ID: 1161203286

View in Genome Browser
Species Human (GRCh38)
Location 19:3028012-3028034
Sequence GGTCCCAGAGGAGGAAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 639}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161203267_1161203286 29 Left 1161203267 19:3027960-3027982 CCCAGGTTCAGGGGAATCACAGC 0: 1
1: 0
2: 0
3: 20
4: 234
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203276_1161203286 -8 Left 1161203276 19:3027997-3028019 CCCCCAGCTCCACGGGGTCCCAG 0: 1
1: 0
2: 1
3: 43
4: 353
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203275_1161203286 -7 Left 1161203275 19:3027996-3028018 CCCCCCAGCTCCACGGGGTCCCA 0: 1
1: 0
2: 5
3: 26
4: 294
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203278_1161203286 -10 Left 1161203278 19:3027999-3028021 CCCAGCTCCACGGGGTCCCAGAG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203273_1161203286 -5 Left 1161203273 19:3027994-3028016 CCCCCCCCAGCTCCACGGGGTCC 0: 1
1: 0
2: 11
3: 434
4: 1208
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203277_1161203286 -9 Left 1161203277 19:3027998-3028020 CCCCAGCTCCACGGGGTCCCAGA 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203266_1161203286 30 Left 1161203266 19:3027959-3027981 CCCCAGGTTCAGGGGAATCACAG 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203268_1161203286 28 Left 1161203268 19:3027961-3027983 CCAGGTTCAGGGGAATCACAGCA 0: 1
1: 0
2: 2
3: 16
4: 239
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639
1161203274_1161203286 -6 Left 1161203274 19:3027995-3028017 CCCCCCCAGCTCCACGGGGTCCC 0: 1
1: 0
2: 2
3: 53
4: 414
Right 1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG 0: 1
1: 0
2: 5
3: 62
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161203286 Original CRISPR GGTCCCAGAGGAGGAAGCGG GGG Intronic
900125840 1:1068683-1068705 GGGCCCAGAGCAGCAAGCCGCGG + Intergenic
900158528 1:1212881-1212903 GATGCCAGAGGAGGCACCGGTGG + Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900214059 1:1471849-1471871 GGTCCCGGCGGCGGTAGCGGCGG + Exonic
900221608 1:1512233-1512255 GGTCCCGGCGGCGGTAGCGGCGG + Exonic
900266471 1:1759730-1759752 AGCCCCGCAGGAGGAAGCGGTGG - Exonic
900430408 1:2598712-2598734 GCTGCCAGATGAGGAAGTGGTGG - Exonic
900467268 1:2831887-2831909 GGACACAGAGGATGAGGCGGGGG - Intergenic
900508369 1:3042589-3042611 GGTCCCAGCTGAGGGAGCCGAGG - Intergenic
900601356 1:3504103-3504125 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900601369 1:3504131-3504153 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900623735 1:3598847-3598869 GGTCCCTGAGAAGGAAGGGGTGG - Intronic
900891993 1:5456272-5456294 GATGCCCGTGGAGGAAGCGGTGG + Intergenic
900945913 1:5831353-5831375 GGTCACAGAGGAGGAAGCCAAGG + Intergenic
901069958 1:6512116-6512138 TTTTACAGAGGAGGAAGCGGAGG + Intronic
901202035 1:7472529-7472551 GCCCCCAGGGGAGGCAGCGGAGG - Intronic
901430590 1:9211673-9211695 GGTCACAGAGCGGAAAGCGGGGG + Intergenic
901673970 1:10872185-10872207 GGCCCCAGAGGTGGAAGATGAGG + Intergenic
902396164 1:16133436-16133458 GGGCCCTGAGGAGGCAGCGGTGG - Intronic
902636386 1:17737509-17737531 GCTCACAGAGGAGGAACCTGAGG - Intergenic
902730868 1:18368041-18368063 TGTCACAGAGGAGGAAGCTGAGG + Intronic
902741846 1:18444284-18444306 GGTCTCAGAGGAGGCAGCGTTGG - Intergenic
903351217 1:22717558-22717580 GTTTCCAGATGAGGAAGCTGAGG - Intronic
903394074 1:22985926-22985948 GAGCCCACAGGAGGAAGCTGGGG + Intergenic
904009380 1:27381141-27381163 AGCCCCAGAGAAGGAAGCTGGGG + Intronic
904014574 1:27409826-27409848 GGCCCCGGAGGAGGAGGAGGAGG + Exonic
904419403 1:30381969-30381991 GATGCCAGAGGAGGAAGCATGGG + Intergenic
904977908 1:34472626-34472648 GGTCCAGGAAGAGGAATCGGGGG + Intergenic
905017331 1:34786567-34786589 TGTACCAGAGGAGGAGGCTGGGG + Intronic
905268796 1:36773178-36773200 GGTCCCAGAGTGAGAAGCTGAGG + Intergenic
905956360 1:42000498-42000520 GTTCCCAAAGGAGAAAGAGGAGG + Intronic
907441960 1:54484403-54484425 GGACACATAGGAGGAAGGGGAGG + Intergenic
908356855 1:63330393-63330415 GTCCGCAGAGGCGGAAGCGGCGG - Intergenic
908534647 1:65066745-65066767 GGTGCCGGAGGAGGAGGAGGAGG - Intergenic
908534653 1:65066766-65066788 AGTCTAAGAGGAGGAGGCGGCGG - Intergenic
908648087 1:66301446-66301468 TGTCACAGAGGAGGAACCAGAGG + Intronic
908700211 1:66890662-66890684 GGAAGCAGAGGAGGAAGAGGAGG + Intronic
908795661 1:67828488-67828510 CAGCCCAGAGGAGGAAGCTGAGG - Intronic
909979811 1:82085350-82085372 GGTGGCAGAGGAAGAAGAGGTGG + Intergenic
910841960 1:91569730-91569752 AGTCACAGAGTAGGAAGCGGAGG + Intergenic
913254630 1:116942465-116942487 GGTTACAGAGGAGGAAGCTGAGG - Intronic
913424275 1:118709352-118709374 GGTCCCAGAGGAGGGAGGAAAGG + Intergenic
914879743 1:151538181-151538203 AGTCACAGAGGAGGGAGAGGAGG - Exonic
915111296 1:153566019-153566041 GGGGCCAGAGGAGGCAGCTGGGG + Intronic
915320215 1:155052142-155052164 GGTGCTCGAGGAGGAAGCAGAGG + Intronic
915354856 1:155250160-155250182 GGTCCCTGAGGAGGAAGAAAGGG - Intronic
915557910 1:156670347-156670369 GGGCCCCCAGGAGGAAGGGGAGG - Exonic
915835655 1:159172949-159172971 GGTCCCTGAGGAGGGAGGGCAGG + Intronic
916290540 1:163161416-163161438 GGTGCCAGAAGAGGAAACGGAGG + Intronic
917207171 1:172588841-172588863 AGTTCAAGAGGAGGAAGAGGAGG + Exonic
917984356 1:180299768-180299790 ATTCCCAGTGGAGGAAGAGGAGG + Intronic
918383581 1:183983258-183983280 ATTCCCAGAGGAGGAAGAGGAGG + Intronic
919876737 1:201874854-201874876 GGACCAGGAGGAGGAAGAGGAGG + Exonic
919974628 1:202602632-202602654 CGTCCCAGAGGAGGCAGTTGGGG + Intronic
920160992 1:203997523-203997545 GGGCACAAAGGAGGAAGGGGTGG - Intergenic
920312391 1:205056389-205056411 GGCCTCAGAGGCGGAGGCGGCGG - Intronic
920526952 1:206674328-206674350 GGGCCCAGATGAGGAAACTGAGG - Intronic
921080379 1:211734323-211734345 GGTGGCAGAGGTGGAAGAGGTGG + Intergenic
921637339 1:217512069-217512091 AATCCCAGAGGTGGAAGTGGAGG + Intronic
921825986 1:219672535-219672557 CCTCCCAGAGGAGGAACTGGAGG - Intergenic
922568673 1:226618782-226618804 GTTCTCAGAGGAGGAGGAGGAGG + Intergenic
922900112 1:229130078-229130100 TGGCACAGAGGAGGAAGCTGGGG + Intergenic
923007914 1:230067061-230067083 GGCACCAGAGCAGGAAGCAGCGG - Intronic
923046719 1:230361333-230361355 AGACCTAGAGGAGGAAGAGGAGG + Intronic
923146438 1:231202019-231202041 GGTGGCAGAGGAGGAGGAGGTGG + Intronic
923372702 1:233328493-233328515 GGACCCGGAGCAGGACGCGGCGG + Exonic
923378448 1:233390366-233390388 GGTGGCAGAGGCGGAAGAGGTGG - Intergenic
