ID: 1161205726

View in Genome Browser
Species Human (GRCh38)
Location 19:3040268-3040290
Sequence CCTGGAAGGCACAGCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 12, 3: 30, 4: 387}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161205716_1161205726 0 Left 1161205716 19:3040245-3040267 CCAAACTCGCCCAGCCTGGTCCC 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205714_1161205726 2 Left 1161205714 19:3040243-3040265 CCCCAAACTCGCCCAGCCTGGTC 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205708_1161205726 28 Left 1161205708 19:3040217-3040239 CCTTCCCTGGAGAGCTCATTGCT 0: 1
1: 0
2: 3
3: 30
4: 233
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205712_1161205726 23 Left 1161205712 19:3040222-3040244 CCTGGAGAGCTCATTGCTGGGCC 0: 1
1: 0
2: 3
3: 13
4: 189
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205720_1161205726 -10 Left 1161205720 19:3040255-3040277 CCAGCCTGGTCCCCCTGGAAGGC 0: 1
1: 0
2: 3
3: 40
4: 299
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205711_1161205726 24 Left 1161205711 19:3040221-3040243 CCCTGGAGAGCTCATTGCTGGGC 0: 1
1: 0
2: 2
3: 26
4: 184
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205715_1161205726 1 Left 1161205715 19:3040244-3040266 CCCAAACTCGCCCAGCCTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387
1161205718_1161205726 -9 Left 1161205718 19:3040254-3040276 CCCAGCCTGGTCCCCCTGGAAGG 0: 1
1: 1
2: 0
3: 29
4: 282
Right 1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG 0: 1
1: 0
2: 12
3: 30
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161205726 Original CRISPR CCTGGAAGGCACAGCACAGA TGG Intronic
900605663 1:3522535-3522557 CCTGGGAGGCAAATCCCAGAAGG + Intronic
901092566 1:6651863-6651885 CCTGGGAGGCAAGGAACAGAGGG - Intronic
901414131 1:9105338-9105360 AGAGGAAGGCACAGCACAGTGGG + Intronic
902381431 1:16054351-16054373 CCTGGCAAGCACACCACAGCTGG + Intronic
902630442 1:17701504-17701526 CATGCAAGCCACAGCTCAGAGGG + Intergenic
903035460 1:20489997-20490019 CCAGCAGGGCCCAGCACAGAAGG + Intergenic
903415531 1:23179986-23180008 CCTGGCAGTCAAAGCAAAGAGGG + Intergenic
904028990 1:27522300-27522322 CCAGGAAGGCACAGTACTGGTGG + Intergenic
904624474 1:31794235-31794257 CCTGGGAGGCAGAAGACAGAGGG + Exonic
904790890 1:33020039-33020061 TCTGGAAGGCACAAAGCAGATGG + Intronic
905643662 1:39609732-39609754 CCTGGAGGGCTCAGAGCAGAAGG + Intergenic
905932746 1:41801162-41801184 CCTTCCAGGCTCAGCACAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907316987 1:53578620-53578642 CCTGGTAGCCAAAGCAAAGAGGG - Intronic
907574231 1:55511484-55511506 CTTGGAACACAGAGCACAGATGG + Intergenic
912314664 1:108656963-108656985 CCTGGAACACAAAGCACAGGTGG - Intronic
912506794 1:110162079-110162101 CCCTGAAAGCACAGCGCAGAGGG - Intronic
912799896 1:112714284-112714306 CCGGGAACGCAGAGCACCGAGGG - Intronic
913521896 1:119652514-119652536 TCTGGCAGGAACAGCACAGCAGG - Intergenic
913970694 1:143413512-143413534 CATGGAAGGCACAGCACATAAGG - Intergenic
914065071 1:144239123-144239145 CATGGAAGGCACAGCACATAAGG - Intergenic
914114080 1:144727231-144727253 CATGGAAGGCACAGCACATAAGG + Intergenic
917275128 1:173323120-173323142 CCTGGGAGGCACCCCACAGGAGG + Intergenic
918611998 1:186503548-186503570 CATGGAAGGCACAAGAGAGAAGG + Intergenic
919438732 1:197599219-197599241 CCAGGAAGGCAGAGCATAAAAGG + Intronic
920916642 1:210262923-210262945 CCGGGAGGGCAGAGCAGAGAGGG - Intergenic
921180796 1:212629865-212629887 CCTGAAAGACAGAGCACACATGG + Intergenic
922714359 1:227859194-227859216 CCTGGAATCCACAGAAGAGAAGG - Intergenic
923011574 1:230092294-230092316 CCTGGAAAGATCACCACAGATGG + Intronic
924143317 1:241048458-241048480 GCTGGAAGGCCCAGCACTCATGG - Intronic
924582255 1:245332633-245332655 CCTGGAAGCCACAGCCCTGCTGG + Intronic
924942809 1:248824289-248824311 CCTGGAAGGTACCGCTGAGAAGG + Intronic
1062867808 10:871618-871640 TCAGGAAGGCACAGCGCAGAGGG - Intronic
