ID: 1161203601

View in Genome Browser
Species Human (GRCh38)
Location 19:3029097-3029119
Sequence CGCGCACCCCAACCCGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161203601_1161203623 22 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203623 19:3029142-3029164 CAGCGGCCGGGGCGGGAGCGCGG 0: 1
1: 3
2: 9
3: 110
4: 971
1161203601_1161203618 9 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203618 19:3029129-3029151 GGGCGGGCAGGGGCAGCGGCCGG 0: 1
1: 3
2: 21
3: 210
4: 1723
1161203601_1161203615 -2 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203615 19:3029118-3029140 CGGGGCGAGCGGGGCGGGCAGGG 0: 1
1: 1
2: 14
3: 78
4: 723
1161203601_1161203612 -8 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203612 19:3029112-3029134 GGTGCGCGGGGCGAGCGGGGCGG 0: 1
1: 0
2: 11
3: 79
4: 808
1161203601_1161203619 10 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203619 19:3029130-3029152 GGCGGGCAGGGGCAGCGGCCGGG 0: 1
1: 2
2: 14
3: 126
4: 1123
1161203601_1161203621 14 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203621 19:3029134-3029156 GGCAGGGGCAGCGGCCGGGGCGG 0: 1
1: 2
2: 14
3: 262
4: 2024
1161203601_1161203624 27 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203624 19:3029147-3029169 GCCGGGGCGGGAGCGCGGCGAGG 0: 1
1: 4
2: 24
3: 191
4: 1158
1161203601_1161203622 15 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203622 19:3029135-3029157 GCAGGGGCAGCGGCCGGGGCGGG 0: 1
1: 3
2: 134
3: 527
4: 2387
1161203601_1161203626 28 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203626 19:3029148-3029170 CCGGGGCGGGAGCGCGGCGAGGG 0: 1
1: 0
2: 10
3: 60
4: 446
1161203601_1161203616 -1 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203616 19:3029119-3029141 GGGGCGAGCGGGGCGGGCAGGGG 0: 1
1: 2
2: 16
3: 161
4: 1233
1161203601_1161203614 -3 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203614 19:3029117-3029139 GCGGGGCGAGCGGGGCGGGCAGG 0: 1
1: 6
2: 38
3: 279
4: 1729
1161203601_1161203620 11 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203620 19:3029131-3029153 GCGGGCAGGGGCAGCGGCCGGGG 0: 1
1: 2
2: 10
3: 156
4: 1308
1161203601_1161203617 5 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203617 19:3029125-3029147 AGCGGGGCGGGCAGGGGCAGCGG 0: 1
1: 3
2: 10
3: 180
4: 1517
1161203601_1161203613 -7 Left 1161203601 19:3029097-3029119 CCCTCCCCGGGTTGGGGTGCGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1161203613 19:3029113-3029135 GTGCGCGGGGCGAGCGGGGCGGG 0: 1
1: 0
2: 9
3: 106
4: 926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161203601 Original CRISPR CGCGCACCCCAACCCGGGGA GGG (reversed) Exonic
900114030 1:1020948-1020970 GGGGCTCCCCACCCCGGGGAGGG + Intronic
905827112 1:41034228-41034250 CCCCCACCCCAACCCGAGCAGGG - Intronic
920251165 1:204623376-204623398 CACCCAGCCCAACCAGGGGAGGG - Intronic
922718960 1:227890671-227890693 CTCGCACCCCAGCCAGGGGGAGG + Intergenic
924953471 1:248906525-248906547 CTCGCACCCCAACCCGCAGAAGG - Intronic
1075414961 10:122255804-122255826 CCCGCCCCCCAACCCGGAGCAGG - Intergenic
1077495784 11:2885952-2885974 CGCGCACACCCACCGGGGGCGGG + Intergenic
1079030431 11:16982381-16982403 CCCCCACCCCAACCCAGGAAAGG + Intronic
1079906062 11:26248766-26248788 CGCGGTCCCCAACCCTGGGCAGG + Intergenic
1080386326 11:31813079-31813101 AGCCCTCCCCAGCCCGGGGAGGG - Intronic
1080406897 11:31987567-31987589 CGCGCCCGCCACCCCGGGGCTGG - Intronic
1083303702 11:61752391-61752413 CGCGCCCCTCAAGCCTGGGACGG + Intergenic
1083678325 11:64340248-64340270 CGGGCACCCCGACCCGGGCATGG + Exonic
1083854661 11:65386793-65386815 GGCGCACGCCCAGCCGGGGACGG - Intronic
1088764589 11:112962965-112962987 TGCGCTCCCCAACCGGGGGTCGG - Intronic
1089564457 11:119363642-119363664 CTCGGACCTCCACCCGGGGAGGG + Intronic
1092144629 12:6205949-6205971 CGCTGACCCCAACCTGGGGGAGG - Intronic
1101888422 12:108689646-108689668 CCCCCACCCCATCCTGGGGAAGG + Intronic