923969679 1:239185813-239185835 GGTGATAGAGGAGGAAGAGGTGG + Intergenic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
924616705 1:245617957-245617979 GGTCCCAGAAGAGGCAGAAGGGG - Intronic
1062982498 10:1737067-1737089 AGTCCAAGAGGAGGAGGAGGCGG - Exonic
1063346838 10:5319453-5319475 GGTCCCAAAGTAGAAAGTGGAGG - Intergenic
1064252674 10:13718688-13718710 GGAAGCAGAGGAGGAAGCTGAGG + Intronic
1064712948 10:18144971-18144993 GGTAACAGAAGAGGAAACGGAGG + Intronic
1065099768 10:22321408-22321430 GGCCCCGGAGGAGGAGGCGTTGG + Exonic
1066349071 10:34620030-34620052 GGTCTCTGAGGAGGAGGTGGTGG - Intronic
1067419483 10:46133949-46133971 GGTCCCACAGGAGCAGGCGGGGG + Intergenic
1067426533 10:46215462-46215484 GGTGCCACAGGAGCAGGCGGGGG - Intergenic
1067504834 10:46840546-46840568 GGTCCCACAGGAGCTGGCGGGGG + Intergenic
1068395734 10:56458768-56458790 GGTTGTAGAGGAGGAAGAGGAGG + Intergenic
1069526903 10:69180428-69180450 GGAGGCAGAGGAGGAGGCGGTGG - Exonic
1069616204 10:69807759-69807781 GGTACCAGAGGAGTCAGGGGTGG + Intronic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069976591 10:72218059-72218081 GATCCCGGAGGGGGAGGCGGAGG + Intronic
1070326143 10:75390467-75390489 TGGCCCTGAGGAGGAAGAGGAGG - Intergenic
1070370691 10:75779314-75779336 GGTCCCAGAGGAGAATGTGGTGG - Intronic
1070745721 10:78932554-78932576 GGCTCCAGAGGGGGAAGGGGCGG - Intergenic
1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG + Intronic
1071521588 10:86334735-86334757 TGTTCCAGAGGAGGAAACCGAGG + Intronic
1073468355 10:103707727-103707749 TGTCCCAGAAGAGGAAGCTGAGG + Intronic
1073544561 10:104337683-104337705 AGTCCCGAAAGAGGAAGCGGCGG + Intronic
1074059090 10:109948702-109948724 TTTCACAGAGGAGGAAACGGAGG + Intronic
1074764722 10:116692158-116692180 GCTCCCCCAGGAGGAAGCTGAGG + Intronic
1075042362 10:119118473-119118495 GGTCCCTGAGCAGGAGGCGAGGG + Intronic
1075058939 10:119241164-119241186 CGTCACAGACGAGGAAGCTGAGG - Intronic
1075273046 10:121069597-121069619 GTTCCCAGAAGAGGATGCGCTGG - Intergenic
1076158410 10:128221970-128221992 CGTTCCAGGGGAGGAAGGGGCGG - Intergenic
1076180313 10:128401969-128401991 GTTCTCAGAGAAGGAAGAGGTGG + Intergenic
1076517452 10:131055809-131055831 GTTGCCAGACGAGGAAGCGTGGG - Intergenic
1076597896 10:131637290-131637312 GGTCACAGAGAAGGAAACGGTGG + Intergenic
1076615040 10:131749575-131749597 GCTCCCGGAGGAGGAAGCCCAGG - Intergenic
1076869661 10:133187165-133187187 CGTCCCCGCGGAGGCAGCGGAGG - Intronic
1077154946 11:1087105-1087127 GGACCCGGAGGAGGACCCGGAGG - Intergenic
1077154951 11:1087117-1087139 GGACCCAGATGAGGACCCGGAGG - Intergenic
1077154970 11:1087171-1087193 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077154998 11:1087253-1087275 GGACCCAGAGGAGGACCTGGAGG - Intergenic
1077155018 11:1087309-1087331 GGACCCAGAGGAGGACCTGGAGG - Intergenic
1077155029 11:1087337-1087359 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155054 11:1087426-1087448 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077556398 11:3228109-3228131 GGCCGCAGAAGAGGAAGAGGAGG + Exonic
1077865352 11:6217611-6217633 GGTGCCAAAGGAGGGAGCTGGGG - Exonic
1078336121 11:10464648-10464670 GACCCCAGAGGAGGATGCTGGGG - Intronic
1080517180 11:33035285-33035307 GGTCACAGAGGTGGAGGAGGTGG - Intergenic
1080643805 11:34173949-34173971 GGTGCCAGATGAGGAAGGAGTGG - Intronic
1081565611 11:44259133-44259155 GCTCCCACAGGAAGAAGCAGGGG + Intergenic
1081824179 11:46031436-46031458 GGGCCCAGAGTAGGAAGGGAAGG + Intronic
1082790850 11:57345932-57345954 GAGAACAGAGGAGGAAGCGGGGG - Intronic
1082810417 11:57476194-57476216 GGTTCCCGTGGAGGAAGAGGTGG - Exonic
1083349617 11:62018107-62018129 AGTCCCAGAAGAGGAAGCCTAGG - Intergenic
1083448552 11:62727181-62727203 GTTCGCAGGGGAGGAGGCGGCGG - Exonic
1083571450 11:63764044-63764066 GGAGCCAGAGGAGGAGGAGGAGG - Exonic
1083614295 11:64018741-64018763 GTTTCCAGAGGAGGAAACTGAGG + Intronic
1083626918 11:64076623-64076645 TTTTCCAGAGGAGGAAGCTGAGG + Intronic
1083803423 11:65059532-65059554 TGTCCCAGAGGAGGCAGCAGGGG + Intergenic
1083903637 11:65655999-65656021 GGTCCCTCAGGAGGAAGGGGAGG + Intronic
1084119827 11:67062577-67062599 GGTCCCAGAGTGGGCAGCTGAGG - Intronic
1084331055 11:68430905-68430927 TTTCACAGAGGAGGAAGTGGAGG - Intronic
1084528975 11:69715619-69715641 GCTCCCAGAGCAGGAAACCGAGG + Intergenic
1084698536 11:70770768-70770790 GATCCCAGAGCAGGAACCTGGGG - Intronic
1084960365 11:72713202-72713224 GGTCCCAGAGGAGGGGCCGGGGG - Exonic
1085460289 11:76689330-76689352 GGTGCCAGAGGAGGAGGCCAGGG + Intergenic
1086071592 11:82805664-82805686 GGTCTTAGAGGTGGAAGAGGAGG + Intergenic
1086071594 11:82805673-82805695 GGTGGAAGAGGAGGAAGTGGAGG + Intergenic
1086699544 11:89884779-89884801 TTTCCCAGAGGAGGAAACTGAGG + Intergenic
1086706627 11:89959735-89959757 TTTCCCAGAGGAGGAAACTGAGG - Intergenic
1089125990 11:116176915-116176937 GGTCCCAGAGCTGGAAAAGGTGG + Intergenic
1089183084 11:116596234-116596256 TTTCCCAGATGAGGAAACGGAGG - Intergenic
1089290908 11:117437563-117437585 GGGCGCAGAGGAGGAAGAGGAGG + Intronic
1089338889 11:117744554-117744576 GGACGCAGAGGAGGAAGCTAGGG - Intronic
1089668629 11:120036158-120036180 GAGCCTAGAGGAGGAAGAGGAGG - Intergenic
1089713706 11:120336447-120336469 GGTCCGGGAGGCGGAGGCGGCGG - Intergenic
1090168725 11:124579416-124579438 GGTGTCAGAGAAGGAAGAGGTGG + Intergenic
1091224790 11:133950879-133950901 GTGCCCAGAGGAGGAGGAGGAGG - Intronic
1091301081 11:134508691-134508713 GGTCCCAGAGGGTGAAGGGACGG + Intergenic
1091302608 11:134516952-134516974 GGGACCAGAGGAGGAAGCCCAGG + Intergenic
1091969126 12:4771366-4771388 GTGCCCAGAGGAGGAAAGGGTGG + Intronic
1091994104 12:4979150-4979172 GGTGCGAGAGGAGGAAGTGGAGG + Intergenic
1092788187 12:12048862-12048884 GGGTGCGGAGGAGGAAGCGGAGG + Intergenic
1093061890 12:14616156-14616178 GCTTCCAGATGAGGAAGAGGAGG + Intronic
1094122465 12:26988826-26988848 GGTGGCAGAGGTGGAAGGGGAGG - Intronic
1096226126 12:49867904-49867926 GGACCCAGAGTAGGAGGCTGCGG + Exonic
1096256123 12:50063388-50063410 GGTCTCAGCGGAGGAGGGGGTGG - Intronic
1096403206 12:51324157-51324179 GGCCCCCGAGGAGGAAGTGCGGG + Intronic
1096411002 12:51377160-51377182 GGGCCCAGAGGAGGGGGCCGGGG - Intronic
1096519201 12:52174624-52174646 AGCCCCAGAGGAGGAAACTGAGG + Intronic
1096561163 12:52436952-52436974 GGTCACAGAAGAGGGAGTGGAGG - Intergenic
1096625167 12:52890676-52890698 GGCCTCAGAGGAGGAAGAGTAGG + Intergenic
1096647609 12:53047254-53047276 GGACGCGGAGGAGGAGGCGGTGG - Intronic
