCTGTAAACTGG - Intronic
1165438248 19:35808645-35808667 CAGTTTCCCCATCTAGAAAATGG - Intronic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1165956298 19:39503887-39503909 CAGTTTCCCTATCTGTAAACTGG + Intronic
1166092297 19:40517799-40517821 CAGTTTCCTCATCTGGAAAATGG - Intronic
1166106140 19:40599030-40599052 CAGTTTCTCCATCTGTACAATGG - Intronic
1166129199 19:40735933-40735955 CAGTTTCCTCATCTGGAAAACGG - Intronic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166294801 19:41883567-41883589 CGGTTTCCCCACCCGTACAATGG - Intronic
1166568415 19:43779086-43779108 CAGTTTCCCCATCTGTAAATTGG - Intronic
1166674910 19:44734496-44734518 CAGTTTCCCCATTTGGATAATGG - Intergenic
1166678294 19:44753000-44753022 CAGTTTCCCTATTTGGAAACTGG + Intronic
1166708890 19:44924656-44924678 CTGTTTCCCCATCTGTACAATGG + Intergenic
1166718234 19:44982718-44982740 TGGTTTCTCCCCCTGGACACAGG + Intronic
1166766722 19:45255627-45255649 CACTTTCCCCACCTGTAAAATGG + Intronic
1167095097 19:47371132-47371154 CAGTTTCCCCATCTACACACTGG - Intronic
1167135420 19:47612706-47612728 CAGTTTCCCCATCTGTAAAATGG - Intronic
1167148662 19:47696664-47696686 CAGTTTCCCCCTCTGGAAAATGG + Intronic
1167150939 19:47709243-47709265 CAGTTTCCTCACCTGCAAGCTGG - Intergenic
1167153362 19:47722891-47722913 CAGTTTCCTCATCTGGAAAATGG + Intronic
1167174184 19:47853961-47853983 CAGTTTCCCCACCTATACAATGG - Intergenic
1167217793 19:48176402-48176424 CAGTTTTCTCACCTGGAAAGTGG - Intronic
1167323896 19:48812523-48812545 CAGACTCCCCAGCTGGACCCAGG - Intergenic
1167339232 19:48905035-48905057 CAGTTTCCCCACCTGTAAAATGG + Intronic
1167558876 19:50213315-50213337 CAGCTTCCCCACCTGCAGAGCGG - Intronic
1167621234 19:50562190-50562212 CAGTTTCCCCCTCTGTAAACTGG + Intronic
1167632852 19:50636561-50636583 CCGTTTCCTCATCTGGACAATGG + Intronic
1167659824 19:50790170-50790192 CAGTTTCCCCATCGGTACAATGG + Intergenic
1167660342 19:50792446-50792468 CAGTTTTCCCATCTGCACAGTGG + Intronic
1167733940 19:51279819-51279841 CAGTTTGCTCACCTAGACAATGG + Intergenic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
1167792557 19:51690743-51690765 CAGTTTCCCCAAGGAGACACTGG + Intergenic
1167799369 19:51730241-51730263 CAGTTTCCCTATCTGGAAAATGG - Intergenic
1168336746 19:55601272-55601294 CAGTTTCCCCATCTGCAAAATGG + Intronic
1168347923 19:55659932-55659954 CAGTTTCTCCAGCTAGAGACTGG + Intronic
1168415082 19:56162621-56162643 CAGTTTCCCCATCTGTACCATGG - Intergenic
925383508 2:3445628-3445650 CAGTTTCCCCATCTGTAAATTGG - Intronic
925540108 2:4957545-4957567 CAGTTTCCCCATCTGTAAAATGG + Intergenic
926085880 2:10020121-10020143 CAGCTGCTCCACCTGGAAACCGG + Intergenic
926115230 2:10208974-10208996 CAGTTTGGCCACCAGGAGACAGG - Intronic
926291817 2:11537451-11537473 CAGTTTCCCCAACTGAAAAATGG - Intronic
926423909 2:12724215-12724237 CAGTTTCCTCACCTGGAATGCGG - Intronic
926621932 2:15054484-15054506 CAGTTTCCTCAACTGGAAAGCGG - Intergenic
926784631 2:16507901-16507923 CAGTCTCCCCACCTGCAAAGTGG - Intergenic
927464242 2:23325103-23325125 CAGTTTCCTCACCTGCAAAATGG + Intergenic
927887401 2:26727127-26727149 CAGTCTCCCTTCCTGTACACTGG + Intronic
928059931 2:28101589-28101611 CAGGTTCCCCACATGGACTGGGG - Intronic
928339148 2:30426461-30426483 CAGTTTCCTCATCTGTACAAAGG + Intergenic
928359857 2:30654413-30654435 CAGTTTCCTCACCTGTAAAATGG - Intergenic
928360222 2:30656521-30656543 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
928845465 2:35666525-35666547 CAGTTTCCTCATCTGGAAAATGG - Intergenic
929303854 2:40336886-40336908 CAGTTTCCTAACCTGGAAAATGG + Intronic
929429415 2:41874513-41874535 CAGTTTCTCCATCTAGCCACTGG + Intergenic
929435450 2:41925338-41925360 CAGTTTCCTCATCTGTACAAGGG - Intergenic
929783874 2:44975344-44975366 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
929830215 2:45341217-45341239 CAGTTTCCCCAACTGTAACCTGG + Intergenic
929911234 2:46091112-46091134 CTGTGTCCCCTGCTGGACACGGG + Intronic
929938742 2:46314555-46314577 CAGTTTCCCCATCTTCACAATGG + Intronic
930056384 2:47255307-47255329 CAGTTTCCTCATCTGGAAAATGG + Intergenic
930258641 2:49119844-49119866 CAGTTTGCCCATCTGCAAACTGG + Intronic
930472113 2:51829912-51829934 CTGTTGCTCCAGCTGGACACAGG + Intergenic
931185035 2:59941625-59941647 CAGTTTCCTCATCTGTAAACAGG - Intergenic
931692358 2:64846028-64846050 CAGTTTCCCCACTTGTAAAATGG + Intergenic
931863807 2:66388030-66388052 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
932335173 2:70926858-70926880 CAGTTTCCCCACCAGTAAAATGG - Intronic
932411852 2:71552299-71552321 CAGTTTCCCTATCTGGAAAGTGG + Intronic
932480541 2:72036531-72036553 CAGTTTCCTCACCTGCAAAACGG - Intergenic
932845644 2:75133529-75133551 CAATTTCCTCATCTGGAAACTGG - Intronic
933304480 2:80580119-80580141 CAGTTTTCCTACCTGGAAAATGG + Intronic
934709857 2:96507847-96507869 CAGTTTCCCCACGTGTATAATGG - Intronic
934938302 2:98480993-98481015 CAGTTTCCTAAACTGCACACTGG - Intronic
934974680 2:98792525-98792547 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
935043038 2:99452960-99452982 CAGTTTCCTCACATGTAAACTGG + Intronic
935202762 2:100872313-100872335 CAGTTTCCTCATCTGGACAAAGG + Intronic
935289406 2:101597015-101597037 CAGTTCCCTCACCTGGACAGTGG + Intergenic
935289526 2:101598333-101598355 CAGTTCCCTCACTTGGACAGTGG - Intergenic
935553585 2:104483369-104483391 CACCTTCCCCACCAGCACACGGG - Intergenic
935737506 2:106118064-106118086 CAGGTGTCCCACCTAGACACTGG - Intronic
935979511 2:108613083-108613105 CAGTTTCCCCATCTGTAAATGGG + Intronic
936054789 2:109254368-109254390 CAGTTTCCCCATCTGTAAAATGG + Intronic
936484448 2:112914316-112914338 CGGTTTCCACACCTGAACAGTGG - Intronic
936633221 2:114227090-114227112 CTGGGTCCCCACCTGGACTCAGG - Intergenic
936822059 2:116534199-116534221 CAGTTTCCCCATCTGTAAATTGG + Intergenic
937030316 2:118733431-118733453 CAGTTTCCTCATCTGGAAAATGG + Intergenic
937086792 2:119177240-119177262 CAGTTTTCTCACCTGGTCAATGG + Intergenic
937236445 2:120434210-120434232 CAGTTTCCTCACCTGCAAAATGG - Intergenic
937276261 2:120686001-120686023 CAGTTTCCTCACCTGTGAACCGG - Intergenic
937752258 2:125490393-125490415 CAGTTTTCCCCTCTGGCCACAGG + Intergenic
937876833 2:126832359-126832381 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
937915300 2:127095976-127095998 CAGTGTACCCACCTGGGGACCGG - Intronic
938941139 2:136170624-136170646 CAGTTTCCACATCTATACACGGG + Intergenic
938985845 2:136575414-136575436 CACTTTCCCCACCTATACAATGG - Intergenic
938998166 2:136702699-136702721 CAGTTTCCCCATCTGTAAAATGG + Intergenic
939525981 2:143295042-143295064 CAGTTTCCCCAACTGTAAAATGG - Intronic
939750861 2:146044585-146044607 AAGTTTCAACACCTGGTCACTGG - Intergenic
939896282 2:147795107-147795129 CAGTTTCCTCATCTGTACAATGG - Intergenic
940984425 2:160038489-160038511 AAGTCTCCCCACCTGGGCTCTGG - Intronic
941049851 2:160720672-160720694 CAGTTTCCCCACCTGTAAAATGG + Intergenic
941067860 2:160923732-160923754 CAGTTTCCCCACCTAGACAGTGG - Intergenic
941157749 2:161999915-161999937 CAGTTTCCTCATCTGGATAATGG - Intronic
941471760 2:165896961-165896983 CACCTTCCCCACCTGGGCCCTGG + Intronic
941520630 2:166537552-166537574 CAGTTTCTTCACCTGGAAAATGG + Intergenic
941580934 2:167294153-167294175 CAGTGGCCCCACCTGGACGCCGG - Intergenic
943159384 2:184227786-184227808 CAGTTTCCTCATCTTGACAATGG + Intergenic
944440999 2:199743200-199743222 CAGTTTCCCCATCTGTAGAGAGG - Intergenic
945185425 2:207134827-207134849 CAGTTTCCTCACCTGTAAAATGG + Intronic
945200935 2:207280463-207280485 CAGTTTCCCCACCTAAGAACAGG + Intergenic
946008854 2:216548667-216548689 CAGTTTCCCCACCTATAAAATGG - Intronic
946041585 2:216787212-216787234 CAGTTTCCTCATCTAGACATTGG + Intergenic
946131601 2:217611047-217611069 CAATTTCCTCACCTGCACAATGG + Intronic
946208573 2:218129076-218129098 CAGTTTCCCCATCTGTAAAATGG + Intronic
946229892 2:218284718-218284740 CAGTTTCTTCACCTGGAAAATGG + Intronic
