ID: 1161198839

View in Genome Browser
Species Human (GRCh38)
Location 19:3003019-3003041
Sequence GGGGGTGCCCAGCACCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161198827_1161198839 9 Left 1161198827 19:3002987-3003009 CCATGTCAGCCTACGAGCCCCTT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334
1161198826_1161198839 12 Left 1161198826 19:3002984-3003006 CCACCATGTCAGCCTACGAGCCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334
1161198837_1161198839 -10 Left 1161198837 19:3003006-3003028 CCTTTGGATATTGGGGGGTGCCC No data
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334
1161198829_1161198839 0 Left 1161198829 19:3002996-3003018 CCTACGAGCCCCTTTGGATATTG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334
1161198836_1161198839 -9 Left 1161198836 19:3003005-3003027 CCCTTTGGATATTGGGGGGTGCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334
1161198835_1161198839 -8 Left 1161198835 19:3003004-3003026 CCCCTTTGGATATTGGGGGGTGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG 0: 1
1: 0
2: 3
3: 32
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161198839 Original CRISPR GGGGGTGCCCAGCACCATCA GGG Intronic
900230540 1:1554801-1554823 TGGGCAGCCCAGCACCATCCTGG + Intronic
900319628 1:2076126-2076148 GGGGGTGCCCAGTGCCATCGAGG + Intronic
900503344 1:3017199-3017221 GGGGGTGCCCAGCAGATACAGGG + Intergenic
900519152 1:3097358-3097380 GGTGGTGCCCAGCACACTCTGGG + Intronic
900547002 1:3234826-3234848 GTGGGTGTCAGGCACCATCACGG - Intronic
900658854 1:3772972-3772994 GGGGGTCCCCAGCAGCCACAAGG - Intronic
900833763 1:4984579-4984601 GAGGGTGTCCATCACCATCTTGG + Intergenic
901055064 1:6445502-6445524 GGGGAAGCCCAGCACCGCCAGGG + Intronic
902990381 1:20183578-20183600 GAGGGTGCACAGCACCATCTTGG + Intergenic
903741356 1:25560421-25560443 GGCTGTGCCCAGCAGCACCAGGG - Intronic
904005386 1:27360727-27360749 GAGGGTGCGCATCGCCATCAAGG - Exonic
904454352 1:30638427-30638449 AGGTGTGGCCAGCACCCTCAAGG + Intergenic
904476676 1:30769469-30769491 GGGGCTTCCCAGGACCAACACGG + Intergenic
904952685 1:34256670-34256692 GTGGGTGCAGAGCACCAGCATGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906315797 1:44785724-44785746 AGGGGTGCCCAGCACAAACTAGG + Intronic
908267506 1:62393873-62393895 GGGGGTGCCAACCACCCCCAGGG + Intergenic
908898658 1:68929411-68929433 GTGGGTGCAGAGCACCAGCATGG + Intergenic
910130682 1:83901949-83901971 TGGAGTGGCCAGCACCATGAAGG - Intronic
914249090 1:145907132-145907154 GGGGGCGCCCACCAGCATCCTGG + Exonic
915678630 1:157556496-157556518 GTGGGTGCAGAGCACCAGCATGG + Intergenic
915761149 1:158314734-158314756 GTGGGTGCCGCGCACCAGCATGG - Intergenic
918200740 1:182264194-182264216 GAGAGTGCCCAGCAGCAACAAGG + Intergenic
919747634 1:201018380-201018402 GGGGCTGCCTGGCACCACCATGG - Intronic
920400001 1:205670532-205670554 GGGGGACCCCAGCCCCATCCCGG + Intronic
921478004 1:215633302-215633324 GGCACTGCCCAACACCATCAGGG - Intronic
922242809 1:223767267-223767289 GTGGGTGCAAAGCACCAGCATGG - Intronic
922473614 1:225891059-225891081 GGGGGTGCCTGGAACCACCAAGG - Intronic
922782480 1:228264073-228264095 TAGGGTGACCACCACCATCAAGG - Intronic
1063801626 10:9585318-9585340 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1067054526 10:43043145-43043167 AGGGGTGCTCAGCACCTCCAGGG + Intergenic
1067067599 10:43112575-43112597 GGGTGTGCCCACCACCATGAGGG + Intronic
1069655234 10:70083049-70083071 AGGGATTCCCAGCACCAACAGGG + Intronic
1070632177 10:78094380-78094402 GTGGGTGCAACGCACCATCATGG + Intergenic