1096680740 12:53253552-53253574 GGTCCGACAGGAGGCAGCGCAGG - Exonic
1096882951 12:54687405-54687427 TGTCCCTGAGGAAGAAGGGGAGG + Intergenic
1097452948 12:59757687-59757709 GGTGCCAGAGATGGAAGAGGTGG - Intronic
1097779341 12:63685736-63685758 GTTGGCAGAGGAGGAAGAGGAGG - Intergenic
1099263073 12:80408800-80408822 GGTGGAAGAGGAGGAAGAGGAGG - Intronic
1099263088 12:80408860-80408882 GGTGGAAGAGGAGGAAGGGGAGG - Intronic
1100121122 12:91370504-91370526 GGGCACAGAGGAAGAAGTGGAGG + Intergenic
1100255821 12:92881914-92881936 TGTCTCAGAGGAGGCAGAGGTGG - Intronic
1100523259 12:95396686-95396708 ATTCCCAGAGGAGGAAACTGAGG - Intergenic
1100605230 12:96146963-96146985 TTTCACAGAGGAGGAAGCTGAGG - Intergenic
1100823878 12:98456978-98457000 CGCCCCAGAGGAGGAGGCCGAGG + Intergenic
1101335299 12:103791382-103791404 TGTCCTAGAGGAAGAAGTGGGGG - Intronic
1101542449 12:105677124-105677146 GCTAGCAGAGGAGGAAGAGGTGG + Intergenic
1101612559 12:106304210-106304232 GGCCCCAGAGGGGGAAGCACAGG + Intronic
1102009151 12:109607375-109607397 AGTCACAGAGGAGGTAGTGGTGG + Intergenic
1102028383 12:109726429-109726451 AGTCCCACAGCAGGAAGTGGTGG + Intronic
1102535421 12:113577162-113577184 AGTCAGAGAGGAGGAAGAGGAGG - Intergenic
1102675582 12:114656229-114656251 GGGCCCAGATAAGGAAGCGGAGG - Intergenic
1103954332 12:124567864-124567886 GCTCCCCGAGGAGGAAGGAGGGG + Intergenic
1104811171 12:131621171-131621193 GTTCCTGGAGGAGGAGGCGGCGG + Intergenic
1104957764 12:132474713-132474735 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957773 12:132474736-132474758 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957803 12:132474806-132474828 GGTCACCGCGGAGGAAGGGGTGG - Intergenic
1104957833 12:132474876-132474898 GGTCACCGCGGAGGAAGGGGTGG - Intergenic
1104957852 12:132474922-132474944 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957881 12:132474988-132475010 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957901 12:132475035-132475057 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957920 12:132475079-132475101 GGTCACCGCGGAGGAAGGGGTGG - Intergenic
1104957939 12:132475125-132475147 GGTCACCGCGGAGGAAGGGGTGG - Intergenic
1104957959 12:132475170-132475192 GGTCACCGCGGAGGAAGGGGCGG - Intergenic
1104957978 12:132475216-132475238 GGTCACCGCGGAGGAAGGGGTGG - Intergenic
1105249114 13:18680605-18680627 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1105865451 13:24454768-24454790 GATCGCAGATGAGGAAACGGAGG + Intronic
1108441225 13:50454746-50454768 GTTCCCATAGGTGGAAGGGGAGG - Intronic
1110807539 13:79774399-79774421 GGTATCAGAGGTGGAAGAGGGGG + Intergenic
1110850957 13:80244480-80244502 GGTGCTAGAGGAGGAAACTGGGG + Intergenic
1111951558 13:94712609-94712631 GGCCCTGGAGGAGGAAGAGGAGG + Intergenic
1112029730 13:95446184-95446206 GTTCCCAGAGGAGGTCGAGGGGG + Intronic
1112506933 13:99981146-99981168 TGTGCCGGAGGAGGAGGCGGGGG - Intergenic
1113507843 13:110829470-110829492 TTTCCCAGAGGAGGAAACTGAGG + Intergenic
1113724405 13:112587743-112587765 GGGCCCGGACGAGGGAGCGGAGG - Intronic
1113799090 13:113077325-113077347 GGGCCCGGAGGTGGAAGGGGAGG - Intronic
1114248385 14:20935355-20935377 GGTCCAAAAGGAGGAAGAGGAGG + Intergenic
1115235760 14:31207538-31207560 GGTCCTCGCGGAGGAAGGGGAGG - Intronic
1115485732 14:33909560-33909582 GGTGACAGAGGAGGAAGCTGAGG + Intergenic
1117343373 14:54810046-54810068 GGCCCCAGAGCTGGAAGAGGTGG + Intergenic
1117365260 14:55021019-55021041 TGTCTCAGAGGTGGAAGAGGGGG + Intronic
1117454391 14:55883144-55883166 TGTCCCAGAGAAGGAAAGGGTGG - Intergenic
1117488655 14:56224873-56224895 GGACCCAGAGAAGGGAGCTGAGG - Intronic
1117639620 14:57784784-57784806 GGTGGCAGAGGTGGAAGGGGAGG - Intronic
1118918874 14:70131881-70131903 GGCCACAGAGAAGGAAGTGGAGG + Intronic
1118984033 14:70738333-70738355 CGTCCCAAAGGAGGAAGGGGAGG - Exonic
1119092395 14:71796805-71796827 GGTGGCAGAGGTGGAAGAGGTGG - Intergenic
1119248216 14:73131130-73131152 GGTCACTGAGGAGGAAGCAGAGG + Intergenic
1119474816 14:74920953-74920975 TGTTCCAGATGAGGAAGCTGAGG - Intronic
1119573017 14:75693036-75693058 GGTCTCAGAGGAGGCAGGAGAGG + Intronic
1119684890 14:76623643-76623665 CTTTCCAGAGGAGGAAGCTGAGG - Intergenic
1119742888 14:77025979-77026001 GGTCCCAGAGGTGGGGGCGGCGG + Exonic
1121188919 14:92006735-92006757 GGTTCAAGAGGTGGAGGCGGAGG - Intronic
1121310128 14:92931398-92931420 GGCCCCTGGGGAGGAAGAGGAGG + Exonic
1121493610 14:94377473-94377495 GGACTCAGAGGAGGAAAGGGAGG + Exonic
1121619102 14:95333808-95333830 GGTCCCAGGGGAGAAGGCAGGGG + Intergenic
1122135033 14:99627910-99627932 GGCCCCCGAGGAGGAAGGGCTGG + Intergenic
1122154517 14:99742235-99742257 AGTCCCTGAGGAGCAAGAGGTGG + Intronic
1122159771 14:99774488-99774510 AGTCCCAGAGGAGGAGGGTGAGG - Intronic
1122200193 14:100117827-100117849 GCTCCCAGAGCAGGAAACAGTGG - Intronic
1122613709 14:103002595-103002617 GGACACTGAGCAGGAAGCGGGGG + Intronic
1122810066 14:104283383-104283405 GCTCCTAGAGGAGGAGACGGTGG + Intergenic
1122972678 14:105158753-105158775 GGGCCCAGAGGAGGGGGCTGGGG + Intronic
1123008976 14:105338123-105338145 TTTCCTGGAGGAGGAAGCGGGGG + Intronic
1124425418 15:29558703-29558725 GGTGGCAGAGAAGGAAGAGGTGG - Intronic
1124917200 15:33987512-33987534 GGTCCCAGAGGCTGCAGCTGGGG - Intronic
1124950779 15:34318627-34318649 GGACCCAGAGGAGGGGGCAGCGG - Intronic
1125728612 15:41880701-41880723 GGGCCCAGCGGAGGAAGCGAAGG - Intronic
1127702884 15:61518356-61518378 GCTGCCTTAGGAGGAAGCGGGGG + Intergenic
1127830638 15:62747983-62748005 GGTGGCAGAGGTGGAAGAGGTGG + Intronic
1127942744 15:63716332-63716354 GGAGCCAGAGGATGAAGAGGAGG - Exonic
1128139750 15:65290762-65290784 AGTGGCAGAGGAGGAAGAGGTGG - Intronic
1128339144 15:66808358-66808380 AGCCTCAGAGGAGGAAGAGGAGG + Intergenic
1128349249 15:66878072-66878094 ATTCCCAGGGGAGGAAGCTGAGG + Intergenic
1128357160 15:66936261-66936283 TTTCCCAGAGAAGGAAGCAGAGG - Intergenic
1128683138 15:69665940-69665962 CGTCCCAGAGGGAGAAGCAGAGG - Intergenic
1129325178 15:74796365-74796387 GGTGGCAGAGGTGGAGGCGGAGG + Intronic
1129410808 15:75349256-75349278 GGTCCCAGCGGCCGAACCGGCGG - Exonic
1129750534 15:78059732-78059754 GGCCCAAGAGGAGGAACAGGTGG - Intronic
1129834410 15:78692935-78692957 GGAGCAAGAGGAGGAAGGGGAGG + Intronic
1130048477 15:80464272-80464294 TTCCCCAGAGGAGGAAGCTGAGG - Intronic
1131387501 15:92019298-92019320 AGTCACAGAGGAGCAAGCTGAGG - Intronic
1131592001 15:93759995-93760017 GTTCACAGAGGAGGAAACTGAGG + Intergenic