946401379 2:219470220-219470242 CAGTTTCCCCATCTGTAAATGGG - Intronic
946547738 2:220763750-220763772 CAGTTTCCTCATCTGGAAAATGG - Intergenic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
947765537 2:232634759-232634781 CAGTTTCCTCATCTGGAGAGTGG + Intronic
947792844 2:232877631-232877653 GACTTTCTCCTCCTGGACACTGG + Intronic
948034611 2:234847870-234847892 CAGTTTTCCCAGCTGTACAATGG - Intergenic
948185766 2:236020130-236020152 CAGTTTCCCCACCTATAAACTGG + Intronic
948248748 2:236507856-236507878 CAGTTTTCCCATCTGTAAACTGG + Intergenic
948301831 2:236913524-236913546 CAGTTTCCTCATCTGGAAAGCGG - Intergenic
948388077 2:237593975-237593997 CAGCTTCCCCTCCTGCACAGAGG + Intronic
948792884 2:240388336-240388358 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948792893 2:240388381-240388403 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948867395 2:240782834-240782856 CAGTTTCCCCGCCTGTAAAGTGG - Intronic
948877919 2:240840002-240840024 CAGTTTCCCCATCTGTAAACTGG + Intergenic
1168765046 20:376319-376341 CAGTTTCCCCATCTGTAAAATGG - Intronic
1168796856 20:616167-616189 CAGTTTCCTCATCTGTAAACAGG + Intergenic
1168833209 20:858820-858842 CAGTTTCCCCATATGTACATGGG - Intergenic
1168834017 20:864894-864916 CAGTTCCCCCATCTGGATAATGG - Intergenic
1168841531 20:912972-912994 CTGTTTCCTCACCTGTACACTGG + Intronic
1168967364 20:1906969-1906991 CTGTTTCCTCACCTGTAAACAGG - Intronic
1168970197 20:1925689-1925711 CAGTTTCCCCATCTGTAAAATGG + Intronic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1169608703 20:7353797-7353819 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1169746483 20:8948169-8948191 CAATTTCCTCACCTGTACAGTGG - Intronic
1169810383 20:9603801-9603823 CAGTTTCCACACCTGTAAAATGG - Intronic
1170303471 20:14911844-14911866 CAGTTTCCCCATCTGTAAAATGG - Intronic
1170309575 20:14977580-14977602 CAGTTTCCTCAGCTGGAAATTGG + Intronic
1170549416 20:17463711-17463733 CAAGTTCCACACTTGGACACAGG - Intronic
1170593607 20:17789645-17789667 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1170666980 20:18394847-18394869 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1170746777 20:19106608-19106630 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1171176541 20:23054307-23054329 CAGCTTCCACACCTGGGCAATGG - Intergenic
1171384016 20:24755123-24755145 CAGTTTCCCCCTCTGAACATAGG + Intergenic
1171794564 20:29556763-29556785 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1171853885 20:30327501-30327523 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1172009168 20:31836440-31836462 CGGTTTCCCCAGCTGGATCCAGG - Intergenic
1172038940 20:32030303-32030325 CAGTTTCCTCACCTGCAAAATGG - Intronic
1172125520 20:32623132-32623154 CAGTTTCCCCACCTGTCAATGGG - Intergenic
1172126172 20:32626626-32626648 CAGTCTCCCCATCTGGAAAATGG + Intergenic
1172177132 20:32979365-32979387 CAGTTTCCCCATCTACACAATGG - Intergenic
1172187044 20:33037378-33037400 CAGTCTACCCACCTGTACACTGG + Intronic
1172215648 20:33233818-33233840 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1172335913 20:34115200-34115222 CAGTTTCCTCATCTGGAAAAAGG - Intergenic
1172407226 20:34698829-34698851 CAGTTTCCCCATCTGCAGAATGG - Intronic
1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG + Intronic
1172595605 20:36149151-36149173 CAGTTGCCCCATCTGTACAATGG - Intronic
1172634956 20:36404206-36404228 CAGTTTCCCCATCTGTACAATGG + Intronic
1172641678 20:36443918-36443940 CAGTTTCCCCACCTATAAAATGG - Intronic
1172657475 20:36545982-36546004 CAGTTTCCCCATCTGTGCAGTGG - Intronic
1172694005 20:36809249-36809271 CAGTTTCCCCATCTGCAAAATGG + Intronic
1172754580 20:37274174-37274196 CAGTTTCCCCATCTGCAAAGTGG - Intergenic
1172764742 20:37345630-37345652 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1172770570 20:37380095-37380117 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1172774638 20:37399942-37399964 CAGTCTCCCCATCTGTACAATGG - Intronic
1172874644 20:38156783-38156805 CAGTTTTCTCACCTGGGCAAGGG - Intronic
1172889569 20:38254413-38254435 CAGTTTCCCCACCTATAAAAGGG + Intronic
1172971242 20:38874427-38874449 CAGTTTCCCCATCTGTAGAATGG - Intronic
1172972234 20:38882009-38882031 CAGTTTTCCCATCTGTAAACTGG + Intronic
1173224752 20:41155852-41155874 CAGTTTCCCCATCAGGAAACTGG - Intronic
1173327284 20:42045691-42045713 CAGTTTCCTCATCTGTAAACTGG - Intergenic
1173426133 20:42945245-42945267 CAGTTTCCTCACCTGCAAAATGG - Intronic
1173579435 20:44136781-44136803 CAGTTTCCCCATCTGTAAAATGG + Intronic
1173645261 20:44629313-44629335 CAGTTTCCCCATCTGTCCAGTGG - Intronic
1173794752 20:45851653-45851675 CAGTTTCCTCATCTGTACAATGG - Intronic
1173817953 20:46002038-46002060 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1173826751 20:46052719-46052741 CAGTTTCCCCACCTGTCAAATGG - Intronic
1173840207 20:46152069-46152091 CTGTTTCCTCACCTGGAGATGGG + Intergenic
1173851983 20:46224431-46224453 CAGTTTCCCCATGTGCACAGGGG - Intronic
1173862844 20:46295534-46295556 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1173912108 20:46678085-46678107 CAGTTTCTCCACCTGTAAAGTGG - Intronic
1173952050 20:47001122-47001144 CAGTTTCTCCATCTGTACAATGG + Intronic
1174047695 20:47745314-47745336 CAGTTTCCCCATCTGCAAAGCGG + Intronic
1174128528 20:48326143-48326165 CAGTCTCCCCATCTGTACAATGG - Intergenic
1174283570 20:49456481-49456503 CAGTTTCCTCACCTGCAAAAAGG + Intronic
1174300601 20:49579573-49579595 CAGTTTCCTCACCTGGAAAGTGG - Intergenic
1174345098 20:49923246-49923268 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1174360773 20:50027778-50027800 CAGTTTCCTCCCCTGGAAAATGG + Intergenic
1174367165 20:50063641-50063663 CAGTTTCCCCATCTGTACAAGGG - Intergenic
1174374714 20:50118372-50118394 CAGTTTCCTCACCTGCAAAATGG - Intronic
1174396610 20:50250649-50250671 CAGTTTCCCCATCTGCTCAGTGG - Intergenic
1174550155 20:51356350-51356372 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1174551791 20:51367446-51367468 CAGCTTCCTCCCCTGCACACAGG - Intergenic
1174827187 20:53778814-53778836 CAGTTTTCCCACCTGGCAAAGGG + Intergenic
1174855260 20:54038557-54038579 CAGTTTCCCAACCTGTTCATTGG - Intronic
1175146076 20:56897444-56897466 TAGTTTCACCACCTGGAAAATGG + Intergenic
1175242533 20:57560364-57560386 CAGTTTCCCTATCTGTACATGGG + Intergenic
1175247124 20:57588931-57588953 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1175270628 20:57731427-57731449 CAGTTTCCTCACCTGTACAATGG + Intergenic
1175285605 20:57834666-57834688 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1175304465 20:57966444-57966466 CAGTTTCCCCACCTGTAAGTTGG + Intergenic
1175398230 20:58682532-58682554 CAGTTTCCCCCTCTGGAAAAGGG - Intronic
1175407871 20:58746440-58746462 CAGTTTCCACATCTGGAAAACGG + Intergenic
1175411338 20:58771623-58771645 CAGCTTCCCCATCTGTACAACGG + Intergenic
1175417263 20:58810168-58810190 CAGTTTCCACATCTGCAAACAGG + Intergenic
1175578095 20:60077890-60077912 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1175625055 20:60483135-60483157 CAGTTTTCCCTCCTGTACAATGG + Intergenic
1175726035 20:61319241-61319263 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175726454 20:61321981-61322003 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175915295 20:62423221-62423243 CAGTTTCCCCATCTGGAGCGAGG - Intronic
1175943103 20:62546942-62546964 CAGTTTCCCCACCTACAAAATGG + Intergenic
1175967376 20:62666282-62666304 CAGTTTCCCCACCTGTAAAGTGG + Intronic
1176022231 20:62967717-62967739 CAGTTTCCCCACCTGCCAGCGGG + Exonic
1176045064 20:63088260-63088282 CAGTTTCCTCACCTCCAGACGGG + Intergenic
1176047030 20:63097967-63097989 CAGTTTCCCCATCTGTGCAGTGG + Intergenic
1176076422 20:63250395-63250417 CAGTTTCCTCATCTGGAGAATGG + Intronic
1176147080 20:63570324-63570346 CAGTCTCCTCACCTAGAGACAGG - Intronic
1176206171 20:63889420-63889442 CAGCCTCCCCACCAGGACATTGG + Intronic
