ID: 1161204436

View in Genome Browser
Species Human (GRCh38)
Location 19:3033721-3033743
Sequence CTGTGCTTAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161204436_1161204443 13 Left 1161204436 19:3033721-3033743 CCCTCTTCCCTCTCTAAGCACAG 0: 1
1: 1
2: 2
3: 34
4: 342
Right 1161204443 19:3033757-3033779 AACTTGTAATCCCAGCACTTTGG 0: 47
1: 4657
2: 96876
3: 318116
4: 240641
1161204436_1161204448 26 Left 1161204436 19:3033721-3033743 CCCTCTTCCCTCTCTAAGCACAG 0: 1
1: 1
2: 2
3: 34
4: 342
Right 1161204448 19:3033770-3033792 AGCACTTTGGGAGGCCAAAGAGG 0: 2987
1: 62797
2: 151671
3: 159067
4: 94862
1161204436_1161204444 14 Left 1161204436 19:3033721-3033743 CCCTCTTCCCTCTCTAAGCACAG 0: 1
1: 1
2: 2
3: 34
4: 342
Right 1161204444 19:3033758-3033780 ACTTGTAATCCCAGCACTTTGGG 0: 3400
1: 85962
2: 310992
3: 242116
4: 148921
1161204436_1161204445 17 Left 1161204436 19:3033721-3033743 CCCTCTTCCCTCTCTAAGCACAG 0: 1
1: 1
2: 2
3: 34
4: 342
Right 1161204445 19:3033761-3033783 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161204436 Original CRISPR CTGTGCTTAGAGAGGGAAGA GGG (reversed) Intronic
900163311 1:1234774-1234796 GTGTGCTTGGAGAGGCCAGAGGG + Exonic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902808417 1:18874900-18874922 GTGAGCTTGGAGAGGGAGGAAGG - Intronic
902893029 1:19458716-19458738 CTGTCCTTAGACATTGAAGAGGG - Intronic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
903916980 1:26771826-26771848 GTGAGCCTAGAGAGGGAAGAAGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905380003 1:37555155-37555177 CTGTGCTTTGGGAGAGATGATGG - Intergenic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
906037999 1:42764934-42764956 CAGTGCTTAGAGAGTAAAGAAGG - Intronic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
909517644 1:76530512-76530534 CTGAGCTGAGAGATGGAAAAGGG + Intronic
912059946 1:105655245-105655267 CTGTGCTTAGAGGGAGCAGCAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915213520 1:154326210-154326232 CTGTCCTTGGTGAGGGAAGGTGG + Intronic
916060189 1:161092983-161093005 TTGTGCTTAGGGAGAGAGGAGGG + Intergenic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918204346 1:182295951-182295973 ATCTGCTGAGAGAGAGAAGAAGG - Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920703803 1:208237162-208237184 CTGTCCATAAAGAGGGTAGAGGG - Intronic
921148548 1:212381914-212381936 CTGTTCTCAGAGAGAGAAGGAGG + Intronic
922895626 1:229097765-229097787 CTGTGCTGAGAGCGGGAGGCTGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924516440 1:244770089-244770111 TTCTGCTTAGCGAGGGATGAAGG - Intergenic
1062813519 10:482839-482861 CTGGGCTTAGAGACTGATGAGGG + Intronic
1063045996 10:2392939-2392961 CTGTGCTTAGATTCTGAAGATGG + Intergenic
1063450781 10:6148555-6148577 CGGTGGTTAGAGTGGGAGGAAGG + Intronic
1063879225 10:10513823-10513845 CTTTGCATAGAGAGGGAACCAGG - Intergenic
1064214940 10:13392339-13392361 TTGTGCTTTGAGTGGGAAGGTGG + Intergenic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1066249302 10:33617439-33617461 CTGTTCTTGAAGAGGGAAGGTGG - Intergenic
1066566566 10:36727611-36727633 GTGTGCTTAGTGGGGAAAGAGGG - Intergenic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069192643 10:65508854-65508876 CTGTGCTTACTAAGGCAAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069545116 10:69322114-69322136 GTTTGTTTAGAAAGGGAAGATGG + Intronic