1132552080 16:557689-557711 GGGCTCAGAGAAGGCAGCGGAGG - Intergenic
1132585025 16:702350-702372 GGTCCCGGAGCAGGAGGCAGGGG - Intronic
1132701918 16:1225629-1225651 GCTCCCAGAGGATGAAGGAGAGG - Intergenic
1132709634 16:1260580-1260602 GGTTCCAGATGAGGAAACCGAGG - Intergenic
1132716032 16:1290205-1290227 GCTCCCAGAGGAAGACACGGTGG + Intergenic
1132726174 16:1339232-1339254 GGCCCCAGAGGAGGTAAAGGTGG + Exonic
1133020535 16:2964935-2964957 GGTCCCAGAAGAGGCACGGGCGG - Exonic
1133028298 16:2998045-2998067 GGTCTCAGTGGGGGAAGGGGTGG + Intergenic
1133116789 16:3582159-3582181 GAGCCCAGAGGAGGAAGCCCTGG + Exonic
1134084799 16:11349030-11349052 TGTTCCAGAGGAAGAGGCGGTGG - Intronic
1135120633 16:19763392-19763414 GGTGGCAGAGGTGGAAGGGGAGG + Intronic
1135258275 16:20959143-20959165 GGTCCCAGAGAAGGCAGTGGTGG + Intronic
1135663416 16:24316085-24316107 TTTCACAGAGGAGGAAGCTGAGG + Intronic
1136081288 16:27854168-27854190 GGACGCAGGGGAGGAAGAGGAGG + Intronic
1136255124 16:29033592-29033614 CGGCCAAGAGGAGGAAGCGCAGG + Intergenic
1136401450 16:30021477-30021499 GGCCACAGAAGAGGAAACGGAGG + Intronic
1136418342 16:30116935-30116957 GATCACAGTGGAGGAAGCGCTGG - Exonic
1137576993 16:49606573-49606595 GGTCCCAGAGGGAGAACCTGTGG + Intronic
1137704153 16:50522469-50522491 TGTTACAGATGAGGAAGCGGAGG + Intergenic
1138107919 16:54300246-54300268 TGTCACAGAGGAGGAAACTGAGG - Intergenic
1139464398 16:67146551-67146573 GGTCACAGAGGCCGAAGCAGTGG + Intronic
1139949826 16:70663405-70663427 GGCCCCAGAGGAGGAAGAGGAGG + Exonic
1140202215 16:72903910-72903932 GGGCCCAGAGGAGGAAGCGATGG - Intronic
1140221598 16:73048079-73048101 GGCGGCAGAGGAGGAGGCGGCGG - Exonic
1140469616 16:75206818-75206840 GCTCTCAGGGGAGGAGGCGGGGG - Intronic
1141361233 16:83396922-83396944 GGTTCCAGTTGAGGAAGCTGAGG + Intronic
1141430650 16:83968874-83968896 GGTCCCAGCGGAGGCCACGGCGG - Intronic
1141595739 16:85095809-85095831 GGGCCCTGAGGAGGCAGAGGTGG - Intergenic
1141622179 16:85242173-85242195 GGTGCCAGGAGAGGAAGCGAGGG - Intergenic
1141624713 16:85255072-85255094 GGGCCCAGAGAGGGAGGCGGCGG + Intergenic
1141755459 16:85987804-85987826 GGTCCCAGAGGAGGATGGGGAGG - Intergenic
1142110561 16:88328887-88328909 GGAGGCCGAGGAGGAAGCGGAGG + Intergenic
1142285894 16:89171424-89171446 GGAGCCAGAGGAGGATGGGGCGG - Intergenic
1142349849 16:89575103-89575125 GGTCCCGGGGGAGGGAGCAGCGG - Intergenic
1142379626 16:89723903-89723925 GCTCACAGAGGAGCAAGAGGCGG - Intronic
1142589279 17:994495-994517 GGTCCCAGAGAAGAAATGGGTGG - Intergenic
1142711994 17:1728409-1728431 GGGCTCCGAGGAGGAAGAGGAGG + Exonic
1142712005 17:1728448-1728470 GGTGCTAGAGGAGGAGGAGGGGG + Exonic
1143135615 17:4710805-4710827 GGTCCCAGACGAGGGCGCAGCGG + Intronic
1143145337 17:4771746-4771768 GGGCCCTGAGGAGGCAGAGGCGG - Intergenic
1143729480 17:8872951-8872973 GGTTACAGAGGAGGAAACTGAGG - Intergenic
1144554187 17:16267334-16267356 GGTGGCAGAGGCGGAAGAGGTGG + Intronic
1144993301 17:19249006-19249028 GGGCGCAGAGGAGGAAGAGCTGG + Intronic
1145251709 17:21300396-21300418 GGTCACACAGCAGGGAGCGGTGG + Intronic
1145255662 17:21320947-21320969 GGCCCAAGAGGAGGCAGTGGAGG - Intergenic
1145275292 17:21425519-21425541 GGACCCACAGCAGGAAGTGGCGG - Intergenic
1145313146 17:21711413-21711435 GGACCCACAGCAGGAAGTGGCGG - Intergenic
1145320952 17:21767001-21767023 GGCCCAAGAGGAGGCAGTGGAGG + Intergenic
1145711598 17:26983369-26983391 GGACCCACAGCAGGAAGTGGTGG - Intergenic
1145919275 17:28598537-28598559 GGTCAGCGAGGAGCAAGCGGGGG + Exonic
1146377624 17:32305206-32305228 GGACTCAAAGGAGGAAGAGGTGG + Intronic
1146894185 17:36529348-36529370 GGGACCACAGGAGGAAGTGGAGG - Intronic
1147123941 17:38352665-38352687 GGTCGCGGAGGAGGAGGGGGCGG + Exonic
1147570429 17:41567394-41567416 GGGTCCAGGGGAGGAAGTGGAGG - Exonic
1147570452 17:41567478-41567500 GGTCATAGTGGAGGAAGTGGGGG - Exonic
1147570481 17:41567592-41567614 GGGTCCAGGGGAGGAAGTGGAGG - Exonic
1147570500 17:41567661-41567683 GGATCCAGGGGAGGAAGTGGAGG - Exonic
1147978701 17:44261982-44262004 GGTCTCAGAGGTGGCAGGGGAGG - Intronic
1148051439 17:44771902-44771924 GGAGCCGGAGGAGGAAGAGGTGG - Intronic
1148384923 17:47227544-47227566 GGTGGCAGAGGTGGAAGAGGAGG - Intergenic
1148644937 17:49214386-49214408 GGTCCCAGATCAGGCAGTGGGGG - Intronic
1148699696 17:49580078-49580100 GCTCCCAGAGGAGCCAGCAGGGG - Exonic
1148786740 17:50149442-50149464 GGCCCCGGAGAAGGAGGCGGCGG - Exonic
1148846365 17:50532456-50532478 CGGCCCAGAGGAGGAAGGGGAGG + Intergenic
1149560850 17:57606919-57606941 AGACCCAGAGGAGGGAGCAGGGG + Intronic
1149712550 17:58756252-58756274 GGAGCCCGAGGAGGAGGCGGCGG + Exonic
1149993837 17:61396911-61396933 GCACACAGAGGAGGAAGCGGCGG + Intergenic
1150614977 17:66763360-66763382 GGTCCCACAGTAGCAAGTGGAGG + Intronic
1150715555 17:67569950-67569972 GAGCCCAGAGGAGGAAGAAGAGG + Intronic
1150747372 17:67826144-67826166 GGTCTCCGAGGAGGAGGAGGAGG + Exonic
1151232353 17:72694057-72694079 AGTCCCAGAGGAAGAAGAGGAGG + Intronic
1151242815 17:72771464-72771486 TGACCCAGAGGAGGAAATGGGGG + Intronic
1151728030 17:75895653-75895675 GGGCCAGGAGGAGGAAGGGGAGG - Intronic
1152068726 17:78124952-78124974 GGACCCCGAGGGGGAAGTGGAGG - Exonic
1152123981 17:78435358-78435380 GGGCCCACAGGAAGAAGCGGTGG - Intronic
1152350028 17:79779003-79779025 GGAGCCAGAGGAGGAAGGGAAGG - Intronic
1152388140 17:79987322-79987344 AGCCCAAGAGGTGGAAGCGGAGG - Intronic
1152556778 17:81057216-81057238 AGTCCCTGAGGAGGAAGCCCAGG + Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152758735 17:82097770-82097792 GCTCCGGGAGGAGGATGCGGCGG + Intronic
1152788075 17:82262236-82262258 GCTCCCAGAGAAGGAAATGGCGG - Intronic
1152856465 17:82667510-82667532 GGGCCCGGAGGAGGAAGCAGAGG - Intronic
1152870837 17:82752223-82752245 CGGCCCCGAGGAGGAGGCGGAGG + Exonic
1153032778 18:730542-730564 GGTCCCAGAGAAGGAACCATAGG - Intronic
1154439771 18:14378625-14378647 GGCCCCCGAGGAGGAGGAGGAGG - Intergenic
1155076769 18:22364263-22364285 GGTGGCAGAGGCGGAAGAGGAGG - Intergenic
1155185482 18:23383416-23383438 GAGGCCAGAGGAGAAAGCGGGGG + Intronic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156509574 18:37625228-37625250 GGACCCACATGAGGAAGCAGTGG - Intergenic
1156759099 18:40565567-40565589 TGTGACAAAGGAGGAAGCGGGGG + Intergenic
1157926871 18:51776261-51776283 TGTCCCAGAGGGGGCAGAGGAGG + Intergenic
1158404260 18:57147191-57147213 GGGCCCCAAGGAGGCAGCGGCGG - Exonic
1159903059 18:74066159-74066181 GCTCCCAGAAGATGAAGGGGAGG + Intergenic