1176947252 21:14997842-14997864 CAGTTTCCCCATCTGCAAAATGG - Intronic
1178308893 21:31513280-31513302 CAGTTTCCCCACCTGTAAAATGG - Intronic
1178490078 21:33044385-33044407 CAGTTTTCCCAACTGGGGACAGG - Intergenic
1178788394 21:35675559-35675581 CAGTTTCTCCACCTGTAAAATGG - Intronic
1178872915 21:36390963-36390985 CAGTTTCCTCACCTGTAAATGGG - Intronic
1178929166 21:36802550-36802572 CAGTTTCTTCACCTGGAAAATGG - Intronic
1178997234 21:37414397-37414419 TAGTTTTCTCACCTGGACAATGG + Intronic
1179242937 21:39608116-39608138 CAGTTTCCCCATCTACACAGTGG - Intronic
1179408504 21:41144227-41144249 CAGTTTCCTCCTCTGTACACTGG - Intergenic
1179557313 21:42187990-42188012 CAGTTACCTCACCTGGAAAATGG + Intergenic
1179710178 21:43208819-43208841 CAATTTCCCCTCCAGGAGACAGG + Intergenic
1179731431 21:43369926-43369948 CAGTGTCCCCTCCAGCACACAGG + Intergenic
1179801147 21:43811996-43812018 CAGTTTCCTCACCTGCACAAAGG + Intergenic
1180065395 21:45409732-45409754 CAGTTTCCCCTCCTTAACCCCGG + Intronic
1180153197 21:45963021-45963043 CAGTTTACCCACCTGTAAAATGG - Intergenic
1180991766 22:19941497-19941519 CAGTTTCCCCACCTGGGAAGGGG + Intronic
1181001130 22:19988239-19988261 CAGTTCCCCCACCTGCAGAGGGG + Intronic
1181072255 22:20352560-20352582 CAGTTTCTCCACCTGAGCAGTGG - Intronic
1181076542 22:20381882-20381904 CAGTTTCCCCACCCAGCCCCAGG + Intronic
1181141578 22:20809272-20809294 CAGTTTCCCCATATGTAAACTGG + Intronic
1181473995 22:23157633-23157655 CAGTTTTCCCACCTGTAAAATGG - Intronic
1181539533 22:23566085-23566107 CAGTTTCCTCATCTGTAAACCGG - Intergenic
1181545175 22:23598434-23598456 CAGTTTCCTCCTCTGTACACGGG - Intergenic
1181555661 22:23670434-23670456 CAGTTTCCCCACATGTAAGCAGG - Intergenic
1181682023 22:24501888-24501910 CAGTTTCCTCACCTGGTAATGGG - Intronic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1181747341 22:24964755-24964777 CAGTTTCCTCACCTGTAAAATGG - Intronic
1181773983 22:25146646-25146668 CAGTTTCCCCATCTGAAAAATGG + Intronic
1181892701 22:26077862-26077884 CAGTTTCCCCATCTGTAAAAGGG - Intergenic
1181899214 22:26138924-26138946 CAGTTTCCACATCTGGAAAATGG + Intergenic
1181922325 22:26330047-26330069 CAGTTTCCTCATCTGGAAAATGG + Intronic
1182045248 22:27269134-27269156 CAGTTTCCCTACCTGTAAAATGG + Intergenic
1182062183 22:27406185-27406207 CAGTTTCCCCACCTGGAAGGAGG - Intergenic
1182090990 22:27594699-27594721 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1182093043 22:27609059-27609081 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1182112502 22:27733528-27733550 CAGTTTCCTCACCTGCAAAATGG - Intergenic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182282085 22:29223767-29223789 CAGTTTCCCTACCTGGAAAGTGG + Intronic
1182316178 22:29448862-29448884 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1182352968 22:29709212-29709234 CAGTTTCCCCACCTGTAGAATGG - Intergenic
1182353046 22:29709559-29709581 CAGTTTCCCCATCTGGCAATGGG + Intergenic
1182357255 22:29727824-29727846 CGGTTTCCCCACCTGGCATCTGG + Intronic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1182823790 22:33244379-33244401 CAGTTTCCTCATCTGCACAATGG - Intronic
1183005025 22:34894243-34894265 CAATTTCCCCATCTGTACAATGG + Intergenic
1183090904 22:35521170-35521192 CAGTTTCCTCATCTGTAAACTGG + Intergenic
1183090931 22:35521409-35521431 CAGTTTCCCCATCTGAATAATGG - Intergenic
1183091451 22:35525112-35525134 CAGTTTCCTCATCTGCACAATGG - Intergenic
1183095230 22:35547957-35547979 CAGTTTCCCCACTTGTAAAAAGG - Intronic
1183100491 22:35580747-35580769 CAGTTTCCTCACCTGGAAAATGG + Intergenic
1183197714 22:36364901-36364923 CAGTTTCTCCACCTGTAAAATGG + Intronic
1183236410 22:36622081-36622103 CAGTTTCCTCATCTGTAAACAGG - Intronic
1183241627 22:36661862-36661884 CAGTTTCTTCACCTGGAAAATGG + Intronic
1183284264 22:36952536-36952558 CAGTTTCCCCATCTGTGAACTGG + Intergenic
1183349229 22:37325328-37325350 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1183352795 22:37343361-37343383 CAGTTTCCCCACCTAGAGATGGG + Intergenic
1183367514 22:37415014-37415036 CAGTTTCTTCACCTGTACAATGG - Intronic
1183392112 22:37551607-37551629 CAGTTTCCTCATCTGCACAATGG + Intergenic
1183458257 22:37934360-37934382 CAGTTTCCCCACGTGTAGACTGG + Intronic
1183509866 22:38228367-38228389 CAGTTTCCTCACCTGTACCATGG - Intronic
1183548431 22:38467781-38467803 CAGTTTCCTCATCTGTACACAGG - Intergenic
1183580252 22:38720853-38720875 CAGTTTCCCCATCTGTAAAATGG - Intronic
1183597905 22:38823251-38823273 CAGCTGGGCCACCTGGACACAGG + Exonic
1183670714 22:39270774-39270796 CTGTTTCCCCACCTGTAAAATGG + Intergenic
1184062440 22:42091619-42091641 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1184089512 22:42284868-42284890 TGGTTTCCCCATCTTGACACGGG - Intronic
1184093021 22:42302196-42302218 CAGTTTCCCCATCTGGAGAAGGG - Intronic
1184118405 22:42435147-42435169 CAGTTTCCTCATCTGTACAATGG - Intergenic
1184156916 22:42673835-42673857 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1184230311 22:43155178-43155200 CAGTTTCCTCATCTGGAAAATGG + Intronic
1184268639 22:43364657-43364679 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1184286577 22:43475230-43475252 CAGTTTCCTCACCTGTAAAATGG - Intronic
1184303501 22:43578202-43578224 CAGTTTCCCCTCCTGTAGAGTGG + Intronic
1184341911 22:43890918-43890940 CAGTTTCCTCACCTACAAACAGG + Intronic
1184344854 22:43907122-43907144 CAGTTTCCCCACCTATAAAGTGG - Intergenic
1184349562 22:43934828-43934850 CTGTTTCCCCATCTGTACAATGG - Intronic
1184373316 22:44096592-44096614 CAGCTTCCCCATCTGTACAATGG - Intronic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184526085 22:45023776-45023798 CAGTTTCCTCACCTATACAGTGG - Intergenic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
1184608709 22:45589196-45589218 CAGTTTCCTCATCTGGAAAATGG - Intronic
1184645517 22:45892682-45892704 CAGTTTCCCCACTTGTAAAATGG - Intergenic
1184663310 22:45975533-45975555 CAGTTTCTCCACCTGTAAAATGG + Intronic
1184669828 22:46006801-46006823 CAATTTCCCCATCTGCAGACAGG - Intergenic
1184788958 22:46687483-46687505 CAGATTTCCCACCTGGCCATTGG - Intronic
1184846643 22:47091759-47091781 CAGTTTCCTCAGCTGGAAAAAGG - Intronic
1185259444 22:49853616-49853638 TAGTTTGCCCTCCTGGACCCGGG + Intergenic
949373835 3:3364996-3365018 CAGTTTCCTCACCTGTAAAATGG + Intergenic
949488748 3:4567055-4567077 CAGTTTCCCCATCTGTAAAATGG + Intronic
949601731 3:5606469-5606491 CAGTTTCCCCAACTGTAAAATGG - Intergenic
949606089 3:5655823-5655845 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
949825558 3:8161535-8161557 CAGTTTCCTCACCTCCACAAAGG - Intergenic
950053434 3:10008593-10008615 CAGTTTCCTCACCTGGACAGTGG - Intronic
950107088 3:10395052-10395074 CAGTTTCCCCAGCTGCAAATTGG + Intronic
950149186 3:10673047-10673069 CAGTTTCCCCCTCTGGAAAATGG + Intronic
950183505 3:10931213-10931235 CAGTTTCCCCATGTGAACAGTGG + Intronic
950198913 3:11029018-11029040 CAGTTTCCCCTTCTGGAAAATGG - Intronic
950305072 3:11910878-11910900 CAGTTTCCTCACCTGGACAGTGG - Intergenic
950305864 3:11915028-11915050 CAGTTTCCTCACCTTTACAGTGG - Intergenic
950447700 3:13047760-13047782 CAGTTTCCCCATCTGAACAGGGG - Intronic
950643286 3:14362013-14362035 CAGTTTCCCCATCTGTAAAATGG + Intergenic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
950673138 3:14539156-14539178 CAGTTTCCCCAACTGCAAAATGG + Intronic
950676923 3:14559810-14559832 CAGTTTCCCCGTCTGAACACTGG + Intergenic
950678558 3:14569343-14569365 CAGTTTCCCCAACTGTAAAATGG - Intergenic
951064151 3:18244392-18244414 CAGTTTTCTCATCTGTACACTGG + Intronic
951710517 3:25581558-25581580 CAGTTTCCTCACCTGTAAAAAGG - Intronic
951980623 3:28562389-28562411 CAATTTCCCCACCTGTAAAATGG - Intergenic
952760443 3:36908829-36908851 CAGTTTCCTCATCTGAACAGTGG - Intronic
953237304 3:41117938-41117960 CAGTTTCCCCATCTGTAAAAGGG - Intergenic
953252847 3:41262187-41262209 CGGCTTCCCCAGTTGGACACCGG - Intronic