1071418558 10:85464482-85464504 GGGGGAACCCATCACCCTCAAGG + Intergenic
1072207901 10:93221037-93221059 GGGTGGGCCCGGCTCCATCAGGG + Intergenic
1072376696 10:94824734-94824756 GTGGGTGCCGTGCACCAGCATGG - Intronic
1072727277 10:97822270-97822292 GGAGCTGCCCAGCACCACCAGGG - Intergenic
1073451551 10:103612755-103612777 GGGGGTGCACAGGACCCCCATGG - Intronic
1073492222 10:103860230-103860252 GGGGGTTGCCAGCATCATCTGGG + Intergenic
1076582321 10:131520091-131520113 GTGGGTGCCCAGCAGCAACGTGG + Intergenic
1076676877 10:132151683-132151705 GGGGGTACCCAGCCCCACCCAGG + Intronic
1076829039 10:132985145-132985167 GAGGGTTCCCAGCACCAGCCTGG - Intergenic
1078028104 11:7719235-7719257 GTGGGTGCAGAGCACCAGCATGG - Intergenic
1080104267 11:28495471-28495493 GGGGGTGTCCACTACCATCTCGG + Intergenic
1081542818 11:44048557-44048579 GGGGGTGGGCAGCATCCTCACGG + Intronic
1083173288 11:60935163-60935185 GGGTGCTCCCAGCACCCTCACGG - Intronic
1083683036 11:64359963-64359985 GAGGGTGCCCAGCAAAACCAGGG - Intronic
1084032957 11:66491825-66491847 GGGGGTGGGGAGAACCATCAGGG - Intronic
1084062608 11:66686002-66686024 GGTGGTGCCCAGCACCACCCGGG - Exonic
1085409879 11:76284605-76284627 GGGGGTGCCCAGCAGGTCCAAGG - Intergenic
1085522351 11:77146080-77146102 GAGGGTGGCCAGCACTGTCAGGG + Intronic
1086580522 11:88393181-88393203 GTGGGTGCAGCGCACCATCATGG - Intergenic
1087083828 11:94197129-94197151 TGGGGTGCACAGGGCCATCAGGG - Intergenic
1088665118 11:112086575-112086597 GAGCGTGCCCAGGACCACCAAGG + Intronic
1091233023 11:134000602-134000624 GCAGGTGCTCAGCACCAGCACGG + Intergenic
1091262504 11:134245601-134245623 GTGGGTGCCCAGCATCTTCTCGG - Exonic
1091285394 11:134405842-134405864 TGGGGTGTCCAGCACCAGCCTGG + Intronic
1095848317 12:46771927-46771949 GGAGGTCCCCAGCACCATCCAGG + Intronic
1095984523 12:47990635-47990657 GCTGGTGCCCTGCCCCATCAGGG - Intronic
1096182942 12:49560471-49560493 TGGAGAGCCCAGCACCAGCAAGG + Intronic
1096214635 12:49792445-49792467 GGGGCTGCCCAGGACCCCCATGG - Exonic
1096460992 12:51821406-51821428 GGGGGAGCCCAGGACCTTGAGGG + Intergenic
1096712547 12:53468000-53468022 GGGGTTGGCCAGATCCATCAAGG - Intronic
1101083213 12:101209624-101209646 GGGGGTGCCCAGGACAGTGACGG + Exonic
1101515404 12:105430275-105430297 GTGGGTGCCGAGGACCACCATGG - Intergenic
1104965455 12:132507021-132507043 GGGCGTGGCCGGCACCACCATGG + Intronic
1104986676 12:132601337-132601359 GGGTGAGCCCAGCAACACCAGGG - Intergenic
1106670418 13:31898950-31898972 GTGAGTTCCCAGCAGCATCAAGG - Intergenic
1106785075 13:33099404-33099426 GGAGATGCCCAGCAGCATCTGGG - Intergenic
1107986870 13:45783614-45783636 GGGGGTCCCAATCAGCATCATGG + Exonic
1113069127 13:106402276-106402298 GGAAGTGCCCAGCACAATGACGG - Intergenic
1113554577 13:111222048-111222070 GGTGGTGCCCAGCAGCTTAAGGG + Intronic
1120124264 14:80722192-80722214 GGGGGTGGCCTGAACCATCAAGG + Intronic
1121107572 14:91291205-91291227 GAGGGTGCTCACCACCGTCATGG + Intronic
1121786479 14:96665277-96665299 GAGGGTCCCCAGCAGCATGAAGG + Intergenic
1122285434 14:100649018-100649040 GGGTGTGCCCAGCACAGCCATGG + Intergenic
1122364272 14:101185292-101185314 GGGGGTGCCCAGAGCCACCATGG + Intergenic
1122461274 14:101897638-101897660 GGTGGTGCCCACCCCCATTAAGG + Intronic
1122542713 14:102507023-102507045 GGCGGTGACCAGCACCTGCATGG + Exonic
1122857933 14:104568861-104568883 GGGTGGGCCCTGCACCTTCAGGG + Intronic
1123058017 14:105581577-105581599 GGCTGTGCCCAGCACAAGCACGG - Intergenic
1123132396 14:105999432-105999454 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123132421 14:105999530-105999552 AGGGGTGCTCAGAACCACCAGGG - Intergenic