1063097671 10:2922559-2922581 CCTGGAACTCAGACCACAGAGGG - Intergenic
1063362587 10:5470039-5470061 CCAGGACGGCTCAGGACAGAGGG + Intergenic
1063914494 10:10867756-10867778 CCTGGATAGCCGAGCACAGATGG + Intergenic
1064831991 10:19479354-19479376 CGTGGAAGGAACAGCACCTAAGG + Intronic
1064932383 10:20641762-20641784 ACTGGAAGCCACAGCACTGATGG + Intergenic
1065399857 10:25286917-25286939 TCTCTAAGGCACAGCACAAAGGG - Intronic
1066546024 10:36501602-36501624 CATTGAAGGCACAGCAAGGATGG - Intergenic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067393227 10:45885143-45885165 CCTGGAGGGCCCCGCTCAGAAGG + Intergenic
1067861549 10:49854271-49854293 CCTGGAGGGCCCCGCTCAGAAGG + Intronic
1069623286 10:69850996-69851018 TCTGGATGGCACAGCACAGCAGG + Intronic
1070217823 10:74405092-74405114 AATGGAAGGCACAGCAAAGGAGG - Intronic
1070322990 10:75368509-75368531 CCTGGAGGCCAAAGCAAAGAAGG + Intergenic
1070901170 10:80030264-80030286 CCTTGAGGGGACTGCACAGAGGG - Intergenic
1071334368 10:84589209-84589231 CCTGGGAGGCCCTGCACAGATGG + Intergenic
1072543954 10:96419891-96419913 CCTAGCAGTCACAGCAAAGAGGG - Intronic
1075293569 10:121252494-121252516 CATGGAAGGCAGAGAACAGAAGG - Intergenic
1075722512 10:124595560-124595582 CCTGGCAGCCAAAGCAAAGAGGG - Intronic
1075881078 10:125851361-125851383 CATGGAATGAGCAGCACAGAGGG + Intronic
1076070593 10:127485256-127485278 CCAGGGAAGCAGAGCACAGAGGG - Intergenic
1077318356 11:1929112-1929134 CCTGGAAGACACCGCAGAGGAGG + Exonic
1077890036 11:6411938-6411960 ACTGGAAGGCAGGTCACAGAGGG + Intronic
1078111142 11:8393654-8393676 CCTGAAAGTCACAGCACACTTGG + Intronic
1078160857 11:8838588-8838610 TTGGGTAGGCACAGCACAGAGGG + Intronic
1079025002 11:16940117-16940139 CCTGGAAGTTACAGCCCAGTAGG - Intronic
1079480656 11:20876403-20876425 CATGGAACACACAGCACACAGGG - Intronic
1079851549 11:25541977-25541999 TCTCGATGGCACAGCAGAGATGG + Intergenic
1080543433 11:33292519-33292541 CCTTGAGAGCACAGCAGAGAAGG + Intronic
1080931082 11:36811777-36811799 TCTGGAAGGCACAACAAAGAAGG + Intergenic
1081806943 11:45896038-45896060 CCTGGAGGGCACTGCACAGAGGG - Intronic
1083544355 11:63537880-63537902 CCTGGAGCTCACAGCCCAGAGGG + Intronic
1084207771 11:67606012-67606034 CTGGGAAGGCAAAGGACAGAGGG + Intronic
1084784273 11:71433109-71433131 CCTGTAAAGCACAGTTCAGATGG + Intronic
1084801904 11:71549477-71549499 CCTGGCAGGCAAAGGAAAGAAGG - Exonic
1085304429 11:75477111-75477133 CCTGGGAAGCCCAGCACTGAAGG + Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1085866298 11:80298282-80298304 CTTGGAAGGCACAATAAAGATGG - Intergenic
1086024145 11:82269883-82269905 CCTGGAAGAGACAGGATAGACGG - Intergenic
1088548163 11:110982417-110982439 CCTGGAATGCAGGGCAGAGAGGG + Intergenic
1088780640 11:113131028-113131050 CCTAAAAGTCACAGGACAGACGG + Intronic
1091050641 11:132367096-132367118 CCTGCTAGGCACAGCACCCAGGG + Intergenic
1091219785 11:133923399-133923421 GCTGGCAGGGACAGCAGAGATGG + Intronic
1091798893 12:3312394-3312416 CCAGGCAGGCACAGCGCACAAGG - Intergenic
1094399251 12:30043760-30043782 CCTGTATGGCACCTCACAGACGG + Intergenic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1095416583 12:41983611-41983633 CCTGGCAGGCAAATCACAGATGG - Intergenic
1096252261 12:50040779-50040801 CCTGGATGGCAGAGGACAGCGGG + Intergenic
1096396250 12:51269156-51269178 CCTGGAAGCCTCAGCCCAGGTGG - Intronic
1097233628 12:57526196-57526218 CCCAGCAGGGACAGCACAGAAGG - Exonic
1098996733 12:77129127-77129149 CCTAGAAGGCAGAAGACAGAAGG - Intergenic
1100780681 12:98022972-98022994 CCTGGAAGACACAGGAAGGAGGG - Intergenic
1102209954 12:111119258-111119280 CCTGTAAGGGACACCATAGATGG - Intronic
1103745252 12:123118498-123118520 CCTGGTAGGCAAAGCAAAGAGGG + Intronic
1104534465 12:129605944-129605966 CCTGGAGGCCACAGTACAGCAGG - Intronic
1105423310 13:20272225-20272247 CCTGGAAGGCCCCTCAAAGAGGG + Intergenic
1105602753 13:21901820-21901842 TCTGAAAGGCACAGCCAAGAGGG - Intergenic
1105810752 13:23993068-23993090 CCTGGAAGCATCAGCAGAGATGG + Intronic