953260776 3:41337055-41337077 CAGTTTCCCCATCTAGAAAATGG - Intronic
953410313 3:42687171-42687193 CAGTTTCCTCATCTGTACAATGG - Intronic
953596411 3:44318583-44318605 CAGTTTCACCACCAGGCCCCAGG + Intronic
953905922 3:46868261-46868283 CAGTTTCCCCACCTGTACCATGG + Intronic
953908600 3:46881241-46881263 CAGTTTCCCCACTTGGTACCGGG + Intronic
954079557 3:48205495-48205517 CAGTTACCCCTTCTGGACAATGG + Intergenic
954304109 3:49716558-49716580 CAGTTTCCTCATCTGGAAAATGG + Intronic
954375085 3:50189844-50189866 CAATTTCTCCACCTGGCAACAGG + Intergenic
954421779 3:50422677-50422699 CAGTTTCCCCATCTGTAGATGGG - Intronic
954624157 3:52013374-52013396 CAGTTTCCCCTTCTGGAAAATGG + Intergenic
954628859 3:52037563-52037585 CAGTCTCCCCATCTACACACTGG - Intergenic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
954673634 3:52303812-52303834 CAGTTTCCCTACCCGCACAATGG - Intergenic
954674748 3:52309561-52309583 CAGTGTCCCCACCTGCAAAAAGG + Intergenic
954704662 3:52473019-52473041 CAGTTTCCCCAACTGTAAAATGG - Intronic
954710638 3:52503633-52503655 CAGTTTCCCCACTTGTAAAGTGG + Intronic
954713408 3:52515845-52515867 CAGTTTCCCCACCCTGCCAGAGG + Intronic
954799206 3:53177493-53177515 CAGTTTCCCCATCTGAAAAGTGG + Intronic
954995157 3:54874660-54874682 CAGTTTCCTCACCTGTACAATGG - Intronic
955007332 3:54981938-54981960 CACTTTCCCCACCCTGCCACAGG - Intronic
955347251 3:58170316-58170338 CAGCTTCCCCATCTGTAAACAGG - Intronic
955350196 3:58187984-58188006 CAGTTTCCTCACCTGTAAACAGG + Intergenic
955410973 3:58655158-58655180 CAGTTTCCCTATCTGTACAAAGG + Intronic
955523186 3:59794964-59794986 CAGTTTCCTCACCTGTAAAGTGG + Intronic
955530706 3:59870040-59870062 CAGTTTCCCCAGCTATACAATGG - Intronic
955780504 3:62479177-62479199 CAATTTCCCCAACTGCACACAGG - Intronic
955857282 3:63286764-63286786 CAGTTTCCTAACCTGAAAACTGG + Intronic
955887738 3:63618719-63618741 CAGTTTCCCCATCTCTACAGTGG + Intergenic
955967976 3:64408538-64408560 CAGTTTCCCCACCTATAAAATGG + Intronic
956190097 3:66600125-66600147 CAGTTTCCCCATCTGTAAAATGG - Intergenic
956511152 3:69994787-69994809 CAGTTTCTCCACCTGCAATCTGG + Intergenic
956553059 3:70483602-70483624 CAGTTTCCACACCTGTAAATGGG + Intergenic
956691913 3:71886520-71886542 CAGTTCCTCCACCTGCACATTGG + Intergenic
956693971 3:71903089-71903111 CAGTTTCCCCATCTGTAGACTGG - Intergenic
956694602 3:71907686-71907708 CAGTTTCCCTATTTGTACACTGG + Intergenic
956724180 3:72143612-72143634 CAGTTTCCTCACCTGTAAAATGG + Intergenic
956847947 3:73201297-73201319 CAGTTTCCCCACCATCAAACTGG + Intergenic
957055525 3:75439774-75439796 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
957944821 3:87050648-87050670 CAGTTTCCCCACATGTGCAATGG - Intergenic
958690643 3:97461387-97461409 CAGTTTCCACATCTGGAAAATGG + Intronic
958982227 3:100735493-100735515 CAGTTTCCTCATCTGTACAAAGG - Intronic
959958893 3:112273510-112273532 CAGTTACCCCACTTGGGCATAGG - Intronic
960739309 3:120815459-120815481 CAGTTTCCCCACCTTTAAAATGG - Intergenic
960955637 3:123028408-123028430 CAGTTTCCTCAGCTGTAAACTGG + Intronic
961134935 3:124501656-124501678 CAATTTCATCACCTGCACACTGG + Intronic
961298864 3:125908832-125908854 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
961328394 3:126125032-126125054 CAGTTTCTCCATCTGTACATTGG - Intronic
961406309 3:126682205-126682227 CAGTTTCCCCATCTGGGCTCAGG + Intergenic
961447199 3:126986427-126986449 CGGTTTCCCCACCTGAGCAGTGG + Intergenic
961631805 3:128306646-128306668 CAGTTTCCCCATCTGTAAAATGG + Intronic
961655307 3:128438541-128438563 CAGTTTCCCCACCTGAAGAATGG - Intergenic
961713176 3:128842595-128842617 CGGTTTCCTCACCTGGACAGTGG + Intergenic
961747071 3:129070966-129070988 CAGTTTCCCCATCTGTAAAATGG - Intergenic
961794160 3:129397524-129397546 CAGTTTCCTCACCTGTAAAATGG + Intergenic
961799906 3:129439681-129439703 CAGTTTCACCACCTGTAAAATGG - Intronic
961821508 3:129577855-129577877 CATCTTCCCCATCTGGACAATGG + Intronic
961829006 3:129613742-129613764 CAGTTTCCCTACCTGTAAATAGG - Intergenic
961889198 3:130116159-130116181 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
961943232 3:130658271-130658293 CAGTTTCCCCATCTGTAAAATGG + Intronic
962000009 3:131285979-131286001 CAGTTTCTTCACCTGTACAATGG + Intronic
962635623 3:137328402-137328424 CAGTTTCCCCACCTGTAAAATGG - Intergenic
962812480 3:138971667-138971689 CAGTTTCCCCATCTGAAAAACGG + Intergenic
962839511 3:139221188-139221210 CTGTTCCCTCACCTGGACCCAGG + Intronic
962869546 3:139476202-139476224 CAGTTTTCTCATCTGGAAACTGG - Intronic
963122741 3:141789860-141789882 CAATTTCCCTACCTGTACAATGG - Intronic
964653700 3:159042808-159042830 CAGTTTCCCCATCTGCAAAGTGG - Intronic
964821475 3:160775135-160775157 CAGTTTCCCCAACTGTAAAATGG - Intronic
965116398 3:164495294-164495316 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
965449640 3:168821453-168821475 CAGTTTCCTCACCTGCATATAGG - Intergenic
965689357 3:171338871-171338893 CAGTTTCCTCACCTGTAAATTGG - Intronic
965737578 3:171837857-171837879 CAGTTTCACCATCTGTACAATGG + Intergenic
966113955 3:176438583-176438605 CAGTTTCCTCACCTGCAAAAAGG + Intergenic
966440331 3:179937881-179937903 CAGTTTCCTCATCTGGAAAGTGG + Intronic
967077043 3:186012847-186012869 CAGTTTCCTCATCTGGAAACAGG + Intergenic
968231439 3:197007044-197007066 CAGTTTCCTCACCTGTAAAATGG - Intronic
968608938 4:1548277-1548299 CAGCTTCCCCTCTCGGACACAGG + Intergenic
968658184 4:1787555-1787577 CAGTTTCCCCACCTGTCAAGTGG + Intergenic
968704379 4:2071178-2071200 CAGTTTCCCCACGTGCAAAGAGG + Intergenic
968830356 4:2930431-2930453 CAGTTTCCCCCTCTGCACAGTGG - Intergenic
968854401 4:3108498-3108520 CAGTTTGCCCATCTGTACACTGG + Intronic
968969298 4:3785225-3785247 CAGTTTCCCCATCTGCAAAGTGG - Intergenic
968998338 4:3960082-3960104 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
969101846 4:4775345-4775367 CAGTTTCCTCACCTATAAACTGG + Intergenic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969229515 4:5820130-5820152 CAGTTTCCTCATCTGTACAATGG + Intronic
969243724 4:5918980-5919002 CAGTTTCCCCATCTGTGCAGAGG - Intronic
969276097 4:6136933-6136955 CAGTTTCCTCATCTGTACAATGG - Intronic
969326336 4:6446479-6446501 CAGTTTCCTCATCTGTACAACGG + Intronic
969343607 4:6557815-6557837 AATATTCCCCACCTGGGCACTGG + Intronic
969363134 4:6677892-6677914 AAGTTTCCCCACCTGAACAATGG - Intergenic
969606163 4:8203340-8203362 CAGTTTCCCCATCTCTGCACTGG + Intronic
969616027 4:8253031-8253053 CAGTTTCCCCACCTGTAATGTGG + Intergenic
969702015 4:8772959-8772981 CAGTTTCCCCATCTCTACATGGG + Intergenic
969755661 4:9148570-9148592 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
969815550 4:9684695-9684717 CAGTTTCCCCAACTGTAAAATGG + Intergenic
969845285 4:9915574-9915596 CAGTTTCCCCAGCTGTAGAGTGG - Intronic
969875039 4:10129979-10130001 CAGTTTCCTCATCTCTACACTGG - Intergenic
970171269 4:13292882-13292904 CAGTTTCCTCACCTGTAAATTGG - Intergenic
970507411 4:16745317-16745339 CAGTCTCCCCGCCTGGGCTCTGG - Intronic
971008994 4:22409528-22409550 CAGTTTCCACATCTGTACAGTGG + Intronic
971163814 4:24161503-24161525 CAGTTTCCTCACCTGGAAAATGG + Intergenic
971385743 4:26139208-26139230 CAGTTTCCTCATCTGGGCAGTGG + Intergenic
972011883 4:34193046-34193068 CAGTTTCCTCACCTGTAAAATGG - Intergenic
972636755 4:40891114-40891136 CAGTTTCCCCAGCTGCTAACTGG - Intronic
972796546 4:42426545-42426567 CAGTTTCCTCAGCTGTACAGTGG + Intronic
973680433 4:53312402-53312424 CAGTTTCCCTACCTGCAAAATGG + Intronic
973796374 4:54431667-54431689 CAGTTTCCCCACCTCTGCAATGG + Intergenic
973814260 4:54604288-54604310 CACCTTCCCCACCTTGCCACAGG - Intergenic
973909982 4:55570539-55570561 CAGTTTCCCTAACTGTACATGGG + Intronic
973989944 4:56394824-56394846 CAGTTTCCCCACATGTGCAATGG - Exonic
973993017 4:56430367-56430389 CAGTTTCCTCATCTGTACATTGG - Intronic
974101934 4:57426593-57426615 CAGTTTCCTCACCTGTAAAACGG + Intergenic
975263088 4:72328583-72328605 CAGTTTCCTCACCTGTAAACTGG + Intronic