1123132610 14:106000279-106000301 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132666 14:106000515-106000537 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132673 14:106000535-106000557 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132690 14:106000596-106000618 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132727 14:106000754-106000776 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132734 14:106000774-106000796 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132751 14:106000835-106000857 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132794 14:106001013-106001035 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132801 14:106001033-106001055 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132818 14:106001094-106001116 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132825 14:106001114-106001136 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132842 14:106001175-106001197 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132849 14:106001195-106001217 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132866 14:106001256-106001278 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132873 14:106001276-106001298 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132890 14:106001337-106001359 GGGGGCACTCAGGACCATCAGGG - Intergenic
1123132897 14:106001357-106001379 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123132914 14:106001418-106001440 GGGGGCACTCAGAACCATCAGGG - Intergenic
1123137756 14:106045332-106045354 GGGGGCGCTCAGCACAAGCAGGG - Intergenic
1123144608 14:106116566-106116588 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123146976 14:106141927-106141949 AGGGGTGCTCAGAACCACCAGGG - Intergenic
1123147045 14:106142151-106142173 GGGGGCACTCAGAACCATCAGGG - Intergenic
1123149820 14:106170358-106170380 GGGGGCGCTCAGAAGCATCAGGG - Intergenic
1123149832 14:106170397-106170419 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123149844 14:106170436-106170458 GGGGGTGCTCAGGACCACCAGGG - Intergenic
1123156814 14:106234993-106235015 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123164035 14:106308898-106308920 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123164061 14:106309015-106309037 GGGGGTACTCAGAACCAACAGGG - Intergenic
1123164081 14:106309093-106309115 GGTGGCGCTCAGCACCACCAGGG - Intergenic
1123164091 14:106309133-106309155 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123164108 14:106309231-106309253 GGGGGTGCTCAGAACCACTAGGG - Intergenic
1123175791 14:106417672-106417694 GGGGGCGCTCAGAACCATCAGGG - Intergenic
1123196153 14:106618639-106618661 GGGGGCGCTCAGAAGCATCAGGG - Intergenic
1123196183 14:106618753-106618775 GGGGGTGCTCAGAACCATGAGGG - Intergenic
1123203549 14:106691493-106691515 GGGGGTGACCAGGACTAGCAGGG - Intergenic
1123203661 14:106691940-106691962 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123203684 14:106692038-106692060 GGGGGCGCTCAGGACCAGCAGGG - Intergenic
1123203733 14:106692214-106692236 GGGGGTGCTCAGAACCACTAGGG - Intergenic
1123207585 14:106728094-106728116 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123212596 14:106775088-106775110 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123218014 14:106830729-106830751 GGGGGAGCTCAGAACCAACAGGG - Intergenic
1123218028 14:106830787-106830809 GGGGGAGCTCAGAACCACCAGGG - Intergenic