1106146291 13:27052751-27052773 GCTGGAACACACAGGACAGATGG + Intergenic
1106404316 13:29460546-29460568 CATGGATGGCACAGCAGAAATGG - Intronic
1108493602 13:51004131-51004153 CCGGGAAGGGATAGCACAGGTGG - Intergenic
1109646699 13:65267754-65267776 ACTGGAAGGCACAGCGGGGAGGG - Intergenic
1111269796 13:85866373-85866395 CCTGGAAGGAACAGCAGAGCAGG - Intergenic
1111716251 13:91883165-91883187 TCTGGAAGGCAAGGCTCAGATGG + Intronic
1112387293 13:98951750-98951772 CCATGAAGCCAAAGCACAGATGG + Intronic
1112392273 13:98996473-98996495 CCTGTAAGGCACAGTCCAGTTGG - Intronic
1113201296 13:107868674-107868696 CTTGGAAAGCACCGCAGAGAGGG - Intergenic
1113226235 13:108162855-108162877 CCTGGAAGGCACAGAAGCAACGG - Intergenic
1113299441 13:109001369-109001391 CTTGGTAGCCACAGCAGAGAAGG - Intronic
1113817595 13:113185003-113185025 AGTGGAAGGCACTGGACAGAAGG + Intronic
1114627636 14:24139668-24139690 CCTGGGAGGCCCAGCTCAAATGG - Intronic
1114674010 14:24429359-24429381 GCTGGATGGGACAGCACTGAGGG + Exonic
1114699208 14:24660142-24660164 TCTGAAAGCCATAGCACAGAGGG - Intergenic
1115853288 14:37604073-37604095 TCTAGAAGGCAAAGCACAGGAGG - Intronic
1118170292 14:63382157-63382179 CCTGGAAAGCACAGAAAAAAAGG + Exonic
1119097567 14:71848249-71848271 ACTGGAAGGCACCCCCCAGAAGG - Intergenic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1119762094 14:77158836-77158858 CCTGGATGGCCCAGGACTGAGGG + Intronic
1119936448 14:78596409-78596431 TGGGGAAGCCACAGCACAGAGGG - Intronic
1120197893 14:81506209-81506231 CATTGAAGGCACAGCACATGGGG - Exonic
1122138774 14:99649929-99649951 CATGGGAGGGACAGCACACACGG + Intronic
1122154788 14:99743482-99743504 CCTGGATCGCACAGTACTGAAGG - Intronic
1122281254 14:100623757-100623779 CTTGGAAGGCACATCAGGGAGGG - Intergenic
1122768925 14:104088554-104088576 CCTTGCAGGCACAGCAGGGAGGG + Intronic
1122907987 14:104811146-104811168 CCTGGAAGGCACTGGAGAGCGGG + Intergenic
1122984908 14:105207564-105207586 CCTGGCAGGCCCAGCCCGGAAGG + Intergenic
1122985833 14:105211249-105211271 CCTGGCAGGCTCAGCTCCGAGGG + Exonic
1123737072 15:23195873-23195895 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1123737825 15:23202296-23202318 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124090142 15:26591596-26591618 CCTGAAAGGAACTGCCCAGAGGG + Intronic
1124240983 15:28027443-28027465 TCTGGAGCCCACAGCACAGAAGG + Intronic
1124287770 15:28418849-28418871 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124288290 15:28424544-28424566 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124289034 15:28430965-28430987 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124294189 15:28486345-28486367 TCTGGAAGGCAAGGCTCAGATGG - Intergenic
1124294935 15:28492777-28492799 TCTGGAAGGCAAGGCTCAGATGG - Intergenic
1125769993 15:42158948-42158970 CCAGGAAGGCAGGGCACACATGG + Exonic
1125929932 15:43593386-43593408 GGTGGAGGACACAGCACAGATGG + Intronic
1125943100 15:43693218-43693240 GGTGGAGGACACAGCACAGATGG + Intronic
1127564706 15:60175785-60175807 CCTAGAAGGCACAGCAAAAAGGG + Intergenic
1127804613 15:62507532-62507554 CCTGGGAGGCAGAGCACAGGTGG + Intronic
1128158879 15:65410130-65410152 CCTGGTAGGCAGGGCAGAGAGGG - Intronic
1129115478 15:73363182-73363204 CCAGGAAAGCCCAGCAAAGAAGG + Intronic
1129766781 15:78174606-78174628 CCCGGAAGCCTCAGCACAGCTGG + Intronic
1130151680 15:81316049-81316071 CCTTTGAGGAACAGCACAGAGGG - Intronic
1130431333 15:83850234-83850256 GCTGGAATGCAGAACACAGATGG - Intronic
1130759660 15:86805460-86805482 GTTGGAAGGCTCAGCAGAGAGGG - Intronic
1130956410 15:88630266-88630288 CCAGGGAGGCACAGGACAGAAGG + Exonic
1130990149 15:88871262-88871284 CCTTGAGGGCACAGCATGGAAGG + Intronic
1130993405 15:88890247-88890269 GCTGCAGTGCACAGCACAGATGG - Intronic
1131988200 15:98066122-98066144 GCTGGGAGCCACAGCCCAGAGGG + Intergenic
1132010115 15:98267978-98268000 CCTGGAAGGCAGCACAGAGATGG - Intergenic
1132652285 16:1026950-1026972 CCAGGGAGGCCGAGCACAGATGG + Intergenic