1069753375 10:70759183-70759205 CTTTGCTTTGGGAAGGAAGACGG - Intronic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1070413861 10:76171097-76171119 CTGTGCCTAGAGAAAGAAGCTGG + Intronic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1070731269 10:78830157-78830179 GAGAGCTTAGAGAGGGCAGAAGG - Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1071849030 10:89549927-89549949 CTCTGCTTAAAGAGGGAGAAAGG - Intronic
1075152736 10:119949076-119949098 TCGTGCTTATTGAGGGAAGAAGG + Intergenic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076506115 10:130973612-130973634 CTGTGCTTGCAGGGTGAAGAGGG + Intergenic
1077427389 11:2489621-2489643 CTCTGCTTAAAGAGAGGAGATGG + Intronic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1081327056 11:41757706-41757728 TTGTCCTTAGAGAGGGAGGCAGG - Intergenic
1083179400 11:60974546-60974568 CTAGGGTTAGAAAGGGAAGAAGG - Intronic
1083303252 11:61749806-61749828 CTGGGCTGAGAGGGGGGAGAGGG - Intergenic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1083904367 11:65660454-65660476 CTGTGTTTAGAGAGTGGAAAAGG - Intronic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1086258032 11:84903247-84903269 CTGTGTTCAGAGAGTAAAGAAGG - Intronic
1088332450 11:108667743-108667765 CTTTCCTTAGAGTGGGCAGATGG - Intronic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1089634016 11:119800869-119800891 CTGTGCATTGTGAGGAAAGAAGG - Intergenic
1090951041 11:131473628-131473650 CTGAGCTAGGAGAGGGAAAATGG + Intronic
1091853139 12:3717099-3717121 CTGGGCTTAGAGAGTGAATAGGG + Intronic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1092998933 12:13977656-13977678 CTGTGCTGTGAGGGGGAAAAAGG + Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1093836387 12:23834722-23834744 CAGTTCTTAAAGAGGTAAGAAGG + Intronic
1096443873 12:51670631-51670653 CTGTGCTTAGAGAGGTGAATGGG + Intronic
1096661772 12:53129821-53129843 GTGGGCTTGGAGAGGGATGATGG - Intergenic
1096749243 12:53748267-53748289 GAGGGCTTGGAGAGGGAAGAGGG - Intergenic
1097271942 12:57780892-57780914 CTGTTCTCAGAGAAGGAGGATGG + Exonic
1097572639 12:61354459-61354481 CAGTTCTTTGAGAGGGAAAATGG + Intergenic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1098922097 12:76312197-76312219 CTGGTCTTAGAGAAGCAAGATGG + Intergenic
1099072414 12:78062461-78062483 CTGTTCTTAGAGAGTAATGATGG + Intronic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103619255 12:122176308-122176330 CTGTTCCTAGAACGGGAAGAGGG + Intronic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1105959978 13:25324093-25324115 CAGTGCTTAGAGAGGTAGCAGGG + Intronic
1107136355 13:36948102-36948124 CTGTGCTTAGAAAGGTAAGCTGG + Intergenic
1108260719 13:48653118-48653140 ATTTGCTTAGACAGGGTAGATGG + Intergenic
1109421052 13:62113181-62113203 CTGTGCTTGAATAGGCAAGAAGG - Intergenic
1110200682 13:72846432-72846454 CTGTGCTAAGAGACTGGAGAGGG - Intronic
1111017969 13:82405741-82405763 TTGTGCTTATAGTAGGAAGAGGG + Intergenic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1112593093 13:100782455-100782477 CTCTGCTTACAAAGGGAAGGAGG + Intergenic
1114256086 14:21002360-21002382 GTGTGCTTGGAGAGGGAGAAAGG + Intergenic
1114491763 14:23106796-23106818 CTGTGCTTTGGGAGAGATGAGGG - Intergenic
1118464895 14:66022184-66022206 CTGTTCTTTGAGAAGAAAGAGGG - Intergenic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1119419848 14:74502044-74502066 GGGTGCTTAGGGAGTGAAGAGGG - Intronic
1121674153 14:95738920-95738942 GTGTCCTGAGAGAGGGACGATGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1125055144 15:35350778-35350800 CTGTGGTTAGAGAAGATAGATGG + Intronic