975495065 4:75028041-75028063 CAGTTTCCCCAACTGTAAAATGG + Intronic
975497512 4:75051274-75051296 CAGTTTCCCCATCTGTAAAATGG - Intergenic
975959555 4:79885439-79885461 CAGTTTCCTCATCTGTAAACTGG - Intergenic
977904646 4:102461479-102461501 CAGTTTCCCTGTCTGGACTCTGG - Intergenic
977913411 4:102563643-102563665 CAGTTTCCCCATCTGTAAAAGGG - Intronic
978624497 4:110669258-110669280 CAGTTTCTCCACCTACACAATGG + Intergenic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
979392538 4:120143580-120143602 CAGTTTCCTCACCTGTAGAATGG - Intergenic
979477747 4:121178244-121178266 CAGTTTCCCCATCTGTAGAGGGG + Intronic
979607826 4:122657740-122657762 CAGTTTCCTCATCTGGAGAATGG + Intergenic
980364073 4:131776549-131776571 CAGGTTCTGCACATGGACACAGG - Intergenic
980830698 4:138127051-138127073 CAGAGTCCCCACCAGGCCACTGG + Intergenic
981098632 4:140807093-140807115 CTGGTTTCCCACCTGGAAACAGG + Intergenic
981144435 4:141308625-141308647 CCTTCTCCCCACTTGGACACAGG - Intergenic
981663494 4:147195107-147195129 CAGTTTCCCCATTTGAAAACAGG - Intergenic
982129084 4:152211184-152211206 CAGTTTCCTCACCTGCAAAATGG + Intergenic
982720369 4:158853570-158853592 CAATGTCCCCACTTGGACACAGG - Intronic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
984001343 4:174250153-174250175 CAGTTTCCCCATCTGTAAAATGG - Intronic
984035090 4:174657329-174657351 CAGTTTACCCATTTGGACACCGG + Intronic
984610105 4:181828148-181828170 CAGCTTCCCCTCCTGGAGCCAGG - Intergenic
985172955 4:187172025-187172047 CAGTTTCCTCATCTGTACAATGG - Intergenic
985262830 4:188130546-188130568 CAGTTGCCCAGCTTGGACACTGG - Intergenic
985886982 5:2687441-2687463 CAGTTTCCCCACATGTAAACTGG + Intergenic
986231062 5:5865072-5865094 CAGTTTCTCCACCTACAGACAGG - Intergenic
986317113 5:6597052-6597074 CAGAGCCCCCACGTGGACACTGG - Intergenic
987029317 5:13961230-13961252 CAGTTTCCTCATCTGGAAAATGG - Intergenic
988507263 5:31834224-31834246 CAGGTGCTCCAACTGGACACAGG - Intronic
988551723 5:32206243-32206265 CAGTTTCTCCATCTGGAGAATGG - Intergenic
988997625 5:36729620-36729642 CAGTTTCCCCACCTGTACAATGG + Intergenic
988997859 5:36731506-36731528 CAGTTTCCTCATCTGGAAAATGG - Intergenic
988998689 5:36739104-36739126 CAGTTTCCCCATCTGTAAAATGG + Intergenic
989107582 5:37878311-37878333 CAGTCTCCCCACCTGTAAAATGG + Intergenic
989123208 5:38025607-38025629 CAGTTTCCTCACCTGCACGGTGG + Intergenic
989152642 5:38315721-38315743 CAGTTTCCTCATCTGTACAATGG + Intronic
989226225 5:39032698-39032720 CAGTTTTCCTACCTAGGCACTGG - Intronic
989546313 5:42678123-42678145 CAGTTTCCTCACCTGTAAAATGG - Intronic
990003943 5:50923562-50923584 CAGCTTCCCCTCTCGGACACAGG - Intergenic
990228265 5:53681292-53681314 CAGTTTACTCACCTGTACAAGGG + Intronic
990544311 5:56807209-56807231 CAGTTTCTTCACCTGGAAAATGG + Intergenic
991306569 5:65182585-65182607 CAGTTTCCACACCTGTAAAATGG - Intronic
991474765 5:67007369-67007391 AGGTGTCCTCACCTGGACACTGG - Intronic
991655007 5:68895242-68895264 CAGTTTCCCCACCTGTAAAATGG - Intergenic
992024926 5:72660673-72660695 CAGTTTCCCCACCTACAAAATGG + Intergenic
992030776 5:72719402-72719424 TAGTTTCCTCACCTGGGAACAGG + Intergenic
992127034 5:73652789-73652811 CAGTTTCCCCATCTGTAAATTGG - Intronic
992389181 5:76314661-76314683 CATTTTCCTCACCTGAACATGGG - Intronic
992783374 5:80147883-80147905 CAGTTTCCTCAGCTGTACACAGG - Intronic
993514338 5:88811944-88811966 CAGTTTCCTCACCTGGAAAGTGG + Intronic
993531730 5:89033652-89033674 CAGTTTCCACACCTGTAAATTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995885251 5:116887437-116887459 CAGTTTCCTCATCTGGAAATGGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996566165 5:124881469-124881491 CTGTTTCACCAGCTGCACACTGG + Intergenic
997472963 5:134126951-134126973 CAGTTTCCCCATCTGCAAAAAGG - Intronic
997492417 5:134288786-134288808 CAGTTTTCCCAGCTGGATAATGG - Intronic
997590770 5:135070911-135070933 CAGTTTCCTCACCTATACATAGG - Intronic
997801142 5:136863764-136863786 CAGTTTCCCCATCTTGATAATGG - Intergenic
998013952 5:138717585-138717607 CAGTTTCCACATCTGTACAATGG + Intronic
998196715 5:140079814-140079836 CAGTTTCCCCAACTGTAAATTGG - Intergenic
998376620 5:141695096-141695118 CAGTTTCCTCAGCTGCAAACAGG + Intergenic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
998560965 5:143171231-143171253 CAGTTTCCCCATCTGTAAAATGG - Intronic
998572941 5:143281012-143281034 CAGTTTACCCAGCAGGTCACTGG + Intronic
998889846 5:146734443-146734465 CAGTTTCCTCACCTGCAAAGTGG - Intronic
999102630 5:149038963-149038985 CAGTCTCCCCAACTGGAAAATGG + Intronic
999147790 5:149407213-149407235 CAGTTTCCCCATCTGTACAGGGG + Intergenic
999149589 5:149417913-149417935 CAGTTTCCTCATCTGAACAATGG + Intergenic
999186564 5:149715044-149715066 CAGTTTCCTCATCTGTACAGTGG + Intergenic
999242914 5:150137766-150137788 CAGTTTCCCCATCTGCACCCTGG - Intronic
999243730 5:150142143-150142165 CAGTTTCCCCACGAGCACAATGG - Intronic
999259555 5:150229474-150229496 CAGTTTCCCCATATGTACAATGG - Intronic
999282594 5:150375066-150375088 CTGCTTCCCCACCTGGACCTGGG - Exonic
999291118 5:150427183-150427205 CAGTTTCCTCACCTGTAAAATGG + Intergenic
999292043 5:150432207-150432229 CAGTTTCCTCACCTGTAAAATGG + Intergenic
999447521 5:151652056-151652078 CAGTTTCCCCACCTGCATAGTGG + Intergenic
999707881 5:154290671-154290693 CAATTTTCCCACCTGGAAAATGG - Intronic
999766988 5:154748748-154748770 CAGTTTCCCCATCTGTAAATTGG - Intronic
1000093393 5:157949570-157949592 CAGTTTCCTCATCTGAACAAGGG + Intergenic
1000336030 5:160242177-160242199 CAGTTTCCTCACCTGTAAATGGG + Intergenic
1000700363 5:164442216-164442238 CAGTTTCCCCATCTTGTCAATGG - Intergenic
1000898739 5:166888288-166888310 CAGTTTCCTTGCCTGGAAACAGG - Intergenic
1000954943 5:167532111-167532133 CAGTTTCCTCACCTGAAAATGGG - Intronic
1000998220 5:167980465-167980487 CAGTGTGACCACCTGGACATGGG + Intronic
1001109973 5:168887474-168887496 CAGTTTCCCCATCTTTACAGTGG + Intronic
1001126579 5:169024871-169024893 CAGTATCCCCACAGGGCCACAGG + Intronic
1001165410 5:169361246-169361268 CAGTTTCCTCATCTGTAAACTGG - Intergenic
1001257857 5:170198507-170198529 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1001274632 5:170341414-170341436 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1001285067 5:170416815-170416837 CAGTTTCCCCATCTGTAAAATGG - Intronic
1001397356 5:171426881-171426903 CAGTTTCCCCATCTGTAAAATGG + Intronic
1001401081 5:171446733-171446755 CAGTTTCCCTACCTGTGCAAGGG - Intronic
1001555579 5:172634727-172634749 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1001562264 5:172677448-172677470 CAGTTTCCCCACTTGCAAAGTGG - Intronic
1001568937 5:172717744-172717766 CAGTTTCCCCACCTATAAAATGG - Intergenic
1001569558 5:172721225-172721247 CGGTTTCCCCACCTGTAAAATGG + Intergenic
1001586307 5:172835406-172835428 CAGTTTCACCACCTGCAAATTGG + Intronic
1001757106 5:174179082-174179104 CAGTTTCCTCATCTGTACATTGG - Intronic
1002053504 5:176585171-176585193 CAGTTTCCCCATCTGTCCAGTGG + Intronic
1002303094 5:178268591-178268613 CAGTTTCCCCATCTGTAGAGTGG - Intronic
1002313947 5:178331420-178331442 CAGTTTCCCCATCTGTAAACTGG + Intronic
1002334229 5:178466946-178466968 CAGTTTCCCCAGCTGTAAAATGG + Intronic
1002613436 5:180436047-180436069 CAGTTTCCCCATCTGTAAAGGGG - Intergenic
1002829017 6:801850-801872 CACCTTCCCCACCAGGAAACAGG + Intergenic
1002879575 6:1238888-1238910 CAATCTGCCCACGTGGACACTGG + Intergenic
1002919984 6:1561222-1561244 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1005034925 6:21546702-21546724 CAGTTTCCTCATCTGTAAACTGG + Intergenic
1005949973 6:30624721-30624743 CAGTTTCCCCATCTGCCCAAAGG - Intronic
1006379729 6:33690524-33690546 CAGTTTCCTCACCTGTAAAATGG + Intronic
1006381170 6:33698145-33698167 CAGTTTCCACACCTGAAAACTGG - Intronic
1006429961 6:33989281-33989303 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1006508955 6:34511436-34511458 CAGTTTCCACACCTGTATAATGG + Intronic