1133148396 16:3807906-3807928 CCTGGAGGGCACAGATCAGATGG - Intronic
1133239396 16:4405411-4405433 CCTGGAAGGCCCAGCCCAGGGGG + Intronic
1133540588 16:6749190-6749212 CCTGGAATGCACAGCAGAGCAGG - Intronic
1133673576 16:8047877-8047899 CCTGCAAGCCACAGCACAAATGG - Intergenic
1133707758 16:8371497-8371519 CCTGGCAGCCAAAGCAAAGAGGG + Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134626651 16:15727143-15727165 CCAGGAAGGCACACAACAGGGGG + Intronic
1135100573 16:19601642-19601664 CCTGGGAGGAAAAGGACAGATGG - Exonic
1136024049 16:27458679-27458701 CAGGGAATGCACAGCCCAGATGG - Intergenic
1136171700 16:28493943-28493965 CCTGGGAGGCACACTAGAGAGGG - Intronic
1136560801 16:31038210-31038232 GATGGGAGGCACAGCAGAGAGGG - Intronic
1136776409 16:32874125-32874147 CCTGGAAGACACAGCTTTGAGGG - Intergenic
1136894206 16:33987387-33987409 CCTGGAAGACACAGCTTTGAGGG + Intergenic
1137002845 16:35246312-35246334 CCTGTGAGGCCCACCACAGAAGG - Intergenic
1138301838 16:55937109-55937131 CCAGGTAGGCAAAGCACATACGG - Intronic
1140891676 16:79290233-79290255 CCTGGGAGGCTTAGAACAGAGGG + Intergenic
1140901154 16:79369277-79369299 ACAGGAAGGAACAACACAGACGG + Intergenic
1141564627 16:84893063-84893085 CCTAGAACTCACAGCTCAGAAGG + Intronic
1141879221 16:86846760-86846782 CCTGCAAGACACAGCAGAGTGGG + Intergenic
1142236592 16:88925325-88925347 CCCGGAAGGCACCGCTCAGGAGG - Intronic
1142283535 16:89161397-89161419 CGTGGAAGGCACATTCCAGAAGG + Intergenic
1203078824 16_KI270728v1_random:1136234-1136256 CCTGGAAGACACAGCTTTGAGGG - Intergenic
1143019246 17:3908125-3908147 CCCAGGAGGCAGAGCACAGAGGG + Intronic
1143161964 17:4877775-4877797 CATGGAAGTCAGAGCGCAGATGG - Intronic
1143617059 17:8058435-8058457 CCTTCAAGACGCAGCACAGAAGG + Intergenic
1143954808 17:10659879-10659901 GCTGGAAGGGACAGCACCCACGG + Intergenic
1144957253 17:19025089-19025111 GCTGGAAGGCAGGGCACAGACGG - Intronic
1144957327 17:19025514-19025536 GCTGGAAGGCTGGGCACAGACGG - Intronic
1144977830 17:19149003-19149025 GCTGGAAGGCTGGGCACAGACGG + Intronic
1145058356 17:19717352-19717374 CCTGCAAGGAAAAGCAGAGAGGG - Intronic
1145072000 17:19818600-19818622 CATGGAATGCAGAGCACAGGTGG - Intronic
1145958722 17:28873001-28873023 GCCTGAAGGCCCAGCACAGAGGG - Intergenic
1146283686 17:31560395-31560417 CCTGGAAAGCACAGCAGGGCAGG - Intergenic
1147171195 17:38620067-38620089 CCTGGAAGGGAGGGAACAGAAGG - Intergenic
1147979694 17:44266833-44266855 CCTAGAAGGTATAGCACAGCTGG + Intronic
1148834873 17:50460779-50460801 CCTGGAGACCACAGCACAGAGGG + Exonic
1149168201 17:53779448-53779470 ACTGTAAGGAACAGAACAGAAGG - Intergenic
1149983653 17:61331167-61331189 CCTAGAAGCCTCAGCACACAGGG + Intronic
1150440744 17:65189533-65189555 CCTCGAAGGCACAGAGCTGAGGG + Intronic
1150523675 17:65897977-65897999 CCTGGAAGCCACAGCAAAGAGGG - Intronic
1150612050 17:66741233-66741255 CCTGGAAGGCAAAGTATAGTGGG - Intronic
1151328077 17:73391099-73391121 GCTGGCAGGCTCAGCACAGCTGG - Intronic
1151745613 17:76010207-76010229 CCTGGAAGTGGCAGCCCAGAAGG - Exonic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1152659175 17:81534552-81534574 CCTGGGAGACCAAGCACAGATGG + Intronic
1152890604 17:82879617-82879639 CCTGGGGAGCCCAGCACAGAGGG - Intronic
1155178845 18:23325474-23325496 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1155495166 18:26435754-26435776 CCCAGAAGGAACAGCAAAGAAGG - Intergenic
1156178199 18:34572529-34572551 ACTGTAAGGCACAGCAGAGGCGG + Intronic
1156445322 18:37232471-37232493 CCTGGACAGGACAGCGCAGAGGG - Intergenic
1157847546 18:51017732-51017754 CCTGGGTGGTACAGCACAGAGGG + Intronic
1158679717 18:59556303-59556325 CCTGGAAGACAAAACACAGCTGG - Intronic
1159840326 18:73391875-73391897 CTTGGAAGAGAAAGCACAGATGG + Intergenic
1159886474 18:73912241-73912263 CATGCAAGGCACAGCATGGAAGG - Intergenic
1159943904 18:74429410-74429432 TCTGGAAGCCACATCACACAGGG - Intergenic
1160070057 18:75620769-75620791 CGTGTAAGGAACAGCAAAGAAGG - Intergenic