1125785073 15:42309280-42309302 CAGTGCTTAGCAGGGGAAGATGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127540222 15:59930084-59930106 CTATCCTTACAGTGGGAAGAGGG + Intergenic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1131051807 15:89353355-89353377 CTGCCCTTTGAGAGGGCAGATGG - Intergenic
1131406803 15:92171763-92171785 CTGTGCCTAAAGGGGGAGGAGGG - Intronic
1132585144 16:702896-702918 CTGAGCCAAGAGAGGGAAGGGGG + Intronic
1133361888 16:5180556-5180578 CTTTGAATAGAGTGGGAAGAAGG - Intergenic
1134297580 16:12960814-12960836 CAGGGCTGAGATAGGGAAGAAGG - Intronic
1135634241 16:24060526-24060548 CTGTGCTGAGAGAGGGATCCTGG - Intronic
1136247979 16:28986006-28986028 CTGAGCTGGGAGAGGGGAGATGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137892092 16:52173531-52173553 CTCTGCTTAAAGAAGGAAGGAGG + Intergenic
1139004978 16:62559083-62559105 CTCTGCTTAAGGAGAGAAGAGGG - Intergenic
1140193251 16:72836118-72836140 CCTGGCTTAGAGAGAGAAGACGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1142168951 16:88610342-88610364 GTGAGCTTGCAGAGGGAAGAGGG + Intronic
1143253688 17:5540518-5540540 CTTCGCTAAGAGAGGGAACAGGG + Intronic
1143584317 17:7843831-7843853 CTGGGCTCAGAGAGGCGAGAAGG + Intronic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144741444 17:17584831-17584853 CGGTGCTCAGCGAGGGGAGATGG - Intronic
1144991913 17:19238539-19238561 CTGTGCTTTAAGAGCGGAGAGGG + Intronic
1146186882 17:30729959-30729981 CTGTGCTTAGAGCCAGAAGTGGG + Intergenic
1146626706 17:34440388-34440410 CAGTGCTGAGAGCGGGTAGAGGG - Intergenic
1146885877 17:36470605-36470627 CTGGGCTTATAGAGGGACAAAGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148972790 17:51498967-51498989 CTGTTCTCAGAGTGGAAAGATGG - Intergenic
1149981435 17:61314433-61314455 ATGTTCTTAGAGAGGGAATGCGG - Intronic
1150200663 17:63353718-63353740 GTGTGCTAAGAGAGAAAAGAGGG + Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1153103065 18:1496764-1496786 TTGTTCTGAGAGAGGGTAGAGGG + Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1156104829 18:33647505-33647527 TTGTGATTAGAGAGGGGAAAAGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156409294 18:36812350-36812372 CTGACCTCAGGGAGGGAAGAGGG + Intronic
1157166636 18:45363647-45363669 CCGTGCTTAGAAGTGGAAGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157386680 18:47263863-47263885 CTAGGCTGAGAGAGGGAAGAGGG - Intergenic
1158684519 18:59600938-59600960 CCTTGCTTTCAGAGGGAAGAAGG + Intronic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1159101148 18:63960891-63960913 GTGGGCTGAGAGAGGAAAGAGGG + Exonic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1160671540 19:366976-366998 CTCTGCCTAGAGCGGGCAGAGGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161620286 19:5293719-5293741 CTGGTCTAAGAGGGGGAAGAGGG - Intronic
1161783213 19:6307285-6307307 CTGGTCCTAGAGAGGGGAGAGGG + Exonic
1162972015 19:14186539-14186561 CTGTGCTTAGAGCCAGAAGTGGG - Intronic
1163346710 19:16747721-16747743 CTGCGCTGGGAGAGGGGAGATGG - Intronic
1164070735 19:21765981-21766003 CTGTGCCTAGAGAAGGTAAAAGG + Intronic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1168020711 19:53606839-53606861 CTGTTCTCAGATGGGGAAGAGGG - Intergenic
1168334833 19:55591866-55591888 CTGTGCTGAAAGAGGGACCAGGG - Exonic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
925359633 2:3268303-3268325 CTGTGCCCAGAGAGTGCAGAGGG - Intronic
925531514 2:4868272-4868294 CTATTCTTAGAGAAGAAAGAGGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
931789000 2:65646803-65646825 ATTTGGTTAGAGAGGGAAGTTGG - Intergenic
931845765 2:66202406-66202428 CTGTGCTTTGAGAAAGAAGCAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
