ID: 1161206884

View in Genome Browser
Species Human (GRCh38)
Location 19:3046274-3046296
Sequence TGCCCTTCAGGCAGTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161206884_1161206893 26 Left 1161206884 19:3046274-3046296 CCCCCAAGACTGCCTGAAGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1161206893 19:3046323-3046345 GCAGACAATTCAGCCAGCGCAGG 0: 1
1: 0
2: 0
3: 8
4: 81
1161206884_1161206892 -4 Left 1161206884 19:3046274-3046296 CCCCCAAGACTGCCTGAAGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1161206892 19:3046293-3046315 GGCACACAGAGGGACGGAGAAGG 0: 1
1: 0
2: 3
3: 45
4: 538
1161206884_1161206891 -10 Left 1161206884 19:3046274-3046296 CCCCCAAGACTGCCTGAAGGGCA 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1161206891 19:3046287-3046309 CTGAAGGGCACACAGAGGGACGG 0: 1
1: 0
2: 4
3: 34
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161206884 Original CRISPR TGCCCTTCAGGCAGTCTTGG GGG (reversed) Intronic
901971599 1:12913074-12913096 TCCCCTCCAGGCACTCTTGTTGG + Intronic
902013568 1:13288666-13288688 TCCCCTCCAGGCACTCTTGTTGG - Intergenic
902600734 1:17539241-17539263 TGCCCCTCAACCAGTCTTGGCGG - Intergenic
904974837 1:34447969-34447991 TGTCCTTAAGGCAGTCTAGAAGG - Intergenic
905233948 1:36532682-36532704 TGGAGTTCAGGCAGTCTTGTAGG + Intergenic
905938351 1:41842544-41842566 TGCCAATCAGGAGGTCTTGGTGG + Intronic
920099871 1:203510379-203510401 TGCCCTTGAGGGAGTGTTGGAGG + Intergenic
920433165 1:205931825-205931847 TGCCCTTCTAGCAGGGTTGGGGG + Intronic
920836775 1:209518430-209518452 TGCCAGTGAGGCAGTGTTGGAGG + Intergenic
922606464 1:226892669-226892691 CACCCTCCAGGCAGGCTTGGGGG + Intronic
1063799797 10:9561823-9561845 GGCCCTTCAGGCTTTCTTTGGGG - Intergenic
1065333983 10:24635911-24635933 TTCCCTTCAGGGAGTCTGGTAGG + Intronic
1067800254 10:49353701-49353723 TGCCTTCCAGCCTGTCTTGGTGG - Intergenic
1070630772 10:78082817-78082839 TGCTCTTTGGGCTGTCTTGGAGG - Intergenic
1070922214 10:80195117-80195139 TGCCCATCAGCCAGTCCTCGGGG + Intronic
1072860486 10:98998912-98998934 TGCCCTTCGGGCAGAATTGAAGG - Intronic
1073748925 10:106501779-106501801 TGCCCATCAGGAATTCTTTGAGG - Intergenic
1074040563 10:109784259-109784281 TACCCTTCACAAAGTCTTGGGGG + Intergenic
1074551492 10:114446747-114446769 TGCCCTTCAGGAAGTTCTTGAGG - Intronic
1074937783 10:118203109-118203131 TGAGCTTAAGGGAGTCTTGGAGG - Intergenic
1075123819 10:119683720-119683742 TGCTTTTCAGGAAGGCTTGGAGG - Intergenic
1076067862 10:127463537-127463559 TGGGCTTCAGGCAGGCTGGGAGG - Intergenic
1077906619 11:6539421-6539443 TGCCCTTCAGGCAGGTTAGCAGG - Intronic
1078610240 11:12813421-12813443 TGCCCTTCTGGAAGTCTTTGTGG + Intronic
1080312988 11:30915608-30915630 TGCTCCTCAGCTAGTCTTGGGGG - Intronic