1160392033 18:78541149-78541171 CCTGGAAGGCACACGAGAGAAGG - Intergenic
1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG + Intronic
1163600962 19:18248693-18248715 CCGGGGCGGCACAGCACAGCGGG - Intronic
1163860015 19:19737951-19737973 CCTGGAAGGCCCAGCAGAAGGGG + Intergenic
1164710480 19:30353772-30353794 CTTGGGAGGCAAAACACAGATGG + Intronic
925239101 2:2306662-2306684 CCTGGAAAACCCAGGACAGAAGG + Intronic
925442779 2:3902929-3902951 CCAGAATGTCACAGCACAGAGGG - Intergenic
925753928 2:7115582-7115604 CCTCTAAGGTACAGCACATAGGG - Intergenic
926909977 2:17843486-17843508 CCTGGCAAGCACAGCAGGGAAGG - Intergenic
927860214 2:26556046-26556068 CTTGGATGGCACAGCACAGAAGG + Intronic
928793623 2:34989837-34989859 CCTTATAGGCAAAGCACAGATGG + Intergenic
932714434 2:74091026-74091048 CTTGGCAGTCAGAGCACAGAAGG - Intronic
932865684 2:75339419-75339441 CCTGGAAGTTACAGCAGAGGAGG - Intergenic
933844473 2:86314376-86314398 CCTGGAAGGCACTGCAGGGCTGG + Intronic
934175390 2:89574438-89574460 CATGGAAGGCACAGCACATAAGG - Intergenic
934285706 2:91648801-91648823 CATGGAAGGCACAGCACATAAGG - Intergenic
935667261 2:105523544-105523566 GCTGGAGGGCAGATCACAGAAGG + Intergenic
937065395 2:119013166-119013188 CCTGCAATGCACAGAACGGAGGG + Intergenic
937142920 2:119617509-119617531 GCTGGAAGGCTCAGTGCAGAAGG - Intronic
937542081 2:122968688-122968710 CCTGGGAGCCACAGAAAAGAAGG - Intergenic
938413573 2:131085838-131085860 GCTGTAGGGGACAGCACAGATGG - Intronic
938947530 2:136226656-136226678 CCTGGAAGACAAAGCACAGAAGG + Intergenic
940654163 2:156468401-156468423 CATGGAAGGCACAACTCAGAGGG - Intronic
944139362 2:196438212-196438234 GCTGGAAGACACAGGACAGGTGG + Intronic
944928165 2:204486566-204486588 GGAGGAAGGTACAGCACAGAGGG + Intergenic
945027069 2:205629682-205629704 ACTCAAAGGCACAGCCCAGAGGG - Intergenic
945184146 2:207122682-207122704 CTTTGGAGGCACAGCCCAGAAGG + Intronic
946167154 2:217871318-217871340 CCTTGAAGTCACAGGCCAGAAGG + Intronic
946224930 2:218259413-218259435 CCTGGAAGTCACATATCAGAAGG + Intergenic
947996269 2:234530337-234530359 CCTGGAAGGCTCCAGACAGAAGG - Intergenic
948263853 2:236623443-236623465 CCTGGAAAATAGAGCACAGAGGG - Intergenic
948299218 2:236889443-236889465 CCTGAAAGCCACGCCACAGAAGG + Intergenic
1168914964 20:1478078-1478100 CCTTCAAGGCCCAGCACAAATGG - Intronic
1169011130 20:2251532-2251554 CCTGGGGGCCATAGCACAGAAGG - Intergenic
1169789198 20:9391843-9391865 CCTGGAAGGCAGAGAAGAGCAGG - Intronic
1171191504 20:23162648-23162670 CCTGGTTGGCACTGGACAGAGGG + Intergenic
1172601527 20:36187161-36187183 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1172811642 20:37652196-37652218 CCTGGAAGGAAGAGGAGAGAGGG + Intergenic
1173964673 20:47103012-47103034 CCTAGAAGGCAAGGCACAAAAGG - Intronic
1174142336 20:48424636-48424658 AATGGAAGGCAATGCACAGAGGG - Intergenic
1175373814 20:58511006-58511028 CCCTGCAGGGACAGCACAGAGGG + Intronic
1175519218 20:59588911-59588933 CCTGGGACTCACAGCAAAGATGG - Intronic
1175762025 20:61567651-61567673 CCTGGAAGGAGCAGGGCAGAGGG + Intronic
1175941074 20:62537770-62537792 ACTGGAAGCCACAGCCCAGGTGG - Intergenic
1175942332 20:62543243-62543265 CCTGGAAGACATAGCACAGATGG - Intergenic
1175986862 20:62768350-62768372 CCTGGCTGGCACAGAACGGAGGG + Intergenic
1176142497 20:63550988-63551010 TCTGGAGGGCACAGCTCTGAGGG + Intronic
1176205977 20:63888398-63888420 CCTGTAGGGGACAGCAGAGAGGG + Intronic
1176206016 20:63888564-63888586 CCTGTAGGGGACAGCAGAGAGGG + Intronic
1176206055 20:63888730-63888752 CCTGTAGGGGACAGCAGAGAGGG + Intronic
1176206075 20:63888813-63888835 CCTGTAGGGGACAGCAGAGAGGG + Intronic
1177134676 21:17296569-17296591 CATGGAAGGCTCAGAGCAGATGG - Intergenic
1178194637 21:30329641-30329663 TCTAGAAGCCACAGCAAAGAAGG - Intergenic
1178365647 21:31986954-31986976 TCTGGAACTCACAGCCCAGAGGG - Intronic
1179262229 21:39767857-39767879 CCTGGAAGGCACATCTCCAATGG - Intronic
1179992815 21:44957477-44957499 ACTGCAAGGCACAGGGCAGATGG - Intronic