934545618 2:95212667-95212689 CTCTGCTTAGACAGAGAAGGTGG - Intronic
935831031 2:107000659-107000681 ATGACCTTAGAGAGGGAGGATGG + Intergenic
936065936 2:109332220-109332242 CTGAACTCAGAGAGGCAAGAAGG - Intronic
936513846 2:113169271-113169293 CTGAGCTTGGAGAGAGAAGGTGG - Intronic
936859543 2:117000973-117000995 GGAGGCTTAGAGAGGGAAGATGG + Intergenic
937415433 2:121710798-121710820 CTAGGCTCAGAGAGGGAAGGGGG + Intergenic
937840045 2:126515640-126515662 CTGACCTTAGAGAGGGGACAAGG - Intergenic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
938605126 2:132884250-132884272 CTGTGCTTAAAAAGGGCAAACGG - Intronic
940963457 2:159811664-159811686 CTGTGATTAGAGAGGAATGGCGG + Intronic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
942455059 2:176131748-176131770 CTGTGCTTTGAGAGGGATTTGGG + Exonic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
947784661 2:232805782-232805804 TTGTGCTTAGAGGAGGAATAGGG + Intronic
947788056 2:232842454-232842476 ATATCCTTAGAGAGGTAAGATGG - Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170978968 20:21193041-21193063 CTGTGCTTTGAGAGACAGGAGGG + Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173777632 20:45724148-45724170 CCTTGCTTGGAGTGGGAAGAGGG + Intronic
1174585100 20:51602284-51602306 CTGTGCTCAGAAAGTGGAGAAGG - Intronic
1175986366 20:62765930-62765952 CGGGGCTCAGAGAGGGATGAAGG + Intergenic
1177013505 21:15756284-15756306 CTGTGCTTTGGAAGGGAAAACGG + Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1179034670 21:37749225-37749247 CTTTGCTCAGAGGGGGCAGAAGG + Intronic
1179559829 21:42208436-42208458 TTGTGCTTAGAGGGAGAAGTAGG + Intronic
1179595490 21:42440243-42440265 CTGCGCTTTGGGAGGGACGAGGG + Intronic
1179785896 21:43729384-43729406 CTGAGCTGAGAGAGGGGAGTTGG + Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182213530 22:28696676-28696698 TTGTGCTTAGAGAGAGAGGAGGG - Intronic
1182488425 22:30653672-30653694 CAGTGCTTAGAGAAGGGAGGCGG - Intronic
1183239022 22:36642043-36642065 CCCTGCTGAGAGAGAGAAGAGGG + Intronic
1183890046 22:40919913-40919935 CTATGCTCAGTGAGGGTAGAAGG - Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184324856 22:43775209-43775231 CTTCACTTAGAAAGGGAAGAGGG + Intronic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950796214 3:15512417-15512439 CTGGGCTGGGAGATGGAAGAGGG + Intronic
950797156 3:15519511-15519533 CTGTGCTTGAAAAGGCAAGAGGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951467237 3:23014502-23014524 CTGTGCTCAGAGAGGTATGAAGG + Intergenic
951570786 3:24060672-24060694 ATGTGATTTGAGAGAGAAGATGG - Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
953082071 3:39630118-39630140 ATGTGCTTCCAGAGAGAAGAGGG - Intergenic
953105135 3:39870241-39870263 CTGCCCTGAAAGAGGGAAGAAGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955359053 3:58257153-58257175 CAGCACTTAGAGAGGCAAGATGG - Intronic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
958687438 3:97417625-97417647 CTGAGCTTGGAGGGGAAAGATGG + Intronic
959062597 3:101629435-101629457 CTGTGCTTAGGGAGGTAAAGAGG + Intergenic
959234271 3:103698316-103698338 CTTTGCAGAGAGAGGGCAGATGG + Intergenic
959575478 3:107928335-107928357 CCGTGCTTTGAGACGGAAGGAGG - Intergenic
961034666 3:123634240-123634262 CCGGGCTTGGAGAGGGAACAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961357323 3:126347324-126347346 CTCTGCCTACAGAGGGAAGGAGG + Intronic
962522351 3:136209074-136209096 CTGAGCTTTGAGAGGGAGCATGG + Intergenic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