1159946222 18:74446644-74446666 TGTCGCAGAGGTGGAGGCGGTGG + Exonic
1160375182 18:78406109-78406131 GGAAGCAGAGGAGGAAGAGGAGG - Intergenic
1160536637 18:79598000-79598022 AGCCCCAGAGGAGGACGAGGAGG + Intergenic
1160672904 19:374660-374682 ATTCACAGAGGAGGAAGCTGAGG - Intronic
1160680586 19:410172-410194 GGTTCCAGAAGAGGAAACTGAGG - Intergenic
1160712562 19:559206-559228 TCTCCCAGAGTGGGAAGCGGGGG + Intergenic
1160820481 19:1055420-1055442 GGTCCTGGAGGAGGAAGTGGAGG + Intronic
1160823012 19:1067096-1067118 GCTCCCGAAGGCGGAAGCGGGGG + Intronic
1160861412 19:1238589-1238611 GGTCTAAGAGGGAGAAGCGGGGG - Intergenic
1161021045 19:2011712-2011734 GGTGGCAGAGGTGGAAGGGGAGG - Intronic
1161168195 19:2799866-2799888 AAGCCCACAGGAGGAAGCGGCGG - Intronic
1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG + Intronic
1161204491 19:3034014-3034036 GGTCTCAGAGTAGGAACCGGAGG - Intronic
1161535790 19:4817853-4817875 GGTCCCAGAGGGCAAAGCCGAGG + Exonic
1162378534 19:10318726-10318748 GTTCCTGGAGGAGGAAGAGGAGG - Intronic
1162802726 19:13119886-13119908 GGGTCCAGACGAGGAAGCTGAGG + Intronic
1162866863 19:13554581-13554603 CTTCCCAGAGGAGGAAGCATTGG - Intronic
1163026687 19:14517010-14517032 GGCCCCAGTGGCGGTAGCGGCGG - Exonic
1163056267 19:14721151-14721173 ATTCCCAGATGAGGAAGCTGAGG + Exonic
1163120666 19:15215569-15215591 AGGCCCAGAGGAGGAAGGAGAGG + Intergenic
1163144780 19:15373055-15373077 GGGCTCAGAGGACGCAGCGGGGG + Exonic
1163146145 19:15380223-15380245 GCCCCCAGAGGAGGAGGAGGAGG - Exonic
1163152391 19:15423012-15423034 GGACACAGAGGAGGAAGAAGAGG + Exonic
1163163903 19:15482282-15482304 GGTGGCAGAGGTGGAAGAGGAGG - Intronic
1163164018 19:15483055-15483077 GGTGGCAGAGGTGGAAGAGGTGG - Intronic
1163329879 19:16629134-16629156 CGTCACAGAGGAGGAAACGGAGG + Intronic
1163406402 19:17125857-17125879 ATTCGCAGAGGAGGAAGTGGAGG - Intronic
1163423684 19:17229099-17229121 GGACCCAGAGGAGGAAGTCCTGG - Exonic
1163663900 19:18594291-18594313 GGTCGTAGAGGCGGAAGCTGAGG + Exonic
1163715587 19:18870449-18870471 GGTCCCAGGGGAGGTGGCGGCGG + Exonic
1164387987 19:27793431-27793453 GGCCCCTCAGGAGGAAGGGGCGG + Intergenic
1164690364 19:30206411-30206433 GGTACCAGAGGAGGAACCTGTGG + Intergenic
1165069609 19:33247931-33247953 GGGCCCAGAGCAGAAAGGGGTGG - Intergenic
1165101814 19:33442947-33442969 GGGCCCTGGGGAGGCAGCGGTGG - Intronic
1165138594 19:33686062-33686084 GGTCCCAGAGGGAAAAGCTGGGG + Intronic
1165157098 19:33795634-33795656 GGTCGCCGAGGAGGAGGAGGAGG + Intergenic
1165433853 19:35786542-35786564 GGACTCAGAGGAGGAAGAGGAGG - Intronic
1165611856 19:37161604-37161626 GGTGGCAGAGGCGGAAGAGGAGG - Intronic
1166368759 19:42290357-42290379 GGACGCAGAGGAGGATGGGGCGG - Exonic
1166569482 19:43784736-43784758 GGTCCAGGAGGAAGAAGCTGGGG + Intergenic
1166753713 19:45178101-45178123 GCTCCGTGGGGAGGAAGCGGGGG - Exonic
1166881546 19:45933545-45933567 GGTCCCAGATGGGGGAGCTGGGG - Intergenic
1166983153 19:46643658-46643680 GGTCCCAGGGAGGGAAGCTGGGG - Intergenic
1167210862 19:48133362-48133384 GGACGCAGAGGAGGGAGGGGAGG - Intronic
1167338363 19:48900440-48900462 GGTCCCGGAGGAGGATGCACTGG + Intronic
1167428849 19:49443014-49443036 GATCCCAGAGGCGGAGGCGGTGG - Intergenic
1167593168 19:50415180-50415202 GTTCCCAGAGGAGGAGGGGCTGG - Intronic
1167595140 19:50423536-50423558 GGCCTGAGAGGAGGAAGTGGAGG + Intronic
1168064235 19:53910019-53910041 GGTCCCAAAGGAGGAAAGGCTGG + Intronic
1168240182 19:55084995-55085017 TTTCACAGAGGAGGAAGCTGAGG - Intronic
1168451842 19:56472530-56472552 TGTCTCAGAGGTGGAAGAGGTGG - Intronic
925451578 2:3973696-3973718 GGTCCCACAGCAGGAAGGGCTGG - Intergenic
925625931 2:5842080-5842102 GGTTGCAGAGGAGGGAGCTGAGG + Intergenic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
926609738 2:14934380-14934402 AGTACGAGAGGAGGAAGAGGAGG - Intergenic
927196489 2:20551271-20551293 GGGCCCAGAAGAGAAAGGGGAGG + Intergenic
928433594 2:31239617-31239639 GGTCCCTGGGCAGGAAGTGGTGG - Intronic
928605931 2:32945614-32945636 TGTGACAGAGGAGGAAGTGGAGG + Intergenic
929387642 2:41429272-41429294 GGTCCCACAGAAGCAAGCAGTGG + Intergenic
929701859 2:44169156-44169178 AGACCCCGAGGGGGAAGCGGCGG + Exonic
929777827 2:44939468-44939490 GGGGCAGGAGGAGGAAGCGGGGG - Intergenic
930073452 2:47388000-47388022 GGTCGCAGAGGCAGAAGAGGTGG + Intergenic
931162601 2:59709797-59709819 GGTGGCAGAGGCGGAAGAGGTGG - Intergenic
931320402 2:61170333-61170355 GGTGGCAGAGGCGGAAGAGGTGG - Intergenic
932029270 2:68166531-68166553 GGTGGCAGAGGAGGAAGATGTGG + Intronic
933634460 2:84692486-84692508 TTTCCCAGAGAAGGAAGGGGAGG + Intronic
933997213 2:87678921-87678943 TGTCCCAGAGGAAGAAGATGAGG - Intergenic
934854133 2:97718481-97718503 GGCCCCAGGGGTGGAAGAGGAGG + Intronic
935971520 2:108534444-108534466 GGGCCCGGAGCAGGAAGGGGAGG - Intronic
936296638 2:111271989-111272011 TGTCCCAGAGGAAGAAGATGAGG + Intergenic
936349439 2:111701879-111701901 GGTCCCAGAGGGCGAACTGGAGG + Intergenic
936370586 2:111898932-111898954 GGTGCCAGAGGAGGGGGCGTAGG + Intronic
936405109 2:112195897-112195919 GGGCCCAGAGGTGGGAGAGGAGG - Intergenic
936976481 2:118226235-118226257 GGTCACAGATGAGGAAACTGAGG + Intergenic
937222102 2:120347617-120347639 GGTCGCAGAGGGGGAAGCCCCGG + Intronic
938071021 2:128308442-128308464 GGGTCAAGAGGAGGAAGGGGTGG - Intronic
938378916 2:130825821-130825843 GTTCCCAGGGGAGAAAGGGGTGG - Intergenic
938855034 2:135301030-135301052 GGTGACAGAGGAAGAAGAGGAGG - Intronic
940284563 2:152020750-152020772 ACACCCAGAGGAGGAAGCCGGGG + Intronic
940971854 2:159904373-159904395 GGGCCCGGAGGAGGGCGCGGTGG - Intronic
942452413 2:176116492-176116514 GGGCCCAGGGGCCGAAGCGGGGG + Intronic
943724660 2:191241014-191241036 GGTAGCAGAGGTGGAAGAGGTGG + Intergenic
943786320 2:191881958-191881980 GGCCCCAGTGGCGGTAGCGGCGG - Intergenic
943892429 2:193307236-193307258 GATCCCAGAGGTAGAAGCTGTGG + Intergenic
944463286 2:199974835-199974857 GGTCACCTAGGAGGAAGCAGTGG + Intronic
944627445 2:201585958-201585980 GGTGGCGGAGGAGGAAGAGGTGG - Intronic
945988155 2:216371410-216371432 CGACCCAGAGGAGGAAGAGGAGG - Exonic
947734442 2:232447365-232447387 GGTCCCCGAGGAAGAGGAGGAGG + Intergenic
947762605 2:232614378-232614400 GGAGGCAGAGGAGGAAGGGGAGG - Intronic
947864721 2:233388413-233388435 CGTCCCAGGGGAGGAACTGGGGG + Intronic
947869770 2:233428126-233428148 GGAGCCAGAGGAGGAGGAGGTGG + Intronic
947962091 2:234248001-234248023 GGCCGCAGAGGAGGAGGGGGCGG - Intergenic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
