ID: 1161203668

View in Genome Browser
Species Human (GRCh38)
Location 19:3029287-3029309
Sequence CCTTAAGGCGGCTCAGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161203668_1161203674 5 Left 1161203668 19:3029287-3029309 CCGCGGGCTGAGCCGCCTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1161203674 19:3029315-3029337 CCGCCGCCCCCACGCGCCCGCGG 0: 1
1: 1
2: 9
3: 47
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161203668 Original CRISPR CCTTAAGGCGGCTCAGCCCG CGG (reversed) Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
906318730 1:44803979-44804001 CCTGAAGACAGCTCACCCCGTGG + Exonic
907784543 1:57598828-57598850 CCTAAAGGCTGCTGAGCCCCTGG - Intronic
914827410 1:151145859-151145881 CCTTCAGCCCGCTCGGCCCGGGG - Intronic
917433989 1:175000272-175000294 CCGCAGGGCGGCTCAGCCCACGG - Intronic
1062942618 10:1435459-1435481 GCAGAAGGAGGCTCAGCCCGGGG - Intronic
1067793355 10:49303861-49303883 GGGTAAGGCGGCTCAGCCAGGGG - Intronic
1071301217 10:84257375-84257397 CCTGAGGGCAGCTCAGCCTGGGG + Intronic
1074548211 10:114418587-114418609 CCTTAATGCTGCTCATCCCATGG - Intergenic
1075496183 10:122921379-122921401 CCTTAAGGCTGCGCAGCCCCTGG + Intergenic
1085809434 11:79667112-79667134 CCATAAGGAGGCTCAGCTCATGG + Intergenic
1090868603 11:130723579-130723601 CCTTAAGGTGGGTGAGCCCTGGG + Intergenic
1108696688 13:52908007-52908029 CCCAGAGGCGGCTCAGCCAGTGG - Intergenic
1122056368 14:99100915-99100937 CCTGGAGGCGGCTGAGCCCTAGG + Intergenic
1124635077 15:31360159-31360181 CCTTAAGGCAGCTGACCCCAGGG - Intronic
1133103871 16:3494659-3494681 CCATAAGCCGGCCCAGCCAGTGG + Exonic
1133288307 16:4701606-4701628 GGTGGAGGCGGCTCAGCCCGGGG - Intronic
1138621061 16:58211671-58211693 CCTTGAGGGGGCCCAGCCCAGGG + Intergenic
1142251662 16:88994574-88994596 CCTTAGGGCCGCCCAGCTCGGGG - Intergenic
1148634014 17:49133196-49133218 CCTGACGGCGGCTCCTCCCGTGG - Exonic
1152430101 17:80244093-80244115 TCTCAAGGCGGCTCGGCCTGGGG - Intronic
1161203668 19:3029287-3029309 CCTTAAGGCGGCTCAGCCCGCGG - Intronic
1167955839 19:53063123-53063145 CTTTAGGGCGGCTCATCACGAGG + Intergenic
937302376 2:120851263-120851285 CCTTAAGGTGGCCCAGCCCATGG - Intronic
942450615 2:176106206-176106228 CCAGGAGGGGGCTCAGCCCGTGG - Intronic
944760367 2:202808004-202808026 CCTGAAGCCGGCACAGCCCTGGG - Intronic
946279937 2:218659452-218659474 CCTAGAGGCGGCTGAGCCGGAGG - Exonic
1169514186 20:6298295-6298317 GCTTAAGCCTGCACAGCCCGTGG + Intergenic
1170014741 20:11767975-11767997 CTTTATGGTGGCTCAACCCGTGG - Intergenic
1170864002 20:20137205-20137227 CCTTAAGGCAGCACAGCCATGGG + Intronic
1176102952 20:63372790-63372812 CCTAAAGCCGTCTCAGCCCCAGG + Intronic
1176426197 21:6549930-6549952 GATCAAGGCAGCTCAGCCCGAGG - Intergenic
1179701688 21:43158247-43158269 GATCAAGGCAGCTCAGCCCGAGG - Intergenic
1183414534 22:37674976-37674998 CCTGAACGCGGCCAAGCCCGAGG + Intergenic
1184607781 22:45584058-45584080 CCTTAAGGCGGTTGACCCAGAGG - Intronic
1184770824 22:46595557-46595579 CCTCAAGGCAGCTCAGCCCTAGG + Intronic
976482079 4:85556987-85557009 CCATAAGGCAGCTCTGCCGGGGG + Intronic
992228499 5:74641097-74641119 CCTTAGGGGAGCGCAGCCCGGGG + Exonic
1002618838 5:180471969-180471991 CCTTAAGGCCACCCAGCCAGGGG + Intergenic
1002852818 6:1011616-1011638 CCTTAAAGCTGCTCAGTCAGTGG - Intergenic
1003061184 6:2863976-2863998 CCTTAAGAAGCCTCAGCCTGGGG - Intergenic
1006554257 6:34852237-34852259 CCTGAAGCCAGCACAGCCCGGGG + Intronic
1013657142 6:112257561-112257583 CCTTGAGGCTGCTCTGCCTGTGG + Intergenic
1023926931 7:44676071-44676093 CCTTGAGGCCGCTGACCCCGTGG + Exonic
1033757031 7:144403966-144403988 CCTTCAGGCGGCCCCTCCCGTGG + Intronic
1034252117 7:149701103-149701125 CCTTAAGGGAGCTCAGACCTAGG - Intergenic
1045007426 8:97928550-97928572 TCTTAGGGTGGCTCAGCCCCTGG + Intronic
1048439426 8:134449111-134449133 CCTTGAGGCTGCTCTGCCTGTGG - Intergenic
1049709433 8:144056988-144057010 CCTCCAGGCGGCTCAGCCTCTGG + Exonic
1056208162 9:84340072-84340094 GATTAATGCTGCTCAGCCCGAGG - Intronic
1056381893 9:86063317-86063339 CCCTCAGGTGGCTCAGCCCTGGG - Intronic
1062408827 9:136411043-136411065 CCTTCAGGAGGCTGAGCCGGTGG + Intronic
1186742925 X:12537114-12537136 CTATAAGGTGGCTCAGCCTGGGG - Intronic
1190533814 X:51407177-51407199 GCTTAGGGCGGCGCCGCCCGAGG - Exonic
1200873591 Y:8128576-8128598 CCTCCAGGAGGCTCAGGCCGTGG + Intergenic