965083427 3:164064780-164064802 CTGTGCTAAGGCAGTGAAGAAGG + Intergenic
966132762 3:176662507-176662529 TTGATCTTAGAGAGGGAAGTTGG + Intergenic
966455951 3:180116526-180116548 CTGTGCTCAGAGCTGGAAGTGGG + Intergenic
967603459 3:191415901-191415923 CTGTCCTCAGAGTGGGGAGAGGG - Intergenic
967716720 3:192771153-192771175 CTGTGCTTGGAGTGGCAAGCAGG - Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
975816208 4:78218969-78218991 CTATTCTTATAGAGGGAACATGG + Intronic
976013325 4:80518858-80518880 CTTTGCTTAGAGAGGACATATGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976281146 4:83328239-83328261 CTGCGCCTAGAGAGGGAGTATGG - Intronic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
978339560 4:107707575-107707597 CTTTGCTTAGGGGAGGAAGAGGG - Intronic
979904251 4:126264985-126265007 TTGTGCTTAGAAAAGGAAGGAGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
980646125 4:135644329-135644351 CTCTGCTAAGACAGTGAAGAAGG + Intergenic
982787788 4:159556643-159556665 CTGTTCTTAGAGAAAGGAGAGGG + Intergenic
983268882 4:165538070-165538092 CTGTGCGTAGCAAGAGAAGAGGG - Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
986118841 5:4810613-4810635 ATTTGTTTAGATAGGGAAGAAGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
987190881 5:15477135-15477157 CTCTGCTGAGAGAATGAAGAAGG + Intergenic
987230399 5:15887910-15887932 CTATGCTGAGAGAGAGAACATGG - Intronic
987509955 5:18824723-18824745 ATGTGCTGAGAGAGGGGAGTGGG + Intergenic
989589641 5:43101465-43101487 CTGTGCTGAGAGTGAGGAGAAGG - Intronic
989727984 5:44610303-44610325 ATGTGCTTCAAGAGGGAAGGAGG + Intergenic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991514635 5:67421174-67421196 CTGTGCTGAGAGGGTGAAGGTGG - Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994257865 5:97621626-97621648 CTGTGCTTTGAGAATGAAGTTGG + Intergenic
994775130 5:104030354-104030376 CTGGGCCTATAGAGGGAAAAAGG - Intergenic
995006677 5:107205207-107205229 GTGTCCTGAGAGAGGGGAGAGGG + Intergenic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1000341583 5:160280906-160280928 CTGTGCTTAGTGAAAGCAGATGG - Intronic
1002072719 5:176689873-176689895 GAGTCCTTAGAGATGGAAGAGGG - Intergenic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011237801 6:85236920-85236942 CTGATCTTAAAGAAGGAAGATGG + Intergenic
1011785227 6:90836266-90836288 CTGTGCTTAGCAAGGGGACAGGG + Intergenic
1011959938 6:93075546-93075568 CTGTTCTTAGAGCAGGGAGAGGG + Intergenic
1012048943 6:94314803-94314825 CTGAGCTGAGATAGGGATGACGG + Intergenic
1012954985 6:105560168-105560190 ATGTTCTTAGAGTGGGAAGCTGG + Intergenic
1013291982 6:108727920-108727942 CTGTGCTTAGAGAAGGAGTGTGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1014535098 6:122605457-122605479 AAATCCTTAGAGAGGGAAGAAGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017605242 6:156126546-156126568 CTGTAATTAGAAAGGGAAGCAGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1019065459 6:169292335-169292357 CTGTGCTTGGAGTGGGGACAAGG + Intergenic
1019281890 7:204768-204790 CTGTGCTCAGGGAGGGAATGTGG + Intronic
1022308044 7:29168658-29168680 CTGAGGTTTGAGGGGGAAGAGGG - Intronic
1023168175 7:37363614-37363636 CTGGGCGTAGAAAGGGAAAATGG - Intronic
1024224311 7:47314067-47314089 CTGTGCTCAGAGATGCAAGTCGG + Intronic
1024767617 7:52679109-52679131 CTGTGCTGGGAGATGGAAGGTGG - Intergenic