1169020353 20:2326403-2326425 GAGGCCAGAGGAGGAAGCAGAGG - Intronic
1169076646 20:2764075-2764097 GGTAGCAGAGGAGGGAGCTGTGG - Intergenic
1169090684 20:2859821-2859843 GGTCCCAGAGCAGGTGGTGGTGG - Intronic
1169503433 20:6183721-6183743 GCTCTAAGAGGAGGAAGTGGAGG - Intergenic
1170064657 20:12298664-12298686 GGCCCCAGTGGTGGAAGCAGTGG + Intergenic
1170404129 20:16018744-16018766 GGTCCAAGAGAAGGAATCAGTGG - Intronic
1170680330 20:18520453-18520475 GGTACAAGAGGAGGATGCGAAGG + Intronic
1171411571 20:24951586-24951608 ATTCTCAGAGGAGGCAGCGGAGG - Intronic
1172117875 20:32583037-32583059 GCTCCCCGAGGGGGAAGCTGGGG - Intronic
1172630462 20:36374908-36374930 GGTCCAAGATGAGGAAGCCCTGG + Intronic
1172647150 20:36477669-36477691 TTTCCCAGAAGAGGAAGCTGAGG - Intronic
1172658202 20:36549552-36549574 GTTCCCCGAGGAGGAAGGGAAGG + Exonic
1173200709 20:40952938-40952960 TGTCACAGATGAGGAAGCTGAGG - Intergenic
1173289902 20:41705490-41705512 GGTGGCAGAGGTGGAAGAGGTGG - Intergenic
1173882339 20:46425065-46425087 GATGTCAGAGGAGGAAGCGTGGG + Intronic
1174357130 20:50005911-50005933 GGTCAGAGAGGAAGAAGGGGTGG + Intergenic
1174390389 20:50215258-50215280 AGACTCAGAGGAGGAAGCTGTGG - Intergenic
1174519107 20:51116048-51116070 GTTCACAGAGGGGGAAGCTGAGG - Intergenic
1175067098 20:56298399-56298421 GGACACAGAGGGGGAAGCTGAGG + Intergenic
1175596829 20:60241350-60241372 GGTCACACAGGAGGAAGGGGTGG - Intergenic
1175597864 20:60249787-60249809 GGCCCTAGAGCAGGGAGCGGAGG - Intergenic
1175892291 20:62321195-62321217 GGGGCCAGTGGAGGAAGAGGGGG + Intronic
1175892412 20:62321536-62321558 GGCGCCAGTGGAGGAAGAGGGGG + Intronic
1175892811 20:62322917-62322939 GGGCCCAGGGGAGGCAGCTGGGG - Intronic
1175916554 20:62428573-62428595 GGGCTCAGAGGAGGAAGCCTGGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1175939372 20:62531007-62531029 GTTTCCAGAGGAGGAAACTGAGG + Intergenic
1176074949 20:63244205-63244227 AGTCACAGAGGAGGAACCTGAGG - Intronic
1176285315 21:5016241-5016263 GGTGCCTGAGGAGGAGGAGGAGG + Intergenic
1176455973 21:6911148-6911170 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1176834147 21:13776196-13776218 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1178317492 21:31578764-31578786 TGCCCCAGAGGAGGAAATGGAGG - Intergenic
1178680764 21:34670372-34670394 GGACGCAGCGGAGGAGGCGGAGG + Exonic
1178805360 21:35834702-35834724 GGGGCCAGAAGAGGAAGAGGAGG - Intronic
1179581548 21:42347692-42347714 GCTCTCAGAGGAGGAAGGGGTGG - Intronic
1179637012 21:42719191-42719213 GTTCCCAAAGGAGGAAGCCATGG - Intronic
1179871866 21:44247234-44247256 GGTGCCTGAGGAGGAGGAGGAGG - Intronic
1180074646 21:45456363-45456385 GAGCCCAGAGGAGAAGGCGGAGG - Intronic
1180160715 21:45997682-45997704 GCACCCTGAGGAGGAAGAGGAGG - Exonic
1180940376 22:19656830-19656852 GGTCCCAGATGATGAGGCGCGGG + Intergenic
1181050985 22:20238177-20238199 GGGCACAGATGAGGAAACGGAGG - Intergenic
1181425531 22:22835209-22835231 AGTCCCTGAGGAGAAAGGGGAGG - Intronic
1181429775 22:22872079-22872101 AGTCCCTGAGGAGAAAGGGGAGG - Intronic
1181715669 22:24725828-24725850 GGTCCCAAAGCAGGAACCAGGGG - Intronic
1181968414 22:26672400-26672422 AGACTCAGAGGAGGAAGAGGTGG + Intergenic
1182024715 22:27108991-27109013 GCTCCCAGAGGGGGAAGGCGGGG + Intergenic
1182074986 22:27489338-27489360 GTTGCCATTGGAGGAAGCGGGGG + Intergenic
1182620288 22:31614993-31615015 GGTCCCAGAGGAGGGTCCTGTGG + Intronic
1182888085 22:33793018-33793040 GTGCCCAGAGGAGGAGACGGAGG + Intronic
1182994604 22:34800927-34800949 CTTCCCAGAGGAGGAAACTGAGG + Intergenic
1183205093 22:36413412-36413434 GGCCCCAGAGGAGGAAGAACAGG - Intergenic
1183486965 22:38093437-38093459 GGTCCCTCAGGAGGGAGCTGTGG - Intronic
1183545275 22:38452136-38452158 GGGCCCAGAGGAGGGAGCCCTGG - Intronic
1184037840 22:41926827-41926849 GGCCCTCGGGGAGGAAGCGGGGG + Intergenic
1184298908 22:43543513-43543535 GTTCCCAGTGGAGGAAGGAGGGG - Intronic
1184529923 22:45048863-45048885 GCTCCCAGAGGAGGGAGGCGTGG + Intergenic
1184654450 22:45934120-45934142 GTTTACAGAGGAGGAAGCAGAGG + Intronic
1185220773 22:49628099-49628121 GGTCCCAGAGCCGGGAGCCGCGG - Intronic
1185366802 22:50440569-50440591 GGTCTCACAGGAGGACGCAGAGG - Intronic
1185409602 22:50674820-50674842 GGTCCCGGCGGAGGCGGCGGGGG - Intergenic
950066845 3:10118838-10118860 GGTGGCAGAGGTGGAAGGGGAGG - Intronic
950584525 3:13882805-13882827 GGTGGAAGAGGAGGAAGAGGAGG - Intergenic
950628761 3:14267462-14267484 CTTCCCAGAGGAGGAAACTGGGG + Intergenic
952241208 3:31532906-31532928 GGACCCGGAGGAGGAGGAGGAGG - Exonic
952549172 3:34456823-34456845 GGTCCCAGTGGGGGCAGCAGTGG + Intergenic
952646049 3:35660361-35660383 GGGCCCAGAGGCAGAAGCTGAGG - Intronic
953705210 3:45225820-45225842 GGGCCCGGAGGAGGCGGCGGCGG - Exonic
953910917 3:46892688-46892710 GGACCCAGAGGAGGCAGGGGAGG - Intronic
954314917 3:49795818-49795840 GGGCCCAGGGAAGGAAGCTGTGG - Intronic
954581358 3:51704483-51704505 GGTCACAGAGCAGGACGTGGAGG - Intergenic
954884757 3:53862933-53862955 GGTGGCAGAGGCAGAAGCGGTGG - Intronic
955461567 3:59189394-59189416 TGTTCCAGGGGAGGCAGCGGGGG + Intergenic
955636973 3:61040972-61040994 TGTCCTAGGGGAGGAAGGGGAGG - Intronic
955957527 3:64305655-64305677 GGTCCCACAGTAGGAACAGGGGG - Intronic
956789855 3:72672177-72672199 AGTCCCAGAGGACAAAGAGGAGG + Intergenic
958814444 3:98901093-98901115 GGTCCCAGGGGAGTGAGCGGCGG - Intronic
958959411 3:100494835-100494857 TGTTACAGAGGAGGAAGCTGAGG - Intronic
960967748 3:123116788-123116810 GGAACCAGAGGAGGAGGAGGTGG + Intronic
961052231 3:123756615-123756637 GGACCCAGAGGAGAATGCAGGGG - Intronic
961089073 3:124094095-124094117 GTTTACAGAGGAGGAAGCTGAGG + Intronic
961641354 3:128366523-128366545 GGGCACAGAGGAGGAGGAGGAGG + Intronic
963207626 3:142652568-142652590 GGGCACAGAGTAGGAGGCGGGGG + Intronic
963645019 3:147903257-147903279 GGTCCAGCAGGAGGAAGCAGTGG - Intergenic
964721878 3:159775480-159775502 GATCTCAGAGGAGGAAGCAAGGG - Intronic
965020362 3:163221046-163221068 GGTGGCAGAGGAGGAAGAGATGG + Intergenic
966802336 3:183775950-183775972 GGTGCCGGAGGAGGAGGAGGAGG + Exonic
966807851 3:183820313-183820335 GGTCCCAGAGCTGGAAGGTGGGG + Intronic
966909738 3:184552439-184552461 AGCCCAGGAGGAGGAAGCGGTGG + Intronic
966912831 3:184568991-184569013 GCTCCGGGAGGAGGGAGCGGAGG - Intronic
967197717 3:187043120-187043142 GGTCCCGGAGGTGGCAGCGCAGG - Exonic
967256693 3:187600435-187600457 GGTCCGAGGGGAGGGATCGGAGG - Intergenic