1123582642 15:21730664-21730686 AGGGGTGCTCAGAACCACCAGGG - Intergenic
1123582817 15:21731371-21731393 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123582904 15:21731722-21731744 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123582924 15:21731803-21731825 GGGGGTGCTCAGCACCACCAGGG - Intergenic
1123582941 15:21731864-21731886 GGGGGCACTCAGAACCATCAGGG - Intergenic
1123619292 15:22173260-22173282 AGGGGTGCTCAGAACCACCAGGG - Intergenic
1123619467 15:22173967-22173989 GGGGGCGCTCAGAACCACCAGGG - Intergenic
1123619554 15:22174318-22174340 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123619574 15:22174399-22174421 GGGGGTGCTCAGCACCACCAGGG - Intergenic
1123619591 15:22174460-22174482 GGGGGCACTCAGAACCATCAGGG - Intergenic
1123705315 15:22947146-22947168 GTGGGTGCCCAGCAGCTGCAGGG - Intronic
1126212009 15:46110571-46110593 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1126932871 15:53674495-53674517 GGGGGTTCCCACCACAAACAGGG + Intronic
1127968079 15:63938744-63938766 GGGGGTGCCCAGCTCCAGTGGGG - Intronic
1128972204 15:72117811-72117833 GGGTGGGCCCAGCAGCCTCAGGG + Exonic
1129378780 15:75152602-75152624 GGGTGTGCCAAGCACCAGAAAGG + Intergenic
1129833096 15:78683178-78683200 GGGGCTGCCCAGAACCCCCACGG - Intronic
1130321445 15:82845965-82845987 GCGCCTGCCCACCACCATCAAGG + Intronic
1132338891 15:101065768-101065790 CGGGGTCCCCAGCCCCCTCAGGG + Exonic
1132800487 16:1749831-1749853 TGGGGTGCTGAGCACCAGCAGGG + Intronic
1132999256 16:2840917-2840939 GGGGGAGTCCAGCTCCATCAGGG + Intergenic
1136680181 16:31956239-31956261 GGGGGTGCTCAGGATCATGAGGG + Intergenic
1136680208 16:31956356-31956378 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1136680220 16:31956395-31956417 GGGGGCGCTCAGAACCACCAGGG + Intergenic
1136680239 16:31956455-31956477 GGGGGCGCTCAGAAGCATCAGGG + Intergenic
1136691903 16:32038948-32038970 GGGGGCGCTAAGAACCATCAGGG + Intergenic
1136691930 16:32039065-32039087 GAGGGTGCTCAGAACCACCATGG + Intergenic
1136691949 16:32039149-32039171 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1136691979 16:32039256-32039278 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1136692016 16:32039376-32039398 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1136692052 16:32039490-32039512 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1136692144 16:32039821-32039843 GGGGGTGCTCAGAACCACCAGGG + Intergenic
1136692174 16:32039953-32039975 GGGTGTGCTCAGAACCACCAGGG + Intergenic
1136692203 16:32040050-32040072 GGGGGTGCTCAGGACCTCCAGGG + Intergenic
1136780521 16:32897783-32897805 GGGGGTGCTCAGGATCATGAGGG + Intergenic
1136780549 16:32897900-32897922 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1136780561 16:32897939-32897961 GGGGGCGCTCAGAACCACCAGGG + Intergenic
1136780583 16:32898000-32898022 GGGGGCGCTCAGAAGCATCAGGG + Intergenic
1136792515 16:32982627-32982649 GAGGGTGCTCAGAACCACCATGG + Intergenic
1136792533 16:32982711-32982733 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1136792563 16:32982818-32982840 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1136792595 16:32982928-32982950 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1136792687 16:32983259-32983281 GGGGGTGCTCAGAACCACCAGGG + Intergenic
1136792717 16:32983391-32983413 GGGTGTGCTCAGAACCACCAGGG + Intergenic
1136877139 16:33870663-33870685 GGGTGTGCTCAGAACCACCAGGG - Intergenic
1136877169 16:33870795-33870817 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1136877261 16:33871126-33871148 AGGGGTGCTCAGAACCACCAGGG - Intergenic