1024891629 7:54210621-54210643 CTCTGCTTGAAGAGAGAAGAGGG + Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028245927 7:88477195-88477217 CTGAGATGAGAGTGGGAAGAAGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028792241 7:94866186-94866208 TTTAGCTTAGAGAGGGATGAGGG + Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1028925206 7:96350082-96350104 CTGGGCTTAAAGATAGAAGAAGG - Intergenic
1029179199 7:98687788-98687810 CTGGGCTTAGAGAGAGGAGCAGG - Intergenic
1030540952 7:110830167-110830189 GTGTGCTTAGAAAGGAAAAAGGG + Intronic
1033253603 7:139779948-139779970 ATCTGCTTAAAGAGAGAAGATGG - Intronic
1034088125 7:148338910-148338932 CTGTGCTCTGAGAGTGAAGGAGG + Intronic
1036686774 8:10917046-10917068 CTTTGCTAAGACAGGGAAGCAGG - Intronic
1037594362 8:20342587-20342609 CTGTGCTTTGAGAGGTAAAGAGG + Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038454898 8:27666821-27666843 CTGAGCTTGGATAGGGAGGAGGG - Intronic
1039625787 8:39050967-39050989 CTGTGCTCTGAGAGAGGAGAGGG + Intronic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1040719359 8:50298421-50298443 CTCTGCTTACAAAGGGAATAAGG - Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1043601185 8:81940391-81940413 CTGTGGTTAGAGAAAGAATAAGG + Intergenic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1045643993 8:104282482-104282504 CTGTGCTTTGAGAGAGATGGTGG - Intergenic
1045823349 8:106367971-106367993 CTGAGCTTAGAGAGGTAGCAGGG + Intronic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1048235803 8:132689091-132689113 ATGTGATTAGAGAGGAAAGATGG + Intronic
1049444643 8:142624407-142624429 CTGTCCTTAGGGAGGGCCGAGGG - Intergenic
1049569860 8:143364334-143364356 GTGTGCTTAGGGAGGGAGGGAGG - Intergenic
1051223840 9:14878218-14878240 ATGAGCTGAGAGAGAGAAGAGGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051782725 9:20707927-20707949 CTGATCTTAGAGAGGGTACATGG + Intronic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1056055952 9:82824294-82824316 CTGGGATTATAGGGGGAAGAAGG + Intergenic
1056334431 9:85552563-85552585 CTGTGCTCAGAGAGAGGAAATGG - Intronic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1058136746 9:101316124-101316146 CTGTGCTTTAACTGGGAAGAGGG - Intronic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1059930690 9:119257721-119257743 TTGAGCTGAGAGAGGAAAGAAGG + Intronic
1062730437 9:138105422-138105444 CTGTGCTTTCAGAGGGATCAAGG + Intronic
1186415837 X:9382422-9382444 CTGGGCTATGAGAGGGAAGTGGG - Intergenic
1187553898 X:20332862-20332884 GGGTACTTAGAAAGGGAAGAGGG + Intergenic
1188875016 X:35418770-35418792 CTGTGCTTAGAGAAGGTAACTGG + Intergenic
1189498442 X:41530640-41530662 CTGTACCCAGAGAGGGAAGGTGG + Intronic
1190477039 X:50838887-50838909 CTGTACATAGAGAGGAAATATGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193330327 X:80229181-80229203 CTGGGCCTAGAGAGGGAGAAAGG - Intergenic
1195716274 X:107821378-107821400 TGATGCTTGGAGAGGGAAGATGG + Intergenic
1195721436 X:107872661-107872683 CTGGGCTTATAGAGGGAGAAAGG + Intronic
1195850103 X:109273632-109273654 CTGTGATGAGAGATGGATGAGGG + Intergenic
1195934750 X:110114270-110114292 GTGGGCTTACAGAGGGGAGAGGG - Intronic
1195973248 X:110497051-110497073 ATGTGCTTTGAAAAGGAAGAAGG + Intergenic
1196366322 X:114928253-114928275 CTATGCTTTGGGAGAGAAGATGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198671175 X:139082660-139082682 GAGAGCTTTGAGAGGGAAGATGG + Intronic
1198821295 X:140651036-140651058 ATGTGCTTGGACAGGGAGGATGG - Intergenic
1199334441 X:146601427-146601449 CACTGCTGAGAGATGGAAGAGGG + Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1199783695 X:151084865-151084887 CTTGGCTCAGAGGGGGAAGAGGG + Intergenic
1201699776 Y:16867843-16867865 CTCTGCTTCGAAAGGGAAGAAGG + Intergenic