968434210 4:576447-576469 GCTCCGGGAGGAGGAAGCGGAGG - Intergenic
968479489 4:826964-826986 GGGGCCAGGGGAGGGAGCGGTGG - Intergenic
968509031 4:987330-987352 GGCCCCAGAGGAGGGAGCTCCGG - Intronic
968593036 4:1469155-1469177 GCTCCCAGAGGTGGAGGCTGTGG + Intergenic
968840923 4:3005239-3005261 TGTCACAGCGGAGGAAACGGAGG + Intronic
968909676 4:3471298-3471320 GGTCACAGATGAGGAAACTGAGG + Intronic
969276307 4:6138009-6138031 GCTCCCAGAGGTGGCAGAGGTGG + Intronic
969388342 4:6871946-6871968 AGTCACAGAGGAGGAAACAGCGG + Intronic
970194968 4:13543985-13544007 AGACCTAGAGGAGGAAGCCGCGG - Exonic
970350423 4:15196437-15196459 GGAACCAGAGGAGGAACCAGAGG - Intergenic
975108888 4:70601208-70601230 GGTCCCAAAGGAGGTAGGGGAGG + Intronic
977810083 4:101347577-101347599 GGGCCGGGAGGAGGAAGGGGAGG - Intronic
978541790 4:109824000-109824022 GGCTTCAGAGGAGGAAGAGGTGG + Exonic
979565859 4:122153004-122153026 AATCCCAGAGAAGAAAGCGGGGG - Intronic
983020995 4:162675392-162675414 GCTCCCTGAGGAAGAAGCTGTGG - Intergenic
983279123 4:165658467-165658489 GGTGGCAGAGGAGGAAGAGGTGG + Intergenic
983933783 4:173481591-173481613 GGTGGCAGAGGCGGAAGAGGTGG - Intergenic
985006901 4:185543181-185543203 GGTCCCAGCGGCGGAACAGGTGG - Intergenic
985129116 4:186723942-186723964 GGTCCCAGAGCCGGCAGCCGGGG - Intronic
985184810 4:187304405-187304427 CCACCCAGAGGAGGAGGCGGAGG - Intergenic
985295395 4:188432154-188432176 GGGGCCACAGGAGGAAGCGGAGG + Intergenic
985574793 5:669111-669133 GGTCCCAGGGAGGGGAGCGGAGG + Intronic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
985761471 5:1751416-1751438 GGTCCCTGTGGAGGAAGGAGAGG - Intergenic
985761484 5:1751453-1751475 GGTCCCTGTGGAGGAAGGAGAGG - Intergenic
985837961 5:2284128-2284150 GGACTCAGGGGAGGCAGCGGTGG + Intergenic
986720037 5:10554381-10554403 GGTGCAAGAGGAAGAAGCAGTGG + Intergenic
987100604 5:14588311-14588333 GCTCACAGGGGAGGAAGCTGAGG + Intronic
988562562 5:32294101-32294123 GGTCCCAGAGGATGCAGTAGGGG - Intronic
988683226 5:33503226-33503248 GACCCCAGAGGAGGAAGGGAAGG - Intergenic
992719365 5:79545054-79545076 TGTTACAGAGGAGGAAACGGAGG + Intergenic
992806251 5:80340746-80340768 GGTCTCTGAGGAGGCAGTGGGGG - Intergenic
995069158 5:107898342-107898364 GGTGGCAGAGGAGGAAGAGGTGG - Intronic
996811848 5:127524608-127524630 GGCCTCACAGGAGGAAGGGGCGG - Exonic
997490127 5:134268411-134268433 GGTGACAGAGCAGGAAGTGGGGG + Intergenic
998193097 5:140043284-140043306 GGACCTGGAGGAGGATGCGGAGG + Exonic
998194756 5:140058732-140058754 GGTGGCAGAGGTGGAAGAGGTGG - Intergenic
999244285 5:150145067-150145089 GGTGGCAGAGGCGGAAGAGGTGG - Intronic
1001446618 5:171790203-171790225 GGTGCAAGAAGAGGAAGAGGAGG - Intronic
1001805161 5:174578091-174578113 AGTCCCAGAGGAGGCTGAGGTGG + Intergenic
1002084873 5:176768192-176768214 TGTCACAGAGGAGGAAGCTGGGG + Intergenic
1002202502 5:177537994-177538016 GTTCCCAGGGCAGGAAGAGGAGG + Exonic
1002294306 5:178221674-178221696 AGGCCCAGAGGAGGAAGGGCAGG - Intronic
1002621966 5:180494432-180494454 GGGCGCGGAGGAGGAGGCGGCGG + Exonic
1002666776 5:180831189-180831211 GGTCCCCGAGGCGGCGGCGGCGG - Intergenic
1002690140 5:181044775-181044797 GGTCATAGATGAGGAAGGGGTGG + Intronic
1004446679 6:15706564-15706586 GGTAGCAGAGGTGGAAGAGGTGG - Intergenic
1005083538 6:21981019-21981041 GGTTCCAGAGCAGGAAGGGAAGG - Intergenic
1005083697 6:21981906-21981928 GGTTCCAGAGCAGGAAGAGGAGG - Intergenic
1005135967 6:22570070-22570092 CGACCAAGAGGAGGAGGCGGAGG + Exonic
1006414150 6:33893372-33893394 GGTCCCAGAGGGAGAGGAGGTGG + Intergenic
1006503903 6:34475838-34475860 TTTCCTAGAGGAGGAAGCTGAGG + Intronic
1006719778 6:36142739-36142761 GACACCAGAGGATGAAGCGGGGG - Intronic
1006748431 6:36361461-36361483 GGGACCAGAGGAGGAAGCCAAGG + Intronic
1007173275 6:39879304-39879326 GGTCCCCCGGGAGGAAGGGGTGG - Exonic
1007339239 6:41179788-41179810 GGTGCCAGAGGAGGATGGAGAGG - Intergenic
1007620026 6:43206311-43206333 TGTCCCTCAGGAGGAAGAGGAGG + Exonic
1008171616 6:48214435-48214457 GGTGGAAGAGGAGGAAGTGGAGG - Intergenic
1009542032 6:64972434-64972456 AGTCGCAGAGGTGGAAGAGGTGG - Intronic
1009683242 6:66925150-66925172 GATTCCAGAGGAGGAATCTGAGG - Intergenic
1014061523 6:117077462-117077484 GGTGGCAGAGGCGGAAGAGGTGG - Intergenic
1014127613 6:117794830-117794852 GGTTCCAGAGTAGAAAGCAGTGG + Intergenic
1014990171 6:128065485-128065507 AGTCCTAGAGGAGGAAGAGTGGG - Intronic
1015218520 6:130777852-130777874 GGTGGCAGAGGTGGAAGAGGTGG + Intergenic
1016614377 6:146029327-146029349 GGACCCAGAGGAGGAGACGAAGG + Exonic
1016737334 6:147493666-147493688 AGACTCAGAGGAGGAAGAGGAGG - Intergenic
1018065473 6:160122531-160122553 GGTCTTTGAGGAGGAAGCTGAGG + Intronic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1019053342 6:169201377-169201399 GGTCTCACATGAGGAAGCTGGGG - Intergenic
1019314189 7:377016-377038 AGTCACAGAGGAGGAAACTGAGG - Intergenic
1019562622 7:1666038-1666060 GAGCCCGGAGGAGGAAGAGGAGG + Intergenic
1019665961 7:2252491-2252513 GGTGGCAGAGGAGGAAGGGGAGG + Exonic
1019856250 7:3611362-3611384 GGTGCAAGAGGAGGAAGAGCAGG - Intronic
1020013387 7:4818135-4818157 GGCCCCACAGGAGGGAGAGGAGG - Intronic
1020100808 7:5393490-5393512 GGCCCCGCAGGAGGAAGTGGAGG + Intronic
1020446931 7:8278544-8278566 GGTAACAGAGGAGGAAGAGGAGG - Intergenic
1021564236 7:22001033-22001055 TGTCCCAGATGAGGAACCTGGGG + Intergenic
1021934450 7:25615908-25615930 GGTGGCCTAGGAGGAAGCGGAGG - Intergenic
1022020858 7:26398508-26398530 GGTGCTGGAGGAGGAAGGGGTGG - Intergenic
1022171680 7:27837642-27837664 GGTCCCAGAGGTGGAGGCACTGG + Intronic
1022321928 7:29295930-29295952 GGTCCCAGAGGAAGGAGAGTTGG + Intronic
1022388846 7:29926414-29926436 GGCCACAGAGGCGGAGGCGGAGG - Intronic
1023034351 7:36117594-36117616 GGTTACAGAGGAGGAAACAGTGG + Intergenic
1023038755 7:36154345-36154367 GGTCCCTGGGGATGGAGCGGTGG - Exonic
1023264889 7:38394133-38394155 GGCCCCAGGAGAGGAAGCAGAGG - Exonic
1023320671 7:38994379-38994401 GGTCCCAGAGGAGGAAGGGAAGG + Intronic
1023375474 7:39551203-39551225 GGCTGAAGAGGAGGAAGCGGGGG - Intergenic
1024512716 7:50216075-50216097 GGTCCTAGAGGAGGGAATGGGGG - Intergenic
1024604236 7:51011537-51011559 GATGCCAGGGGAGGAAGCAGGGG + Intergenic
1025128194 7:56362365-56362387 GGGCCCAGAGAAGGAAGGGTTGG - Intergenic
1026537490 7:71252016-71252038 AGTCCCGGAGGAGGCAGCAGGGG - Intronic
1026796573 7:73369586-73369608 GGACCCAGAGGAGGCAGTGAGGG - Intergenic
1026807233 7:73436002-73436024 GGTCCTAGTGGAGGATGTGGAGG + Exonic