1181964286 22:26645737-26645759 CCTGGAAGACAATGCAAAGAGGG - Intergenic
1182049263 22:27300431-27300453 CCTGAAGGTCACAGCACAGGGGG + Intergenic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1183433397 22:37779579-37779601 ACAAGAAGCCACAGCACAGAGGG + Intergenic
1184205469 22:42999698-42999720 CCTGGTGGGCACAGGACTGATGG + Intronic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
1185009163 22:48303537-48303559 CCAGAAAAGCACAACACAGAGGG + Intergenic
1185156532 22:49196440-49196462 CCTGCAAGGCACAGAGCTGAAGG + Intergenic
1185213588 22:49586009-49586031 CCTGGGACTCACAGCACGGAGGG - Intronic
951419364 3:22466040-22466062 TCTGGAAGGCATAGCTGAGATGG + Intergenic
952834787 3:37593641-37593663 CCTGAAAGGCCCATCACAGTGGG + Intronic
953219764 3:40959278-40959300 CCTGGGAGGCACACCCCAGTAGG - Intergenic
953251760 3:41250255-41250277 CCTGAAAGGCAGAGAAGAGAAGG + Intronic
953256513 3:41296334-41296356 CCTGGAAGGTACTGAAGAGAAGG + Intronic
954218176 3:49135951-49135973 CCTGGAGGGCACTGTACAGGAGG - Intergenic
954472699 3:50711789-50711811 CCAGAAAAGCACAGCCCAGATGG - Intronic
955466662 3:59243978-59244000 CCAGGAACTCCCAGCACAGAAGG - Intergenic
964172242 3:153784681-153784703 GCTGGAAGGTACAGCTCACAGGG + Intergenic
964199119 3:154098219-154098241 CCAGGCCGGCAAAGCACAGAAGG + Intergenic
964414468 3:156432915-156432937 CCTGGAAGGCACTGAAAAGGAGG - Intronic
965741434 3:171879130-171879152 CCTGGCAGGCAAAGCAGAAAGGG - Intronic
966469749 3:180275809-180275831 CCTAGAAGGCCCAGCACAAAAGG - Intergenic
966913876 3:184574467-184574489 CCTGCATGGCAGAGCACAGGAGG - Intronic
967146658 3:186612379-186612401 CCTGCATGTGACAGCACAGATGG - Intergenic
967168689 3:186806747-186806769 CCTGGCAGGCTCAGCAATGAGGG + Intronic
968570301 4:1336839-1336861 CCTGGAAGACAGAGAGCAGAGGG - Exonic
968662831 4:1805883-1805905 CCTGGTAGGCACAGGACACCAGG - Exonic
969373279 4:6747458-6747480 CCTGGCAAGCACAGCCCAGCTGG + Intergenic
969511805 4:7622344-7622366 CCTGCAAGGCACAGAATAAAAGG - Intronic
969697003 4:8740674-8740696 TCTGGAAAGCCCATCACAGACGG - Intergenic
970014968 4:11503409-11503431 CCTGGAAGGCACAGCTCAGCAGG - Intergenic
970468111 4:16348249-16348271 CTAGGAAGACACAGCACAGAGGG - Intergenic
971156460 4:24088327-24088349 CCTGGGAGACAGAGGACAGAGGG + Intergenic
972041734 4:34609580-34609602 CCTTGAAGCCACAGAACACATGG + Intergenic
972212417 4:36854983-36855005 CCTGGAAGGTTCGTCACAGAGGG - Intergenic
972764302 4:42137412-42137434 CCTGGAAGACAAAGAACACAGGG + Intronic
974902250 4:68015056-68015078 CCTGGAAGGGAAAGCAGACAGGG + Intergenic
977294217 4:95193265-95193287 CATGGAGAGGACAGCACAGAAGG + Intronic
977516477 4:98026533-98026555 ACTAGCAGGCACACCACAGAAGG - Intronic
977780095 4:100970782-100970804 CCTGGAAGGAATAGCAGAAATGG + Intergenic
978672257 4:111263985-111264007 ACTTGAAGCCACAGGACAGAGGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
984885417 4:184445214-184445236 CCGGGTTGGCACAGAACAGAAGG + Intronic
986131047 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG + Intergenic
986224734 5:5801992-5802014 CCAGGAAGGTTCAGCACAGAAGG - Intergenic
986340416 5:6784455-6784477 CCAGGTAGCCACAGCACAGTTGG - Intergenic
987728230 5:21731563-21731585 CCTGACAAGCACAGCAGAGAAGG - Intergenic
989171350 5:38472691-38472713 CTGGGAAGGCACAGGACTGAGGG + Intergenic
989188040 5:38643612-38643634 CTGGGAAGCCACAGGACAGATGG - Intergenic
990291719 5:54359005-54359027 CCATAAAGGCGCAGCACAGATGG + Intergenic
991641146 5:68754566-68754588 CCTTGAAGACACAGAACAGGTGG + Intergenic
993673801 5:90794186-90794208 GTTAGAAGCCACAGCACAGAGGG - Intronic
995415674 5:111910369-111910391 TCTCAAAGGAACAGCACAGAGGG + Intronic
996218472 5:120897616-120897638 CCTGGAAAACACATCACAGGTGG + Intergenic
998470822 5:142382530-142382552 CCTGGAACACTCAGGACAGAAGG - Intergenic
1002374918 5:178781888-178781910 GCTGCCAGGCACAGCACAGCAGG + Intergenic
1002391982 5:178921336-178921358 ACTGGAAGTCACAGCAGAGCGGG - Intronic
1002929917 6:1626116-1626138 TCTAGAAGGCTCAGCAGAGAAGG - Intronic
