ID: 1161206297

View in Genome Browser
Species Human (GRCh38)
Location 19:3042774-3042796
Sequence TCCGAGCTAGTACTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161206297_1161206300 16 Left 1161206297 19:3042774-3042796 CCATTCTCCAGTACTAGCTCGGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1161206300 19:3042813-3042835 GACTTAACAATTTAAATGAAAGG 0: 1
1: 1
2: 0
3: 28
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161206297 Original CRISPR TCCGAGCTAGTACTGGAGAA TGG (reversed) Intronic
911292211 1:96071108-96071130 TCCCAGCTATTACAGCAGAACGG + Intergenic
916045266 1:160995170-160995192 TCATAGCTAGTACCAGAGAAGGG + Intergenic
919735767 1:200949513-200949535 TCCATGGTAGAACTGGAGAAAGG - Intergenic
920171115 1:204073144-204073166 TCCAAGCCGGGACTGGAGAAGGG - Intronic
1068740269 10:60461213-60461235 TCAGATCTAATACTGGAGAAAGG - Intronic
1086022751 11:82251546-82251568 TCAGAGTTAGTACTGGAGAAAGG + Intergenic
1089352818 11:117831059-117831081 TCCTAGCTAGCACTGGGGACAGG + Intronic
1089850300 11:121490151-121490173 AAGGAGCTAGAACTGGAGAAAGG - Intronic
1091726259 12:2848611-2848633 TCAGGGCTGGTGCTGGAGAATGG - Intronic
1094348696 12:29499173-29499195 TCTGAGCTTTTATTGGAGAACGG - Intergenic
1094542966 12:31377924-31377946 TCCCAGCAAGTTCTGGAGTATGG + Intergenic
1099237916 12:80104172-80104194 TACAAGCTAGTACAGGAGATAGG + Intergenic
1109229432 13:59738510-59738532 TCCCTCCTTGTACTGGAGAAGGG + Intronic
1109231554 13:59763931-59763953 TCCGAGCTAGTACTGTGGGGAGG + Intronic
1118243395 14:64083536-64083558 TCTGAGCTAGAACTGAGGAAAGG + Intronic
1118684400 14:68276900-68276922 TCCGAGGTAGTACTGGCTACTGG + Intronic
1119125739 14:72124865-72124887 TACTACTTAGTACTGGAGAAGGG - Intronic
1119920210 14:78439763-78439785 TCAGAGCTAGGACTGGAGCTGGG + Intronic
1124728423 15:32175823-32175845 ACCCAGCTGGTGCTGGAGAATGG - Intergenic
1128036044 15:64527669-64527691 ACTGAGAAAGTACTGGAGAAAGG - Intronic
1129599944 15:76992934-76992956 CTCGAGGTAGAACTGGAGAAAGG + Intergenic
1131424790 15:92336867-92336889 TCCAAGCTAGGACTGTACAATGG + Intergenic
1131488926 15:92845041-92845063 TACCAGGTACTACTGGAGAAAGG - Intergenic
1135297960 16:21299956-21299978 TCCCAGCAAGGACTGGGGAAAGG + Intronic
1135404834 16:22190540-22190562 TCCGGGCTAGGTCTGGAGAGCGG - Exonic
1149893676 17:60412385-60412407 TCCCAGCTACTAGTGGGGAATGG + Intronic
1155186598 18:23392492-23392514 TCCCAGCTTGTACTGGAGGCTGG - Intronic
1161206297 19:3042774-3042796 TCCGAGCTAGTACTGGAGAATGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
927731265 2:25474101-25474123 TCTGAGTTAGAACTGGTGAAAGG + Intronic
932292874 2:70597194-70597216 TCCCAGCCTGTACTGCAGAAAGG + Intergenic
940270802 2:151888112-151888134 CCCGAGCTGGGAATGGAGAATGG - Intronic