1136877292 16:33871235-33871257 GCGGGTGCTCAGAACCACCAGGG - Intergenic
1136877310 16:33871319-33871341 GAGGGTGCTCAGAACCACCATGG - Intergenic
1136889831 16:33961670-33961692 GGGGGCGCTCAGAAGCATCAGGG - Intergenic
1136889843 16:33961709-33961731 GGGGGAGCTCAGAACCACCAGGG - Intergenic
1136889855 16:33961748-33961770 GGGGGTGTTCAGGACCACCAGGG - Intergenic
1136889884 16:33961865-33961887 GGGGGTGCTCAGGATCATGAGGG - Intergenic
1138547001 16:57725854-57725876 GGAGGGGCCCAGCACCATATGGG + Intronic
1138555231 16:57766992-57767014 GGGGGTGCACACCACTGTCAGGG + Intronic
1138915827 16:61463026-61463048 GTGGGTGCACCGCACCACCATGG + Intergenic
1138951827 16:61921167-61921189 GTGGGTGCACCGCACCAGCATGG + Intronic
1139123052 16:64043478-64043500 GGGGGAGCTCACCACCCTCAAGG + Intergenic
1141625919 16:85261004-85261026 GGGGGTGCTCAGTTCCACCATGG + Intergenic
1142132663 16:88438012-88438034 GGTGGCTCCCAGCACCACCAAGG + Exonic
1203083150 16_KI270728v1_random:1161749-1161771 GGGGGTGCTCAGGATCATGAGGG + Intergenic
1203083179 16_KI270728v1_random:1161866-1161888 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1203083191 16_KI270728v1_random:1161905-1161927 GGGGGCGCTCAGAACCACCAGGG + Intergenic
1203083224 16_KI270728v1_random:1161990-1162012 GGGGGAGCTCAGAACCACCAGGG + Intergenic
1203083236 16_KI270728v1_random:1162029-1162051 GGGGGCGCTCAGAAGCATCAGGG + Intergenic
1203094721 16_KI270728v1_random:1244092-1244114 GAGGGTGCTCAGAACCACCATGG + Intergenic
1203094739 16_KI270728v1_random:1244176-1244198 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1203094810 16_KI270728v1_random:1244407-1244429 AGGGGTGCTCAGAACCACCAGGG + Intergenic
1203094897 16_KI270728v1_random:1244738-1244760 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1203094927 16_KI270728v1_random:1244870-1244892 GGGTGTGCTCAGAACCACCAGGG + Intergenic
1203094956 16_KI270728v1_random:1244967-1244989 GGGGGTGCTCAGGACCTCCAGGG + Intergenic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1143659446 17:8315607-8315629 GGGCGTGCCCAGCAGCCTAAGGG - Intronic
1143682937 17:8491153-8491175 GGGGGTGCACAGCAGCACCAAGG - Intronic
1145687897 17:26694144-26694166 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1145998558 17:29118118-29118140 GGAGATGCCCAGCACCTTCATGG + Exonic
1146917910 17:36689978-36690000 CAGGGTACCCAGCACCAACAGGG + Intergenic
1148796800 17:50200964-50200986 GCGGCTGCCCAGCACCCCCACGG + Intronic
1148861278 17:50605587-50605609 GGGAGTCCCCAGCATCATCTGGG - Intronic
1149143212 17:53458492-53458514 GGAGCTGCCCAAGACCATCAGGG + Intergenic
1149647212 17:58249392-58249414 GGGGGAGCCCCGCGCCTTCAGGG + Intronic
1151330187 17:73401934-73401956 GGGGGTGCCTACCATCCTCATGG + Exonic
1151965709 17:77430176-77430198 GAGGGTGGCCAGCACCCGCAAGG - Intronic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1152318787 17:79596406-79596428 GAGTGTGCCCAGCACCAGCCAGG + Intergenic
1152470244 17:80487153-80487175 TGGTGTGCCCAGCATCATCCTGG - Intergenic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1152757237 17:82092128-82092150 GGGGGTCCACGGCACCATCAGGG - Intronic
1152785934 17:82248095-82248117 GGGGGTGCCCAGATCCCCCACGG - Intronic
1154525573 18:15286493-15286515 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1155103237 18:22634702-22634724 GCAGGTCACCAGCACCATCAAGG + Intergenic
1156897731 18:42265745-42265767 GTGGGTGCAGCGCACCATCATGG - Intergenic
1159422960 18:68247154-68247176 TGAAGTGCCCAGCACCCTCAGGG + Intergenic