1026941362 7:74289667-74289689 GGCCCGAGAGGAGGAGGCCGGGG + Exonic
1027229002 7:76261441-76261463 GGCCCCACGGGAGGAAGAGGAGG - Intronic
1031568729 7:123331008-123331030 GGTCCCAGTGGTGGCAGTGGTGG - Intergenic
1031688792 7:124764514-124764536 GATCTCAGAGGAGGAAGAGAAGG - Exonic
1032867163 7:135937739-135937761 TGTCTCAGAGGAGGAAGAGGTGG - Intronic
1033085357 7:138336322-138336344 GGTGGCAGAGGAGGAAGAGGTGG - Intergenic
1034129068 7:148699050-148699072 GGGCCGAGAGGAGGTGGCGGCGG + Intronic
1034268686 7:149793039-149793061 GGTCCCAGAGGGGGCTGGGGAGG - Intergenic
1034860206 7:154588211-154588233 TGTCCCAGAGGAGGGAGGGAGGG + Intronic
1035205136 7:157290048-157290070 GGCCCCAGATGAGGCAGCGTCGG - Intergenic
1035747691 8:1973943-1973965 GGACCCCGGGGAGGCAGCGGCGG + Intronic
1036633593 8:10532213-10532235 GCAACCAGAGGGGGAAGCGGTGG + Intronic
1036645016 8:10607485-10607507 GGCCCCAGAGGCAGAAGGGGAGG - Exonic
1036645029 8:10607533-10607555 GGCCCCAGAGGCAGAAGGGGAGG - Exonic
1036645065 8:10607677-10607699 GGCCCCAGAGGCTGAAGGGGAGG - Exonic
1036645090 8:10607770-10607792 GGCCCCAGAGGCAGAAGGGGAGG - Exonic
1037013405 8:13873397-13873419 GGTGGCAGAGGTGGAAGAGGTGG + Intergenic
1037785722 8:21902003-21902025 GTTCTGAGAGGAGGAAGCTGGGG - Intergenic
1037885335 8:22593201-22593223 GGTCCCAGCAGTGGCAGCGGTGG + Intronic
1037885705 8:22595069-22595091 AGTCCCAGAGGATGCTGCGGAGG + Intronic
1038554097 8:28494476-28494498 GATCCCTGAGGAGGAGGCGCCGG - Intronic
1039926925 8:41942852-41942874 GGTCTCAGAGGAGGAAGAAGAGG - Exonic
1040532777 8:48279123-48279145 GGTCACAGAGAAGGAAGCATTGG + Intergenic
1042307014 8:67343288-67343310 GGACGCAGAGAAGGAGGCGGCGG + Exonic
1042307162 8:67343805-67343827 GGCTGCAGACGAGGAAGCGGCGG + Intergenic
1042829270 8:73009042-73009064 GGCCCCCGAGGAGGAGGAGGAGG + Exonic
1043502885 8:80874094-80874116 GGAGGCAGAGGAGGAAGAGGAGG - Intronic
1045662789 8:104455376-104455398 GGTCCCAGAGGAGGAAAACAGGG + Intronic
1045981777 8:108198026-108198048 GGTAGCAGAGGAGGAAGTGGAGG - Intergenic
1046842483 8:118875242-118875264 GGCGGCAGAGGAGGAAGAGGTGG - Intergenic
1048231979 8:132651379-132651401 GGTGACAGAGGAGGAAGATGGGG - Intronic
1048976720 8:139677278-139677300 GGTCACAGATGAGGAAACTGAGG + Intronic
1048988308 8:139747340-139747362 TTTCCTAGAGGAGGAAGCTGAGG + Intronic
1050287460 9:4118117-4118139 GGCGGCAGAGGAGGGAGCGGAGG + Exonic
1052605135 9:30689426-30689448 GGTCTTAGAGGTGGAAGAGGAGG + Intergenic
1052605137 9:30689435-30689457 GGTGGAAGAGGAGGAAGTGGAGG + Intergenic
1053184950 9:36008188-36008210 GGTGGCAAAGGAGGAAGAGGTGG - Intergenic
1053199676 9:36143896-36143918 GGCCCCAGAGGGGAAAGCTGGGG - Intronic
1055332471 9:75198562-75198584 GGTGGCAGAGGCGGCAGCGGAGG - Intergenic
1056143621 9:83707940-83707962 GGGCAGGGAGGAGGAAGCGGTGG - Exonic
1056185374 9:84129456-84129478 GGTCAAAGAGGAGGAGGCAGAGG + Intergenic
1056305615 9:85288023-85288045 AGTCCCAGAGAAGAAAGAGGAGG + Intergenic
1058946014 9:109857063-109857085 AGTCTCAGGGCAGGAAGCGGGGG - Intronic
1059495425 9:114705210-114705232 GGTCCCAGAGCAGGCAGAGCTGG - Intergenic
1059705929 9:116823233-116823255 CTTTGCAGAGGAGGAAGCGGAGG + Intronic
1060551668 9:124488377-124488399 GGTGCCAGAGGAGGAACAGGAGG - Intronic
1060700613 9:125746963-125746985 GGCCCCGGGGGAGGCAGCGGCGG - Intergenic
1061139065 9:128753360-128753382 GGCCCAAGTTGAGGAAGCGGAGG + Exonic
1061296956 9:129682018-129682040 GGTCCCTGAGGAGGAGGCGTGGG + Intronic
1061974166 9:134060007-134060029 TCTCCCAGAGGAGGGGGCGGAGG + Intronic
1062202076 9:135308770-135308792 GGTCCCTGATGAGGCAGCCGTGG - Intergenic
1062318924 9:135981071-135981093 GGTCCCTGACGAGGAGGCGGCGG + Intergenic
1062451829 9:136618972-136618994 GGTCCCAGGAGAGGAGGCGGAGG + Intergenic
1062488701 9:136793699-136793721 GCCCCAAGAGGAGGAAGAGGTGG + Intronic
1062597677 9:137306451-137306473 GGTCCCAGAGGTGGGAGAGGAGG - Intergenic
1062597916 9:137307414-137307436 GGGCACAGAAGAGGAAGTGGAGG - Intronic
1185614344 X:1411690-1411712 GGCTGCAGAGGAGGAAGCCGTGG - Intronic
1186070232 X:5811499-5811521 TGTCTCAGAGGAGGCAGAGGTGG - Intergenic
1186509782 X:10122061-10122083 GGCCCCGGGGGAGGAAGCTGGGG - Intronic
1187061901 X:15794655-15794677 GGTGGCAGAGGTGGAAGAGGTGG + Intronic
1187281591 X:17861411-17861433 GGTACCCGAGGAGGCGGCGGCGG + Intergenic
1190008044 X:46758892-46758914 CGCCCCAGAGGAGGAGGCCGAGG + Exonic
1190136587 X:47804475-47804497 GGCCCCGGAGGAGGAGGAGGGGG - Intergenic
1190342166 X:49305620-49305642 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190344417 X:49323967-49323989 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190345507 X:49333511-49333533 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190346609 X:49343061-49343083 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190347857 X:49534089-49534111 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190348958 X:49543645-49543667 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190350061 X:49553201-49553223 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190351163 X:49562760-49562782 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190352264 X:49572312-49572334 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190353364 X:49581861-49581883 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190354469 X:49591413-49591435 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190355570 X:49600938-49600960 TGTCACATAGGAGGAAGAGGAGG + Intronic
1190726369 X:53193155-53193177 GGTCCAGGAGGAGGAAGAGCTGG - Exonic
1191184297 X:57592777-57592799 GGCGCCTGAGGAGGAGGCGGAGG + Exonic
1191841733 X:65518134-65518156 TGACCAAGAGGAGGAAGAGGAGG - Exonic
1191892340 X:65956844-65956866 GGTGGAAGAGGAGGAAGTGGAGG - Intergenic
1192561530 X:72131101-72131123 GGTGCCAGAGGGGGTTGCGGGGG + Exonic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1195884897 X:109627425-109627447 GGTTCAAGAGGAGGGAGAGGTGG - Intronic
1196865204 X:120065077-120065099 GGGGGCAGAGGAGGAAGCAGGGG + Intergenic
1196877889 X:120171203-120171225 GGGGGCAGAGGAGGAAGCAGGGG - Intergenic
1198462616 X:136877950-136877972 GGTGGAAGAGGAGGAAGTGGAGG - Exonic
1198462618 X:136877959-136877981 GGTCTTAGAGGTGGAAGAGGAGG - Exonic
1199266397 X:145832389-145832411 GTTCCCAGATGAGGGAGCTGAGG - Intergenic
1199708259 X:150449794-150449816 GTTCCCAGTGGAGGAAGCCTGGG - Intronic
1199886593 X:152027060-152027082 GGACCCAGAGGAGGAAGGATGGG - Intergenic
1199887056 X:152030623-152030645 GGACCCAGAGGAGGAAGGATGGG - Intergenic