1006535744 6:34697148-34697170 CAGTTTCCTCACCTGCAAAATGG - Intergenic
1006591575 6:35161868-35161890 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1006645306 6:35511433-35511455 CAGTTTCTCCATCTGTACAATGG + Intronic
1006779300 6:36621308-36621330 CAGTTTCCACATCTGCACAATGG - Intergenic
1006779773 6:36624422-36624444 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1006812126 6:36826870-36826892 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1006812765 6:36830731-36830753 CAGTTTCCTCATCTGGGCATGGG + Intronic
1006827654 6:36948037-36948059 CTGTTTCCACATCTGTACACTGG - Intergenic
1006908910 6:37551186-37551208 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1006921634 6:37631483-37631505 CAGTTTCCCCATCTGGAACATGG + Exonic
1006942658 6:37763234-37763256 CAGTTTCTCAATCTGGACAGTGG - Intergenic
1007107963 6:39296278-39296300 CAGTTTCCTCACCTGTAAAAGGG - Intergenic
1007252829 6:40507973-40507995 CAGTTTCCTCACCTTTCCACTGG - Intronic
1007281283 6:40714155-40714177 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1007283613 6:40731033-40731055 CAGTTTCCTCACCTGTATAATGG - Intergenic
1007474830 6:42112488-42112510 CAGTTTCCCCATCTGGGAAATGG + Intronic
1007691384 6:43703716-43703738 CAGTTTCCTCATCTGTACAATGG + Intergenic
1007706920 6:43796718-43796740 CAGTGTCCCTACCTGTACAATGG + Intergenic
1007734013 6:43969240-43969262 CAGTTTCCCCATCTGTGCAATGG + Intergenic
1007960268 6:45952521-45952543 CAGTTTCCTCATCTGTACAATGG - Intronic
1008000976 6:46359200-46359222 CAGGTGCCCAACCTTGACACTGG + Intronic
1008062496 6:47013361-47013383 CAGTTTCCTCATCTGTAAACTGG - Intronic
1010197962 6:73258748-73258770 CAGTTTCCCTACCTGTAAAATGG + Intronic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1011580487 6:88858637-88858659 CAGTTTCCTCATCTGGAAAATGG - Intronic
1011689822 6:89856919-89856941 CAGCTTCCCCACCTGTATAAGGG + Intronic
1012444321 6:99292661-99292683 CAGTTTTCCCATCTGGAAATGGG + Intronic
1012956749 6:105579189-105579211 CAGTTTCTTCACCTGGAAACAGG + Intergenic
1013316633 6:108949606-108949628 CAGTTTTCCAACCAGGACAGAGG - Intronic
1013401374 6:109800060-109800082 CAGTTTCCCCATCTGTAAAATGG - Intronic
1013414305 6:109911228-109911250 CAGTTTCCCCATCTGTAAAATGG + Intergenic
1013978407 6:116101992-116102014 CAGTTTCCCCATCTGTAAAATGG + Intronic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1014756400 6:125305962-125305984 CAGTTTCCCCATCTGGAATGTGG - Intergenic
1014880025 6:126712156-126712178 CAGTTTTCCCAACTTGACATTGG - Intergenic
1016276912 6:142364631-142364653 CAGTTTCTCCACCTTTACACTGG - Intronic
1016374892 6:143410090-143410112 CAGTTTCCTCACCTGAAAAATGG + Intergenic
1016974214 6:149791099-149791121 CAGTTTCCCCACCGGGCCCTGGG + Intronic
1017086504 6:150717624-150717646 CAGTGTCCCCACCTGGAGTGGGG - Intronic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1017847569 6:158272620-158272642 CAGTTTCCCCAACTGTAAAATGG - Intronic
1018001188 6:159580020-159580042 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1018021786 6:159767941-159767963 CAGTTTCCTTACCTGTAAACTGG - Intronic
1018750768 6:166802646-166802668 CAGTTTCTCCAGCTGCAAACTGG - Intronic
1018945435 6:168344636-168344658 CAGTTTCCATATCTGTACACTGG + Intergenic
1018981365 6:168604131-168604153 CAGGTTCCCCTCTTGGTCACAGG + Intronic
1019196156 6:170284328-170284350 CAGTTTCCCCATCTGAAACCTGG - Intronic
1019342449 7:514990-515012 CAGTCTCCCCAACTGTACAGTGG + Intronic
1019496877 7:1344915-1344937 CAGTTTCCCCAGCTGTAAACTGG + Intergenic
1019498030 7:1349562-1349584 CAGTTTCTCCATCTGAACAATGG + Intergenic
1019510135 7:1413731-1413753 CAGTTTCCCCATCTGTACAATGG + Intergenic
1019533054 7:1513231-1513253 CAGTTCCCCCACCTGGAAAATGG + Intergenic
1019994043 7:4711842-4711864 CAGGTCCCCCGCCTTGACACCGG - Intronic
1020089909 7:5333168-5333190 CAGTTTCCTCTCCTGGAAACGGG - Intronic
1020130889 7:5558033-5558055 CAGTGTACCCAACGGGACACAGG + Intronic
1020138187 7:5598164-5598186 CAGTTTCCCCACCTGTCAAAAGG - Intronic
1020257644 7:6510848-6510870 CAGTTTTCCCACCTGCAAAATGG - Intronic
1020721573 7:11751548-11751570 CATTTTGACCACCTGGACTCTGG - Intronic
1021919014 7:25465127-25465149 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1022121341 7:27311223-27311245 CAGTGTCCTCATCTGGACGCTGG + Intergenic
1022130831 7:27402930-27402952 CAGTTTTCTCACCTGGAAAATGG - Intergenic
1022319451 7:29275116-29275138 CAGTTTCCTCACCTGTAAAATGG + Intronic
1022474073 7:30699146-30699168 CAGTTTCCCCATCTGTAAAATGG + Intronic
1022483642 7:30760717-30760739 CAGTTTCCTCACCTGTAAAATGG - Intronic
1022494600 7:30844958-30844980 CAGTTTCCCCATCTGTACCATGG - Intronic
1022496319 7:30855190-30855212 CAGTTTCCTCATCTGGAAAATGG + Intronic
1022506757 7:30912364-30912386 CAGTGTCCCCATCTGCACAATGG - Intronic
1022652288 7:32288225-32288247 CAGTTTCTCCACCTGTAAAATGG + Intronic
1023124616 7:36943120-36943142 CAGTTCCCACATCTGTACACTGG + Intronic
1023553100 7:41389692-41389714 CAGTTTCCCCATCTGGAAAGTGG - Intergenic
1024062707 7:45710688-45710710 CAGTTTCCTCACCTGAAGAATGG - Intronic
1024192124 7:47023081-47023103 CAGTTTCCCCATCTGTAAAACGG + Intergenic
1024244101 7:47456408-47456430 CAGATTCCCCACCTGGGGAATGG + Intronic
1024508754 7:50185774-50185796 CAGTTTCCCCACGTGTAAAATGG + Intergenic
1025723072 7:64034029-64034051 CAGTTTCCTCACCTGTATAATGG + Intronic
1025924492 7:65945980-65946002 TAGTTTCCCCATCTGTACTCTGG + Intronic
1025931813 7:66001209-66001231 TAGTTTCCCCATCTGTACTCTGG + Intergenic
1026115047 7:67489029-67489051 CAGTTTCCCCATCCGTAAACTGG - Intergenic
1026266162 7:68797749-68797771 CAGTTTCCCCATCTGTAAACTGG + Intergenic
1026442589 7:70457235-70457257 CAGTTTTCCCACCTGTAAACGGG + Intronic
1026492545 7:70875228-70875250 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1026940958 7:74287726-74287748 CAGTTTCCCCATCTGTAAATTGG - Intergenic
1027250637 7:76396678-76396700 CAGCTTTCCCACCTATACACTGG + Intronic
1028254161 7:88571629-88571651 AAGTTTCCATACCAGGACACTGG + Intergenic
1028628849 7:92910446-92910468 CAGTTTCCTCATCTGTAAACTGG + Intergenic
1029026560 7:97423019-97423041 CAGTTTCCTCATCTGTACAAAGG - Intergenic
1029129067 7:98316358-98316380 CATTTTCCCCATCTGTACAATGG + Intronic
1029177774 7:98677085-98677107 CAGTTTCCCCTTCTGTAAACTGG + Intergenic
1029422276 7:100477808-100477830 CAGCTTCACCACCCGGAAACGGG + Exonic
1029506711 7:100967406-100967428 CAGTTTCCTCACCTGCAAAACGG + Exonic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1029611499 7:101628943-101628965 CAGTTTCCTCATCTGGAAAATGG - Intronic
1029625014 7:101715335-101715357 CAGTTTCCCCATCTGTAAAAGGG - Intergenic
1029689444 7:102171288-102171310 CCGTTTCCCCGCCTGTAAACTGG + Intronic
1029811178 7:103050638-103050660 CACCTTCCCCACCTTGCCACAGG - Intronic
1029935762 7:104422668-104422690 CAGTTTCCTCATCTGTACAAAGG + Intronic
1029946692 7:104540726-104540748 CAGTTTCCCCACCTGAAAGAGGG - Intronic
1030100694 7:105942541-105942563 CAGTTTCCCCACCTGTAAAATGG + Intronic
1030172320 7:106615980-106616002 CAGTTTCCTTATCTGGAAACTGG + Intergenic
1030326953 7:108229936-108229958 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1031124219 7:117755563-117755585 CAGTTTCCCCATCTGTAAAATGG + Intronic
1031899715 7:127395247-127395269 CAGTTTTCCCACCTGCAGAATGG - Intronic
1032196833 7:129794298-129794320 CAGTTTCCCCACCTGTGAAGTGG - Intergenic
1032498020 7:132377489-132377511 CAGTTTTCCTACCTGCACAGGGG - Intronic
1032517811 7:132519872-132519894 CAGTTTCCCCATCTGTAAAATGG + Intronic
1033234758 7:139629521-139629543 CTGTTTCCCCATCTGGAAAATGG - Intronic
1033671597 7:143498663-143498685 CAGTTTCCCCAGCCTGATACGGG + Intergenic
1034061842 7:148099169-148099191 CAGTTTCCCCACATGAAAAGTGG + Intronic
1034069623 7:148171120-148171142 CAGTTTCTCCATCTGTACAATGG + Intronic
1034139268 7:148801368-148801390 CAGTTTCCCCACCTGCAGAAAGG - Intergenic
1034480017 7:151312522-151312544 CAGTTTCCCCACCTACACAAGGG - Intergenic