1160794673 19:939727-939749 GGGGGTGTCCAGCGCCACGAGGG - Intronic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1161300385 19:3539614-3539636 GGGGTTGCCCAGAGCCACCACGG - Intronic
1164025094 19:21344641-21344663 GGGGGAGCTCAGAAGCATCAGGG - Intergenic
1164346787 19:27273099-27273121 GTGGGTGCCGCGCACCAGCATGG + Intergenic
1164607968 19:29613564-29613586 ATATGTGCCCAGCACCATCAGGG - Intronic
1165789578 19:38483483-38483505 GGGGATGTGCAGCGCCATCATGG - Exonic
1165981962 19:39732159-39732181 GTGGGTGCAGAGCACCAGCATGG - Intronic
1166291140 19:41864297-41864319 GTGGGTGCCCAGCCCCATGCAGG - Intronic
926198253 2:10776414-10776436 GGGGGTCCCCAGCTCCAGCTCGG - Intronic
926286717 2:11494416-11494438 GGGGGTGCCCAGTGCCATCCAGG + Intergenic
927223968 2:20743393-20743415 GGGGGTGCAGCGCACCAGCATGG - Intronic
927676830 2:25112328-25112350 GGGGCTGCCCAGGGCCAGCAGGG + Intronic
932345359 2:70991768-70991790 GGGTGTGCCCATCTCCATCCTGG - Intronic
933000069 2:76910409-76910431 GTGGGTGCAGAGCACCAGCATGG + Intronic
934513154 2:94964403-94964425 GGGTGTGCTCAGAACCACCAGGG - Intergenic
937559041 2:123197888-123197910 GTGGGTGCAGAGCACCAGCATGG + Intergenic
944839778 2:203613978-203614000 GAGGGTGGACTGCACCATCAGGG - Intergenic
945442556 2:209896991-209897013 GGGTATCCCCAGGACCATCACGG + Intronic
947534024 2:230929644-230929666 GGGGGCTCCAAGCCCCATCAGGG - Intronic
947832835 2:233153879-233153901 GGGGCTGGCCAGCAGCATCCTGG - Intronic
948014302 2:234675371-234675393 GGGTGTTCTCAGAACCATCATGG + Intergenic
948835627 2:240624729-240624751 GGGGGTGCTCTGCACCATGGGGG + Intronic
948982869 2:241503777-241503799 GGGGGTGCCCTGCACGTTCCTGG + Intronic
1170473483 20:16691144-16691166 GTGGGTGCTCAGCACCCCCATGG - Intergenic
1172126913 20:32629951-32629973 GTGGGTGCCAGGCACCATAAGGG + Intergenic
1172838257 20:37886718-37886740 AGGGGTGCCCAGCACCTTAAGGG + Intergenic
1175823311 20:61923552-61923574 AGGGGTGACCATCTCCATCATGG + Exonic
1175924012 20:62463185-62463207 GGTGGTCCTGAGCACCATCAGGG + Intergenic
1176002803 20:62840549-62840571 AGGCGTGCCCGGCACCAGCAAGG + Exonic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1176085379 20:63293411-63293433 CGGGGTGCCCAGCACGCACAGGG + Intronic
1176624824 21:9083684-9083706 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1179556097 21:42177416-42177438 GGCAGTGCCCAGCTCCATCCAGG - Intergenic
1179829033 21:43984524-43984546 GGGGCTGCCCAGCTCCGCCATGG - Exonic
1180725345 22:17942731-17942753 GGTGCTGCCCAGCAGCGTCACGG - Intronic
1180981422 22:19879823-19879845 AGGGGTGCCCAGCACCAGCAGGG - Intronic
1181343013 22:22198069-22198091 GGGCGTGAACAGCACAATCAAGG + Intergenic
1184226109 22:43129730-43129752 GGGGGTTGGCAGCACCAGCACGG + Intergenic
1184288670 22:43486655-43486677 TGGGGTGGCCACCACCATGAAGG - Intronic
1184363236 22:44031189-44031211 GACGCTGCCCAGCACCTTCATGG + Intronic
1184442042 22:44522949-44522971 GGGGGTGCCCAGCCCCTCCAGGG - Intergenic
1184902749 22:47457779-47457801 GGGGGAGCCCAGGAACAACATGG + Intergenic
950530726 3:13551011-13551033 GGGGGTGGGCAGCACCAGCCAGG - Intronic
953019082 3:39102755-39102777 GGTGGTGCCCAGCAACATGTGGG - Exonic
954107368 3:48416473-48416495 GGGGGTGCCAGGCTGCATCAAGG + Intronic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
956107627 3:65837259-65837281 GGCGCTGCCCACCTCCATCAGGG + Intronic
956168638 3:66415301-66415323 GGGGTGGCCCAGCAGCTTCAAGG - Intronic
958188648 3:90156269-90156291 GTGGGTGCAGAGCACCAGCATGG - Intergenic