944109696 2:196119105-196119127 TCAGTTCTTGTACTGGAGAAGGG - Intergenic
948074542 2:235155750-235155772 TCCGAGCTCCTACTTGAAAATGG - Intergenic
1172224223 20:33294262-33294284 TCCAAAAAAGTACTGGAGAAAGG - Intronic
1174593918 20:51668219-51668241 TGGGAGCAGGTACTGGAGAAGGG + Intronic
1185294202 22:50045421-50045443 TCCGAGCCAGGACTGGGGACTGG + Intronic
953634801 3:44653702-44653724 TCTAAGCTAGGACTAGAGAAAGG + Intronic
955223179 3:57039910-57039932 TCCCAGGTATTACTGGTGAATGG + Intronic
955645944 3:61137523-61137545 TCCAGGCTAGTAGAGGAGAAAGG - Intronic
959864697 3:111252891-111252913 ACTCAGCTAGGACTGGAGAAGGG - Intronic
962256426 3:133872979-133873001 TCCTAGCTGGTGCAGGAGAAGGG - Intronic
963900426 3:150727810-150727832 TCCCAGCTAGTGCGGGAGACTGG - Intergenic
964832860 3:160905040-160905062 TCTGCTCTAGTACTGGAGGAGGG + Intronic
976572990 4:86635009-86635031 TCAGAGACAGAACTGGAGAATGG - Intronic
977251571 4:94694654-94694676 TGGGAGCTAGTGCAGGAGAAGGG - Intergenic
980237887 4:130132009-130132031 TCCAGGCTAGTACTGGGGATTGG - Intergenic
980749997 4:137076480-137076502 TCTGAGCTATTTCTGGAGAAAGG - Intergenic
980956983 4:139439115-139439137 TCCCAGCTACTCCAGGAGAATGG - Intergenic
981330386 4:143501464-143501486 ACTGAGAGAGTACTGGAGAATGG + Intergenic
992565570 5:77992528-77992550 TCTGGGCTTCTACTGGAGAAGGG + Intergenic
995344283 5:111093537-111093559 TCTGAGCTGGTAATGGAGACAGG + Intronic
997848533 5:137310136-137310158 TCTGAGCCAGTTCTGTAGAATGG + Intronic
1002852091 6:1005444-1005466 TCGGAGTTCGTCCTGGAGAAGGG + Intergenic
1004377431 6:15102989-15103011 TCCAAGTTTGTCCTGGAGAATGG - Intergenic
1006893986 6:37454383-37454405 TGCCTGCTGGTACTGGAGAATGG - Intronic
1018716879 6:166539894-166539916 CCCGAGCTAAAACTGTAGAAAGG - Intronic
1021798616 7:24283503-24283525 TCTGAGCGAGTACTTGAGGAAGG + Intergenic
1023219285 7:37902050-37902072 ACTGAGCCAGTACTAGAGAATGG - Intronic
1037696774 8:21230397-21230419 ACAGAGCTAGTATTGGAGAGTGG + Intergenic
1039435521 8:37556883-37556905 TCCCAGCTGGTGCTGGTGAAGGG + Intergenic
1048742505 8:137577561-137577583 TCAGAGATAGAACTGGAGAAGGG + Intergenic
1051582181 9:18688888-18688910 GCCGTGCTAGTACTAGAAAAGGG + Intronic
1057475786 9:95399823-95399845 TCCTGGCTGGTACAGGAGAATGG - Intergenic
1187891520 X:23940388-23940410 TCAGAGCTTGTACTGGACACTGG + Intergenic
1188494137 X:30765876-30765898 TCCCAGCTACTAAAGGAGAAAGG - Intergenic
1190741513 X:53291862-53291884 TCCCAACTAGTACTAAAGAAAGG + Intronic
1192562883 X:72139121-72139143 TCAGAGCTCGTACTGGCAAAAGG - Exonic
1195427692 X:104753160-104753182 TATGTGCTAGGACTGGAGAATGG - Intronic
1196249197 X:113438970-113438992 TCCAAGCTATTACTGTGGAAAGG + Intergenic
1196965465 X:121049654-121049676 TCAGTGCTAGTGCTGGGGAAGGG + Exonic