1034520395 7:151614848-151614870 CAGTCTCCTCACCTTTACACTGG + Intronic
1034560556 7:151877045-151877067 CAGATTCCCCACTTGGGCACAGG - Exonic
1035025039 7:155819712-155819734 CAGTTTCCCCATCTGTGCAATGG - Intergenic
1035374479 7:158398392-158398414 CTGTTGCCTCACCTGGTCACAGG + Intronic
1035624531 8:1061031-1061053 CAGTTCCCCCACGTGGGCAGAGG + Intergenic
1035945443 8:3956307-3956329 CAGTTTCCCCATCTTGAGATGGG - Intronic
1036378908 8:8223876-8223898 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1036387293 8:8293528-8293550 CAGTCTCCCCATCTGGAAAGCGG + Intergenic
1036604961 8:10296665-10296687 CAGTTTCTTCACCTGCAAACTGG - Intronic
1036850658 8:12198724-12198746 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1036872023 8:12440989-12441011 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1037484675 8:19336143-19336165 CAGTTTCCCCAGCTGTAAAATGG - Intronic
1037590304 8:20306368-20306390 CAGTTTCCTCATCTGGAAAGTGG + Intergenic
1037590321 8:20306465-20306487 CAGTTTCCTCATCTGGAAAGTGG + Intergenic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1037917382 8:22780958-22780980 CAGTTTCCTCAGCTGGAGATGGG - Intronic
1038106418 8:24440139-24440161 CAATTTCCCCACCTGCAAAGTGG + Intergenic
1038310916 8:26445646-26445668 CAGTTTCCTCACCTGCCCACAGG + Intronic
1038437155 8:27544183-27544205 CAGATTCCCCACCTGAAAAGGGG + Exonic
1038938891 8:32282143-32282165 GAGTTTGCACAGCTGGACACAGG + Intronic
1040421273 8:47242481-47242503 CAGTTTCCCCATATGTAAACAGG + Intergenic
1040598503 8:48862516-48862538 CTGTTTCTCTACCTGGATACTGG - Intergenic
1040769811 8:50960075-50960097 AAGTTTCCCCACCGTGACTCAGG - Intergenic
1040801017 8:51340141-51340163 CAGCTTCCCTACCTGGCTACTGG - Intronic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1041619016 8:59943493-59943515 CAGTTTCCCCACTTGGAAATTGG - Intergenic
1043773828 8:84239512-84239534 CAGTTTCCTCATCTGTACAATGG - Intronic
1043872677 8:85452141-85452163 CAGTTTCCTCATCTGTAAACAGG + Intergenic
1044107703 8:88232296-88232318 CAGTTTTCCCACCTGTAAAATGG - Intronic
1044217995 8:89635570-89635592 CAGTTTCCTCACCTGCAAATGGG - Intergenic
1044537140 8:93370158-93370180 CAATTTCCCCAACTGTACAATGG + Intergenic
1044844629 8:96368050-96368072 CAGTTTATCCACATTGACACTGG + Intergenic
1045030644 8:98132240-98132262 CAGTTTCCCCATCTGTAAAATGG - Intronic
1045175901 8:99724566-99724588 CAGTTTCCTCAACTGAACATTGG + Intronic
1045266876 8:100626267-100626289 CAGTTTCCCCATCTGTAAAATGG - Intronic
1045497831 8:102723062-102723084 CAGTTTCCTCAACTGGAAAATGG + Intergenic
1045772777 8:105763633-105763655 CAGTTTCCTCATCTGGAAAATGG - Intronic
1046139615 8:110073281-110073303 TATTTTACCCTCCTGGACACAGG - Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047199717 8:122754960-122754982 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1047204506 8:122792653-122792675 CAGTTCCCCCACCTGTAAAATGG - Intronic
1047205744 8:122802020-122802042 CAGTTTCCCCACTTAGAAAGTGG + Intronic
1047213989 8:122862357-122862379 CGGTTTCCCCACGTGGAGAATGG + Intronic
1047313361 8:123710765-123710787 CAGTTTCCTCAGCTGGAAAATGG + Intronic
1047422574 8:124719214-124719236 CAGTTTCCCCATCTGTAAAATGG + Intronic
1047435730 8:124834270-124834292 CAGTTTCTCCACCTGCAAAATGG - Intergenic
1047545328 8:125811092-125811114 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1047797480 8:128272890-128272912 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1048051270 8:130819108-130819130 CAGTTTCCTCACCTGTAAAATGG - Intronic
1048197523 8:132344544-132344566 CAGTTTCCTCATCTGCACAGTGG - Intronic
1048207048 8:132423652-132423674 CAGTTTACCCAACTGCACAGTGG - Intronic
1048297339 8:133224106-133224128 CAGGATCCCCACCTGCACATGGG - Intronic
1048321751 8:133405590-133405612 CAGTTTCCTCACCTGTTCATGGG - Intergenic
1048436984 8:134427333-134427355 CAGTTTCCTCACCTGTAGAGTGG - Intergenic
1048589499 8:135808090-135808112 CTGTTTCCCCACCTGTAAAATGG - Intergenic
1048806082 8:138242538-138242560 CAGTTTTCCCACCTGTAGAGTGG - Intronic
1048885850 8:138908999-138909021 CAGTTTCCTCATCTGGTGACTGG - Intronic
1048965425 8:139611285-139611307 CAGTTTCCCCACCTTTAAATTGG - Intronic
1049031749 8:140043379-140043401 CATTTTCCTCACCTGGAGAATGG - Intronic
1049189916 8:141281403-141281425 CAGTTTCCCCACCTGTAAATGGG + Intronic
1049354762 8:142182235-142182257 CAGTCTCCCCATCTGGAAAGTGG + Intergenic
1049420090 8:142512651-142512673 CAGTTTCCTCACCTGTAAAAGGG + Intronic
1049425751 8:142537210-142537232 CAGTTTCCCCAACTGCACACTGG - Intronic
1049993043 9:1007968-1007990 CAATTTCCCCACCTGTAAAATGG + Intergenic
1050090198 9:2010719-2010741 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1050285734 9:4099974-4099996 CAGTTTCCCAGCCTGTAAACTGG + Intronic
1050596756 9:7211817-7211839 AAGTTTCCCCATCTGGAAAATGG - Intergenic
1050712857 9:8485775-8485797 CAGTGTCCTGAACTGGACACTGG + Exonic
1051009236 9:12390330-12390352 CAGTTTCTCCATCTGTAAACTGG + Intergenic
1051250198 9:15151515-15151537 CAGTTGCCTCACCAGGACAGTGG - Intergenic
1052021183 9:23527342-23527364 CAGTTTCCACACTTGGAAAAGGG - Intergenic
1052870082 9:33496881-33496903 CAGTTTCTCTACCTGTAAACTGG + Intergenic
1053270679 9:36747348-36747370 CAGTTTCCTCACCTGCAAAATGG + Intergenic
1053287311 9:36858415-36858437 CAGTTTCCCCAAATGGACAATGG + Intronic
1053392920 9:37748745-37748767 CAGTTTCCCCATCTGGCAAAAGG + Intronic
1053411766 9:37920452-37920474 CAGTTTCCTCCTCTGGAAACTGG - Intronic
1053489631 9:38488951-38488973 CAGTTTCCACACCTGTAAAATGG - Intergenic
1053628423 9:39902434-39902456 CAGGTTCTGCACATGGACACAGG - Intergenic
1053777636 9:41563893-41563915 CAGGTTCTGCACATGGACACAGG + Intergenic
1053791687 9:41690794-41690816 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1053887219 9:42652860-42652882 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1054153471 9:61623976-61623998 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1054180088 9:61902809-61902831 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1054215464 9:62348267-62348289 CAGGTTCTGCACATGGACACAGG + Intergenic
1054226239 9:62460311-62460333 CAGTTTCCTCACCTGTAGAATGG + Intergenic
1054473265 9:65555177-65555199 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1054657503 9:67678332-67678354 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1054672017 9:67807080-67807102 CAGGTTCTGCACATGGACACAGG - Intergenic
1054720867 9:68602429-68602451 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1054985554 9:71258242-71258264 CAGTTTCCCCATCTGAAAAGTGG - Intronic
1055142518 9:72892078-72892100 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1055301335 9:74886599-74886621 CATTTTCCTCACCTGTAAACCGG + Intronic
1055640457 9:78315340-78315362 CAGTTTCCTCATCTGGAAAATGG + Intronic
1055642164 9:78327790-78327812 CAGTTTCCTCACCTGAATACTGG - Intronic
1056547081 9:87621889-87621911 CAGTTCCCCCACATCCACACTGG + Intronic
1056676654 9:88682042-88682064 CAGTTTCCCCAACTGTAAAATGG - Intergenic
1057051697 9:91928645-91928667 CAGTTTCCCCATCTGTAAAAGGG + Intronic
1057077411 9:92145810-92145832 TAGTTTCCTCACCTGTAAACAGG + Intergenic
1057141128 9:92727420-92727442 CAGTTTCCCCATCTGTAAACCGG - Intronic
1057173386 9:92976948-92976970 CAGTTTCCACAACTGCACAGTGG + Intronic
1057180738 9:93028722-93028744 CAGTTTCCTCACCTGTAAAATGG - Intronic
1057187100 9:93063058-93063080 CAGTTTCCTCATCTGGAAAATGG + Intronic
1057307112 9:93918852-93918874 CAGTTTCACCACCTGGAAAAGGG + Intergenic
1057481294 9:95447384-95447406 CAGCAGCCCCACCTGGACTCAGG - Exonic
1057517794 9:95736677-95736699 CAGTTTTCCTACCTGCACAATGG - Intergenic
1057688317 9:97258191-97258213 CAGTTTCTCTACCTGTAAACTGG - Intergenic
1057774430 9:97994974-97994996 CAATTTCCTCACCTGTAAACTGG + Intronic
1057810291 9:98252135-98252157 CAGTTTCCTCATCTGTACTCTGG + Intronic
1057821411 9:98333905-98333927 CAGTTTCCTCATCTGTAGACTGG + Intronic