1003197332 6:3926347-3926369 ACTGGAAGCCACAGCACATTTGG + Intergenic
1003318483 6:5032802-5032824 ACTGGAAGCCACAGCACATTTGG - Intergenic
1005955755 6:30662334-30662356 CTTGGAATGCTCAGCTCAGAGGG - Intronic
1006795968 6:36732614-36732636 CCTGCCAAGCAGAGCACAGAGGG - Exonic
1006824040 6:36921071-36921093 CCAGCCAGGCACAGCACAGCAGG - Intronic
1010845159 6:80697780-80697802 CCTGTAAGGTACAGTACAAAGGG + Intergenic
1010950924 6:82036145-82036167 CCTGGAGAACACATCACAGAGGG + Intergenic
1010999495 6:82571674-82571696 CCAGGCAGGCACTGCACTGAAGG - Intergenic
1011234671 6:85202766-85202788 TCTGGAAGGCTCATCCCAGAAGG - Intergenic
1011239772 6:85258627-85258649 CCTGGAAGGCAGTGCACCGAAGG - Intergenic
1012264801 6:97128792-97128814 CCTGGCAGGCACTGCAGTGAAGG + Intronic
1013154003 6:107475827-107475849 CCTTCAAGGCCCAGCTCAGAGGG + Intergenic
1013169899 6:107627364-107627386 TCTGTAAGGCAGAGCAGAGATGG - Intronic
1013283657 6:108662234-108662256 TTTGGAAGGCAGACCACAGAAGG + Intronic
1013819173 6:114134729-114134751 CCTGGCAGTCCCAGCATAGAAGG - Intronic
1015258607 6:131208999-131209021 CCAGGAAGGTACACCACAGGTGG + Intronic
1015339293 6:132079428-132079450 CCTGGAAGGCTCTGTACAGGTGG - Intergenic
1015419360 6:132988076-132988098 CCTGGAAGGCAGAGATCTGAGGG + Intergenic
1015765045 6:136707351-136707373 CCTGGGAAGCTCAGCAGAGAAGG + Intronic
1017566468 6:155692495-155692517 CCTGGAAGTGACAGCAGGGAGGG + Intergenic
1017604367 6:156117916-156117938 CCTGGAAGGCACGTCAGTGATGG - Intergenic
1018898004 6:168034649-168034671 CCTGGAATGGGAAGCACAGAGGG + Intronic
1019653114 7:2171466-2171488 CCTGCAAAGGACAGCAGAGAAGG + Intronic
1019893041 7:3962417-3962439 CCTGGAAGGCACCGCAGCCAGGG + Intronic
1020368122 7:7401993-7402015 CCAGGAATGCAGAGTACAGAAGG + Intronic
1020845253 7:13274094-13274116 ACTGGAAGGCACACCCCAGTAGG - Intergenic
1022241615 7:28517751-28517773 CCCAGAAAGCAAAGCACAGAGGG - Intronic
1022425329 7:30263349-30263371 CCAGGAAGTCAGAGCACAGATGG - Intergenic
1022765556 7:33407841-33407863 ACTGGGAGGCACAGCCCAGTAGG - Intronic
1023733938 7:43218580-43218602 CTTGGAAGGCACAGCAAAGCTGG + Intronic
1023842081 7:44103751-44103773 CCAGGGAGGGACAGCACAGTGGG - Intergenic
1024059607 7:45687940-45687962 CCAGACAGGCACAGCCCAGAGGG + Intronic
1024524334 7:50335972-50335994 CCAGCAGGGCACAGCATAGAGGG + Intronic
1025768575 7:64482338-64482360 CCTGGAAGGGACAATACTGAAGG + Intergenic
1026678889 7:72450457-72450479 AGAGGATGGCACAGCACAGATGG + Intergenic
1029177510 7:98675279-98675301 CCAGGAGGTCACAGGACAGATGG - Intergenic
1029377165 7:100185910-100185932 CATGGAATGCAGAGCACAGGAGG - Intronic
1029422089 7:100477135-100477157 CCTGGCAGGCACAGAGAAGAGGG + Intronic
1029473470 7:100768815-100768837 GTTGGGAGGTACAGCACAGAGGG - Intronic
1029622285 7:101697766-101697788 CCTAGTAGGCAAAGCAAAGAGGG + Intergenic
1029714644 7:102319287-102319309 CCCGAAAGAAACAGCACAGAGGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032081488 7:128860652-128860674 CCTGTAAGGCTCAGCACCCAGGG - Intergenic
1033604892 7:142919746-142919768 CCTGGAAGGAAATGCCCAGAAGG + Intronic
1033731993 7:144189132-144189154 CCTTGAAGGAAGACCACAGAAGG + Intronic
1033742842 7:144287715-144287737 CCTTGAAGGAAGACCACAGAAGG + Intergenic
1033751060 7:144361899-144361921 CCTTGAAGGAAGACCACAGAAGG - Intronic
1034484396 7:151349554-151349576 GCAGGAGGACACAGCACAGAAGG + Intronic
1034604604 7:152300522-152300544 CATGGAAGGCACAGCACATAAGG + Intronic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035296328 7:157868747-157868769 CCCGGAGTGCACAGCCCAGAGGG - Intronic
1035751282 8:1998266-1998288 CCTTGTTGGCACAGCAGAGATGG + Intronic
1035832445 8:2711858-2711880 GCCAGAAAGCACAGCACAGACGG + Intergenic
1036380963 8:8236256-8236278 GCTGGAAGGCAGAGCGCTGATGG - Intergenic
1037787242 8:21910364-21910386 CCTGTAGGGGAAAGCACAGAGGG - Intronic
1038994498 8:32906579-32906601 CCCTGAAGGAAGAGCACAGAAGG - Intergenic
1039734991 8:40322238-40322260 TGTGGAAGGCAGAGCAGAGATGG + Intergenic