960411700 3:117335160-117335182 GTGGGTGCAGAGCACCAGCATGG - Intergenic
960546483 3:118920173-118920195 GTGGGTGCAGAGCACCAGCATGG + Intronic
965069939 3:163907129-163907151 GTGGGTGCAGAGCACCAGCATGG + Intergenic
967511064 3:190312993-190313015 GAGGATGCCAACCACCATCAAGG + Exonic
968495145 4:911143-911165 GTGGGTGCCCAGCCTCATCAGGG - Intronic
968744402 4:2352284-2352306 GGGGGTGCTCAGCACAGACATGG + Intronic
968872212 4:3247814-3247836 GGGGGTGCCCAGCCCCACTGTGG - Exonic
968916315 4:3498501-3498523 GGGGGTGTCCAGCCCCACCGTGG + Intronic
969258578 4:6019792-6019814 GGCGGTGCCCAGGTCCTTCAGGG - Intergenic
969551925 4:7875247-7875269 GAGGCTGCCGTGCACCATCAAGG + Intronic
969674627 4:8607992-8608014 GGAGGGTCCCAGCATCATCACGG - Intronic
982399033 4:154945391-154945413 TAGGGTGCCCAGGACCATCCAGG - Intergenic
985699292 5:1360958-1360980 GGGTGTCCCCAGGACCATGAGGG - Intergenic
987329379 5:16842421-16842443 GAGGGAGCCCAGCTCCACCAGGG + Intronic
988012545 5:25508078-25508100 GTGGGTGCCGCGCACCAGCATGG + Intergenic
988881529 5:35508457-35508479 GGGAGTGGCCACCACCATCTTGG + Intergenic
989948488 5:50268647-50268669 GGGGGTGCAGTGCACCAGCATGG + Intergenic
990714745 5:58624269-58624291 GAGGATGCCCAACACCATCCTGG + Intronic
993663035 5:90662689-90662711 GTGGGTGCAGAGCACCAGCATGG - Intronic
995279426 5:110316573-110316595 CGGGGTCCCCAGCCTCATCAGGG + Intronic
996873226 5:128215278-128215300 GTGGGTCCCCAGAACCCTCAAGG + Intergenic
997467184 5:134096143-134096165 GGGGCTGCCCCGCACAATCCCGG - Intergenic
999396703 5:151234003-151234025 GGGAGTGCACGGCACAATCATGG + Intronic
999450772 5:151676182-151676204 TAGGGTTCCCAGCACCATGAGGG - Exonic
999552136 5:152700717-152700739 GGGGGTGCAGCGCACCAGCATGG + Intergenic
1000327342 5:160182322-160182344 GAGAGTGCCCAGCAGTATCAGGG + Intergenic
1001549242 5:172590729-172590751 GGGTGTGCCCAGCAACATAATGG - Intergenic
1002618379 5:180469309-180469331 GGGGGTTCCCAGCAGCAACCTGG + Intergenic
1008263304 6:49392806-49392828 GTGGGTGCAGCGCACCATCATGG + Intergenic
1011999063 6:93631667-93631689 GTGGGTGCCGCGCACCAGCATGG - Intergenic
1017521759 6:155208902-155208924 GGAGGAGCCGGGCACCATCAGGG - Intronic
1018039296 6:159907564-159907586 GCTGGTGTCCAGCACCATCTTGG + Exonic
1019299246 7:295329-295351 GGCTGTGCACAGCACCATCCAGG + Intergenic
1019326524 7:441171-441193 GTGGGTGCCCACCACCATGATGG + Intergenic
1019326600 7:441481-441503 GTGGGTGCCCACCACCAGGATGG + Intergenic
1019347347 7:537610-537632 GGGGGCTTCCAGCACCATGAAGG - Intergenic
1019940073 7:4282760-4282782 GGTGGTTCCCACCTCCATCAGGG + Intergenic
1021907823 7:25353059-25353081 GGGGGTGCCAAGCAGCAGCAGGG + Intergenic
1023545087 7:41310333-41310355 GGGGGTGCGCAGCAGCCTCCAGG + Intergenic
1025473594 7:60890873-60890895 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1025513411 7:61598993-61599015 GTGGGTGCAGAGCACCAGCATGG - Intergenic
1025537760 7:62027832-62027854 GTGGGTGCAGAGCACCAGCATGG - Intergenic
1027522667 7:79229872-79229894 GTGGGTGCACTGCACCAGCATGG - Intronic
1028146998 7:87329710-87329732 GGAGCTGCCCACCACCATCTTGG - Intergenic
1028968474 7:96829232-96829254 GTGGGTGCCGCGCACCAGCATGG - Intergenic
1030588656 7:111451625-111451647 GGGGGTGCAGCGCACCAGCATGG + Intronic
1031418545 7:121521814-121521836 GAGGGTACCCAGCTCCATGAGGG - Intergenic
1031472059 7:122177542-122177564 GGAGCTGCCCACCACCATCTTGG + Intergenic
1032410188 7:131689014-131689036 GGGGAGGCCCAGTAGCATCAGGG + Intergenic
1036743819 8:11390106-11390128 AGGGGAGCCCAGCAACATTAGGG - Intergenic
1039615013 8:38948607-38948629 GTGGGGGCCCAGCATAATCAGGG + Intronic