1057847852 9:98539202-98539224 CAGTTTCCCCATCTGTAAAATGG + Intronic
1057947889 9:99345407-99345429 CAGCTTCCCCATCTGCAGACTGG + Intergenic
1058033538 9:100225478-100225500 CAGTTTCCTCACCTGTAAATTGG + Intronic
1058082414 9:100713917-100713939 CAGTTTCCTCATCTAGACAATGG + Intergenic
1058326951 9:103710473-103710495 TAGTTTACACACATGGACACAGG + Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1058793072 9:108470520-108470542 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1058899392 9:109429238-109429260 CAGTTTCCTCATCTGAAAACTGG - Intronic
1058923820 9:109642257-109642279 CATTTTCCCCATCTGGAAAATGG + Intronic
1059078164 9:111217497-111217519 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1059115514 9:111597673-111597695 CAGTTTCCTCATCCGTACACTGG - Intronic
1059353338 9:113681469-113681491 CAGTTTCCCCATCTGTAAAAGGG - Intergenic
1059354557 9:113688546-113688568 CAGTATCCCCACCTGCAAAATGG - Intergenic
1059365385 9:113782820-113782842 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1059367117 9:113794891-113794913 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1059419967 9:114184741-114184763 CAGTTTCCCCATCTGTAAATGGG - Intronic
1059439933 9:114301216-114301238 CAGTTTCCTCATCTGGAAATGGG + Intronic
1059466377 9:114471339-114471361 CAGTTTCCTCATCTGGAAAGTGG - Intronic
1059520330 9:114934660-114934682 CAGTTTCCCTACCTACACAATGG - Intergenic
1059752131 9:117257891-117257913 CAGTTTTCCCACCTATACAGTGG + Intronic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1059926102 9:119210799-119210821 CAGTTTCCCCATCTGCTAACAGG + Intronic
1060050503 9:120375181-120375203 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1060103859 9:120861665-120861687 CAGTGTCCCTACCTGGACAGTGG + Intronic
1060175338 9:121493439-121493461 CAGTTTCCCCACATGCAAAATGG + Intergenic
1060204264 9:121673369-121673391 CAGTTTCTCCATCTGGAAAATGG + Intronic
1060210729 9:121708659-121708681 CAGTTTCCCCACCTGCAACCAGG - Intronic
1060210914 9:121709795-121709817 CAGTTTCCTCACCTGTAAAATGG - Intronic
1060399043 9:123336955-123336977 CAGTTTCTCCAGCTGGTCAATGG - Intergenic
1060475245 9:123982130-123982152 CAGTTTCCTCATCTGGAAAAGGG - Intergenic
1060486009 9:124046367-124046389 TAGTTTCCCCACCTGTAAAATGG - Intergenic
1060496651 9:124124358-124124380 CAGTTTCCCCATCTATACAATGG + Intergenic
1060497002 9:124126260-124126282 CAGTTCCCCCACCTGTAAAATGG + Intergenic
1060529239 9:124338758-124338780 CAGTTTCTCCATCTGGAAAATGG + Intronic
1060531323 9:124348564-124348586 CAGTTTCCTCACCTATACAATGG + Intronic
1060667786 9:125443302-125443324 CAGTGTCCCCACCTGTAAAGTGG - Intronic
1060730954 9:126036757-126036779 TGGTTTCCCCACCTGGAAAATGG - Intergenic
1060926999 9:127462014-127462036 CAGTTTTCTCACCTGGAAAATGG - Intronic
1061008197 9:127940233-127940255 CAGTTTCCTCACCTGCAGATGGG - Intergenic
1061131748 9:128712472-128712494 CAGTTTCCCCATCTGAACAGTGG - Intronic
1061159783 9:128886882-128886904 CAGTTTCCACATCTGTAAACTGG - Intronic
1061188338 9:129068119-129068141 CAGTCTCCCCATCTGGAAAGTGG + Intronic
1061200779 9:129137351-129137373 CAGTTTCCTCACCTGGACACTGG - Intronic
1061235082 9:129337432-129337454 CAGTTTCCCCATCTGCACAATGG - Intergenic
1061241825 9:129378873-129378895 CGGTTTCCCCATCTGGGCAATGG - Intergenic
1061275677 9:129568566-129568588 CAGTTTCCCCATCTGTAAACTGG - Intergenic
1061296466 9:129679501-129679523 CAGTTTCCTCACCTAGAAAATGG - Intronic
1061309085 9:129750762-129750784 CAGTGTCCTCACCTGTAAACGGG - Intronic
1061410611 9:130419197-130419219 CAGTTTACCCAACTGTAAACGGG - Intronic
1061416785 9:130451404-130451426 CAGTTTCTCTACCTCCACACTGG + Intronic
1061422565 9:130480196-130480218 CAGTTTCCCCACCTGTCCAGTGG + Intronic
1061519529 9:131109885-131109907 CAGTTTCCTCACCTGCAAAATGG + Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061630053 9:131866648-131866670 CAGTTTTCCCATCTGGAAAATGG + Intronic
1061659424 9:132118859-132118881 CAGTTTCCTCACCTGTAAAATGG + Intergenic
1061674916 9:132210237-132210259 CAGTTTCCCCACCTGTAAAATGG + Intronic
1061742301 9:132716218-132716240 CAGTCTCCCCACCTGTAGAATGG + Intergenic
1061778742 9:132983664-132983686 CAGTTTTCCCACCTGCAACCTGG + Intronic
1061824115 9:133247235-133247257 CAGTCTCCCCACATGGACAATGG - Intergenic
1061883559 9:133579678-133579700 CAGTCTCCCCACCTGCAAAATGG - Intronic
1061908350 9:133710236-133710258 CAGTTTCGCCACCTGGAAAATGG - Intronic
1061932757 9:133841758-133841780 CAGTTTCCCCAACTGCAGAATGG + Intronic
1062000126 9:134211697-134211719 CAGTTTCCCCATCTGTAAAATGG - Intergenic
1062014151 9:134282866-134282888 CAGTTTCCCCACCTCCAAATGGG - Intergenic
1062024351 9:134333418-134333440 CGGTTTCCCCAGCTGTACCCGGG + Intronic
1062042510 9:134410645-134410667 CAGTCTCCACGCCTGGGCACAGG - Intronic
1062097334 9:134710129-134710151 CAGTTTCCTCAGCTGGAAAGTGG + Intronic
1062122324 9:134840433-134840455 CAGTTTCCTCAGCTGGAAAATGG - Intronic
1062351753 9:136142999-136143021 CAGTTTTACAACCTGGAGACAGG - Intergenic
1062382675 9:136294980-136295002 CAGTTTCCCCATCTGTAAAATGG + Intronic
1062454344 9:136628687-136628709 CAGTTTCCCCACCTGTACAAGGG + Intergenic
1062521097 9:136958322-136958344 CAGTTTCCCCATCTGTGCAGAGG - Intergenic
1062523776 9:136970183-136970205 CACTTTCTCCACCTGCACAGAGG - Intronic
1062571294 9:137186591-137186613 CAGTGTCCCTACCTGGATAGAGG - Intronic
1185947991 X:4399364-4399386 CAGTTTTCCTACCCTGACACTGG - Intergenic
1186042123 X:5492218-5492240 CAGTGTCCCTCCCAGGACACGGG - Intergenic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1187236247 X:17470146-17470168 CAGTTTCCCCAGCTGTAAATAGG - Intronic
1187397338 X:18930261-18930283 TGGTTTCCCCACCTGTACAGTGG - Intronic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1188596920 X:31912703-31912725 CAGTTTTCTCACCTGGAAACAGG - Intronic
1189234083 X:39474454-39474476 CAGTTTCCCCACCTGCAAAATGG + Intergenic
1189241138 X:39525653-39525675 CAGTTTCCTCATCTGAAAACAGG - Intergenic
1190218546 X:48496069-48496091 CGGTTTCCCCATCTGTACAATGG + Intergenic
1190534480 X:51412067-51412089 CAGTTTCCACACCTGCAAATTGG + Intergenic
1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG + Intronic
1192080783 X:68045954-68045976 CAGTTCCCCCGACTGGAAACTGG + Exonic
1192168734 X:68841610-68841632 CTGTTTCCCCACCAGGCCAAAGG - Exonic
1192233799 X:69283791-69283813 CAGTTTCCTCATCTGGAGAATGG + Intergenic
1192381697 X:70623726-70623748 CAGTTTCCCCAACTGTAAAGTGG - Intronic
1192676931 X:73207456-73207478 CAGTTTCCTCATCTGTACAAGGG - Intergenic
1194170506 X:90575071-90575093 CAGTTTGTCCACCTGCACAGGGG + Intergenic
1195464738 X:105167918-105167940 CAGGTTCCCCACCTATACAAGGG - Intronic
1195668646 X:107451366-107451388 GAGTTTTCCCAGCTGGAGACCGG + Intergenic
1196145602 X:112313461-112313483 CAGTTTCCTCACCTGCAGAATGG - Intergenic
1196185221 X:112738293-112738315 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1196340429 X:114588960-114588982 CAGTTTCCCTAACTGCAAACTGG - Intronic
1196984768 X:121256083-121256105 CAGTTTCCTCATCTGCACACTGG - Intergenic
1197170666 X:123430332-123430354 CTGTTTCCCCAAATGGTCACTGG + Intronic
1197723172 X:129758802-129758824 CAGTTTCCCCAGCTGTAAAAAGG + Intronic
1197891940 X:131277525-131277547 CAGTTTGCCCATTTGGACAAGGG + Intronic
1198015439 X:132605649-132605671 CAGTTTTCCCATCTGTAGACAGG + Intergenic
1198317039 X:135478234-135478256 CAGTCTCCCCATCTGTACTCTGG + Intergenic
1198485679 X:137085257-137085279 CAGTTTCCTCACCTGTAAAATGG - Intergenic
1198526584 X:137507514-137507536 CAGTTTCCTCAACTGTAAACTGG - Intergenic
1199946084 X:152669302-152669324 CAGTTTCCCCATCTGTGCAATGG - Intergenic
1200063590 X:153494640-153494662 CAGTGTCCCCATCTGGGCAGTGG + Intronic
1200066292 X:153505637-153505659 CAGTTTCCTCACACGCACACTGG - Intronic
1200916408 Y:8575073-8575095 CAGTAATCCCACCTGAACACTGG - Intergenic
1200929546 Y:8684707-8684729 GAGTATTCCCACCTGAACACTGG + Intergenic