1040284166 8:46091619-46091641 CCTGGAGGACACAGCACTCAAGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1041070467 8:54123431-54123453 TCTGGTAGGCACAAGACAGAAGG - Intergenic
1041475589 8:58261574-58261596 CCTGGAAGGCAATGTATAGATGG + Intergenic
1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG + Intronic
1043538024 8:81227514-81227536 CATGGAGGACACATCACAGATGG - Intergenic
1044707332 8:95021279-95021301 CCTTGAAGATACAGCACACAAGG + Intronic
1045706294 8:104926882-104926904 CCTGAAGGGTACAGTACAGAGGG + Intronic
1046699690 8:117386167-117386189 TCTGAAAGGCAAAGCACAAATGG + Intergenic
1047206999 8:122810597-122810619 CCTGGAAGGGCCAGCAGTGAGGG + Intronic
1047295620 8:123568258-123568280 CCTGGGAGGCACTGCATAAATGG + Intergenic
1047748568 8:127863731-127863753 CTTGGAAGCCAAAGCCCAGAGGG + Intergenic
1048206654 8:132420823-132420845 GCTGGGAAGCACTGCACAGAGGG + Intronic
1048278719 8:133088953-133088975 TCTGGAAGCTAAAGCACAGATGG - Intronic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049554126 8:143273848-143273870 CCAGGGTGGCACAGCACTGAGGG + Intronic
1049769951 8:144375115-144375137 CCTGGAAGGAGCTGCACTGAAGG - Intronic
1049799722 8:144512154-144512176 CCTGGAAGGTTCTGCGCAGACGG + Exonic
1050577441 9:7011905-7011927 CATGGAAGGCAGAGCAGTGAAGG - Intronic
1050913866 9:11107432-11107454 CCTGCAAACCACAGCACTGAGGG + Intergenic
1051080180 9:13284983-13285005 CCTGGAAGACAAAAAACAGATGG - Intergenic
1051427294 9:16945399-16945421 CTTGGGAGGCAGAGCACAGGAGG + Intergenic
1052506949 9:29367486-29367508 CTTGAAAGTAACAGCACAGAAGG + Intergenic
1053353156 9:37426427-37426449 CCTGGCAGGCAGATCAAAGAGGG + Intronic
1053409237 9:37904847-37904869 ACTGGAACGCACACAACAGATGG + Intronic
1053424205 9:38000442-38000464 CCTGGAAGGCCCTGCACTCATGG + Intronic
1053434360 9:38065767-38065789 CCTTGTAGGCTAAGCACAGAGGG - Intronic
1056394424 9:86168504-86168526 CCTGGAAAACAAAGAACAGACGG - Intergenic
1057032089 9:91783726-91783748 CCTGGAGGGCACACCAGGGATGG + Intronic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1058426549 9:104880194-104880216 CCTGGGAGAGACAGCACAGGAGG + Intronic
1059699848 9:116764447-116764469 CTTGGAAGGGACAGGGCAGAAGG - Intronic
1060110935 9:120905740-120905762 TCTGGTATACACAGCACAGACGG + Intronic
1060204646 9:121675322-121675344 CGTGGCAGGTACAGCAAAGAGGG + Intronic
1060434530 9:123582216-123582238 CCTCCAAGTAACAGCACAGAAGG - Intronic
1060527439 9:124328460-124328482 GCTGGTGGGCACAGCACACAGGG - Intronic
1060829177 9:126703047-126703069 CCCAGACTGCACAGCACAGAGGG + Intergenic
1060994860 9:127870118-127870140 CCTGGAGGCCACAGCAGGGATGG + Intronic
1061591684 9:131602070-131602092 CCTGGGAAGGACAGCAGAGACGG - Exonic
1061598655 9:131650144-131650166 CCTGGAAGCCACAGCACTGGTGG + Exonic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061908875 9:133712486-133712508 CCTGGAAGGGGCAGCAGTGAGGG - Intronic
1062087371 9:134655787-134655809 CCTGGTGGGCACAGCACCCATGG - Intronic
1187652338 X:21422318-21422340 TCTTGAAGGCACAGGAAAGAAGG - Intronic
1189214472 X:39311272-39311294 CATGGCAGGCAAAACACAGAGGG + Intergenic
1190159414 X:48020162-48020184 CCTAGAAGCCACAACATAGAGGG - Intronic
1190175125 X:48142395-48142417 CCTAGAAGCCACAACATAGAGGG - Intergenic
1191899652 X:66027620-66027642 CCTGGAAAGTACAGCACAAATGG - Intronic
1192410281 X:70927797-70927819 CCTGGTAGAAAGAGCACAGAGGG + Exonic
1192567138 X:72174342-72174364 CCTGGAAGGTCCAGCACCGCAGG + Intergenic
1195676312 X:107509704-107509726 GCTGGGAGTCACAGCACAGTTGG + Intergenic
1198737110 X:139798916-139798938 ACTTGAGGGTACAGCACAGATGG + Intronic
1199523316 X:148762722-148762744 CCTAGCAGCCAGAGCACAGAGGG - Intronic
1199940158 X:152618278-152618300 CTTGGGAGACACAGCCCAGAAGG + Intergenic
1200084087 X:153594440-153594462 ACTCGAGAGCACAGCACAGAAGG - Intronic
1200103456 X:153699915-153699937 CCTGGAAGACACAGCTCTGAGGG + Intergenic
1202091742 Y:21198134-21198156 CATGGAAGGAACAGAACAAAAGG - Intergenic