1101942609 12:109111158-109111180 CGCTCACCGCAGCCAGGGGAGGG - Intergenic
1106250194 13:27977102-27977124 CGCCCCCCCCAACACAGGGAAGG - Intergenic
1108689875 13:52850684-52850706 CTCCCACCCCAACCTGGGGCTGG + Intergenic
1108747326 13:53408984-53409006 CACGCACCCCACCCCGGGAGGGG - Intergenic
1114637517 14:24196067-24196089 CGTGGCCCCCAAACCGGGGAAGG + Intronic
1124211793 15:27770295-27770317 CGCGGACCCCAAGCCGGGAGGGG + Intronic
1132891511 16:2207095-2207117 CCTGCACCCCAACCAGGTGAGGG + Exonic
1141828954 16:86498842-86498864 CGCGCACCCCTCCCCTGGGCTGG + Intergenic
1142028529 16:87827103-87827125 GGTGCACCCCCACCCCGGGAAGG - Intergenic
1142176033 16:88645866-88645888 CCCGCACCACAGCCCTGGGAGGG - Intronic
1142236172 16:88923636-88923658 CGCGCAGCACAGCTCGGGGAGGG + Intronic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1146160858 17:30558945-30558967 CACGCAGCCAGACCCGGGGATGG + Intronic
1146797994 17:35795946-35795968 CTCGCACCCCGACCCTGGGTGGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148380037 17:47189525-47189547 GGCGTAGCCCAACCCTGGGACGG - Intergenic
1151291887 17:73156385-73156407 CGCTCACCCCACCCCGGGGCCGG + Intergenic
1151707691 17:75779378-75779400 CGCGCTCCCCCTCCCGGGGGAGG - Intronic
1158601991 18:58863726-58863748 CGCGAAGGCCAACCCCGGGAAGG + Intronic
1161203601 19:3029097-3029119 CGCGCACCCCAACCCGGGGAGGG - Exonic
1161220665 19:3116654-3116676 CGAACACCAGAACCCGGGGACGG - Intronic
1163551292 19:17967518-17967540 CACGCACCCCCATCCTGGGAGGG + Intronic
1165003958 19:32789052-32789074 CACTCACCCCAACCCGAGGAAGG - Intronic
1167643754 19:50695200-50695222 CGCGCACCCCCTCCCGCGGGAGG + Intronic
930289358 2:49474433-49474455 TGCACACCCCAACCCATGGAGGG - Intergenic
936092423 2:109510116-109510138 TGCACACCCCAACCCGAGGCTGG + Intergenic
939580010 2:143936914-143936936 GGCGCAGCCAAACCCGGGCAGGG + Intergenic
941164797 2:162073717-162073739 CGCACGCCCGAACCCGGGCAGGG - Intronic
947388936 2:229620546-229620568 CGAGCACCCCAAACCGCAGAGGG - Intronic
947651082 2:231786644-231786666 CGCGCTCCCCAAGGCGGGGGCGG - Intronic
948560219 2:238847265-238847287 CGCGCCCAGCAACCCGGGTAGGG + Intergenic
948822644 2:240557770-240557792 CGCGGTCCCCACCCCAGGGAGGG - Intronic
1179791008 21:43755944-43755966 CCCGCAGCCCAGGCCGGGGAAGG + Exonic
1180980554 22:19876271-19876293 CAAACACCCCAACCCTGGGAGGG + Intronic
1182189363 22:28442835-28442857 CCCAAAGCCCAACCCGGGGAAGG - Intronic
959108805 3:102097146-102097168 CCCTCACCCCAGCCCAGGGAAGG - Intergenic
968448054 4:662381-662403 CGCGCACCCCAGCCCTGCGGTGG + Intronic
969112383 4:4852063-4852085 CCCACACCCCACCCCGGGGTGGG + Intergenic
969360942 4:6663591-6663613 CTCTCACCCCAACGTGGGGAGGG - Intergenic
969417181 4:7068339-7068361 CGCGCGCCCCACCCCGGCGCTGG - Intergenic
979468862 4:121072034-121072056 CGCACACCACACCACGGGGAGGG - Exonic
985776447 5:1846551-1846573 CGCCCTCCCCACCCCTGGGAGGG - Intergenic
992204202 5:74414434-74414456 TGCTCCCCCCAACCCAGGGAGGG + Intergenic
992962782 5:81972262-81972284 CCCGCAGCCCAGCCCGGCGAGGG - Exonic
998130457 5:139648922-139648944 CGCGCACCGAACCCCGGGGGAGG - Intronic
1002662886 5:180803184-180803206 CCCCCACCCCAACCCAGGGGAGG + Intronic
1007492846 6:42237369-42237391 CCCTCACCCCTACCCTGGGAAGG - Intronic
1024567895 7:50697820-50697842 CCCCCACCCCACCCCAGGGAGGG + Intronic
1026822346 7:73557817-73557839 CTCGCACCCCGGCCCGGGTAGGG - Exonic
1029457757 7:100679643-100679665 CACCCACCCCAACCCCAGGAAGG + Exonic
1035301596 7:157901183-157901205 CGCTCACCTCCACCCTGGGAGGG + Intronic
1037825324 8:22156907-22156929 CGCGCAGCCCCACACGCGGATGG - Intronic
1042936338 8:74062393-74062415 CCCGCACCCCAACCCCGGACAGG + Intergenic
1061275868 9:129569155-129569177 CGCCCACCCGGAGCCGGGGAGGG - Intergenic
1061958991 9:133978434-133978456 CGGGCTCCCCAATCCTGGGAAGG + Intronic
1062442878 9:136579001-136579023 CGCCCACCCCAGCCTGGGGAGGG + Intergenic
1062696193 9:137877607-137877629 CGCGCCTCCCACCCCGGGGCTGG - Intergenic
1198510782 X:137349487-137349509 CAGGCACCCCAACCCAGAGAAGG - Intergenic