1040598705 8:48864014-48864036 CAGGGTCCCCAGAACCATCAGGG + Intergenic
1041073530 8:54148352-54148374 GGGAGTGGCCACCACCATCTTGG - Intergenic
1045281208 8:100751084-100751106 GGGGGTGCCAAGCAACACGATGG - Intergenic
1049203424 8:141352516-141352538 GGGGGTGTCCAGCTCCAATAGGG + Intergenic
1049209997 8:141381556-141381578 GTGGGTGGCCAGGACCATCTGGG + Intergenic
1049299307 8:141861362-141861384 GTGGGAGCCCAGCTCCAGCACGG + Intergenic
1049431458 8:142567177-142567199 GCGGTTGCCCAGCACCCTGAGGG - Intergenic
1049744733 8:144258443-144258465 GTGGGTGCCCAGCAGCGTCTGGG + Intronic
1050090658 9:2014952-2014974 GCGGGCGCCCAGCTCCAGCAGGG + Intergenic
1051801912 9:20944390-20944412 GGGGGTGTACAGCACTAGCATGG + Intronic
1052348436 9:27433978-27434000 GGTGGAGCCCAGCATCATGAGGG + Intronic
1053385849 9:37687320-37687342 GGGGGTGGCCCACACGATCATGG - Intronic
1053715158 9:40879831-40879853 GTGGGTGCTGAGCACCAACATGG + Intergenic
1054863590 9:69977269-69977291 GAAGGTGCCCAGCTCCATCTTGG - Intergenic
1055694154 9:78864767-78864789 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1055712327 9:79076685-79076707 GTGGGTGCAGAGCACCAGCACGG + Intergenic
1057091598 9:92263025-92263047 GGCCGTGGCCAGCACCAGCAGGG + Exonic
1057139420 9:92717655-92717677 GGCTGTGCCCAGCTCCATCAGGG - Intronic
1057195437 9:93113724-93113746 AGGGGTTCCCAGCACCTTCTGGG - Intergenic
1057225364 9:93290012-93290034 GGACGTGCCCTGCTCCATCACGG - Exonic
1060114316 9:120928701-120928723 CGGGGCGCCCAGCCTCATCATGG - Exonic
1060751621 9:126173526-126173548 GGGGGTGCCCAGCACACTGTAGG + Intergenic
1060958925 9:127665184-127665206 GGGGGCAGCCAGCACCATCATGG + Intronic
1061074364 9:128332260-128332282 GGGGATGCCCACCAACATCCTGG + Exonic
1061969957 9:134039616-134039638 GGTGGTGCCCAGCCACAGCAGGG + Intronic
1062004174 9:134231005-134231027 GGGGCTGCCGAGCACCCCCAAGG - Intergenic
1062290937 9:135794044-135794066 GGGGCTGCACAGCACCTGCAGGG + Intergenic
1062366917 9:136214590-136214612 GTGGCTTCCCAGCACCCTCATGG - Intronic
1062731567 9:138113058-138113080 GGAGGTGCCCAACTCCATCTTGG + Intronic
1203747987 Un_GL000218v1:54112-54134 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1203561737 Un_KI270744v1:63861-63883 GGGGGAGCCCAGCTCCTGCACGG + Intergenic
1186342845 X:8661739-8661761 GTGCTTGCCCAGGACCATCAGGG - Intronic
1186454882 X:9703190-9703212 GGGGTTGCTCAGAACCTTCAGGG + Intronic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1191928332 X:66340311-66340333 GTGGGTGCAGAGCACCAGCATGG + Intergenic
1191933467 X:66400399-66400421 GTGGGTGCAGAGCACCAGCATGG - Intergenic
1194126220 X:90020312-90020334 GATGGTGCCAAACACCATCATGG - Intergenic
1196258088 X:113546742-113546764 GGAGCTGCCCACCACCATCTTGG - Intergenic
1196258109 X:113546830-113546852 GGAGCTGCCCACCACCATCTTGG - Intergenic
1197615508 X:128686223-128686245 GTGGGTGCAGAGCACCAGCATGG - Intergenic
1199260500 X:145768016-145768038 GATGGTGCCCAGCACCATGGAGG + Intergenic
1199536359 X:148907099-148907121 GGGAGTGGCCACCACCATCTTGG + Intronic
1200620365 Y:5437766-5437788 GTGGGTGCAGCGCACCATCATGG - Intronic
1201161335 Y:11169106-11169128 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1202278516 Y:23150604-23150626 GAGGGTGCAGAGCACCAGCATGG + Intronic
1202286687 Y:23258163-23258185 GAGGGTGCAGAGCACCAGCATGG - Intronic
1202431340 Y:24781942-24781964 GAGGGTGCAGAGCACCAGCATGG + Intronic
1202438628 Y:24876220-24876242 GAGGGTGCAGAGCACCAGCATGG - Intronic
1202583760 Y:26405007-26405029 GGGAGTGACCAGCACCAAGAGGG + Intergenic