1080648616 11:34205191-34205213 TGCCCTTCAGGAAGTCAGGATGG - Intronic
1081559442 11:44199557-44199579 TGCCTTTCAGGCAGGATTGCAGG - Intronic
1083838535 11:65288919-65288941 GGCTCTACAGGCAGCCTTGGAGG + Intronic
1084566163 11:69930293-69930315 TTCCCTTCAGGCACTCTGGCAGG + Intergenic
1084784420 11:71433949-71433971 TACCCTCCAGGCTGTCTGGGAGG + Intronic
1089014264 11:115153873-115153895 TACCCTTCAGGCAGCCGGGGCGG + Intergenic
1089413775 11:118269709-118269731 GGTCCTTCAGCCAGCCTTGGAGG + Intergenic
1090936917 11:131351363-131351385 TGCCTTACAGGCACTCTTTGAGG - Intergenic
1100325879 12:93539433-93539455 TGCCCTTCAGCCAGGCTTCTTGG + Intergenic
1104375088 12:128258782-128258804 TGGCCTTCTGGAAGTCTTTGCGG + Intergenic
1104845772 12:131846043-131846065 TGCCCTTCCCGGAGACTTGGAGG - Intronic
1107560289 13:41551854-41551876 TGCCCTTGAGGCAGGTTTGCTGG - Intergenic
1108030915 13:46228715-46228737 TTACCTTCAGGTGGTCTTGGTGG - Exonic
1108585466 13:51866498-51866520 TTCACTTGGGGCAGTCTTGGAGG + Intergenic
1111655001 13:91141124-91141146 TGCCCTCCAGCCAGTTTTGTTGG + Intergenic
1117685609 14:58249839-58249861 ATCCTTTCAGGCAGTCTTCGAGG - Intronic
1121000811 14:90451078-90451100 TGCCCCTCTGGCAGGCTGGGTGG + Intergenic
1121409910 14:93742669-93742691 AGCCCTCCAGGTACTCTTGGTGG + Intronic
1122707039 14:103628382-103628404 TGCCCTTCAGGCCGGGCTGGAGG + Intronic
1124138807 15:27059210-27059232 TGCCCTTCAGGCCTTCCTGCTGG - Intronic
1125334035 15:38610083-38610105 TTCCCTTGAGGGAGTCTTGAAGG + Intergenic
1125434147 15:39627530-39627552 TGCACTTCAGGGAGTCTTTCTGG - Intronic
1125696789 15:41644621-41644643 TGCCCTCCAGCCAGCCTGGGTGG + Intronic
1125726114 15:41868927-41868949 TCCCCATCAAGCAGTCTTGATGG - Intronic
1130569394 15:85027131-85027153 AGGCCTTCAGGGAGTCCTGGAGG - Intronic
1133560767 16:6948142-6948164 TGCCTTTCAGCCAGGCATGGTGG + Intronic
1134251209 16:12575385-12575407 TGCCCTTCATGCGGCCCTGGTGG - Intergenic
1137937105 16:52645308-52645330 TGCCCTTCAGCCAGTTCAGGTGG - Intergenic
1140040254 16:71402716-71402738 TGCCCTTCGGTCAGTGTCGGTGG - Intergenic
1140827901 16:78724847-78724869 TGCCCTTGAGGAACTCTTAGAGG - Intronic
1140972229 16:80024495-80024517 TGACATTCAGGAAGGCTTGGAGG + Intergenic
1141134314 16:81455827-81455849 TTCCCTTCAGGGAGGCCTGGTGG + Intronic
1142288269 16:89180381-89180403 TGCCCCTCAAGCAGGCCTGGTGG + Intronic
1145796951 17:27661086-27661108 TGCCCATCAGGGATCCTTGGAGG - Intergenic
1146375146 17:32288818-32288840 TGCCCTGCAGGATGGCTTGGCGG - Exonic
1146857242 17:36264373-36264395 TTCCCTCCAGGCGGACTTGGGGG - Intronic
1146863373 17:36324002-36324024 TTCCCTCCAGGCGGACTTGGGGG + Intronic
1146873154 17:36388283-36388305 TTCCCTCCAGGCGGACTTGGGGG - Intronic
1147066233 17:37924590-37924612 TTCCCTCCAGGCGGACTTGGGGG + Intronic
1147076037 17:37988908-37988930 TTCCCTCCAGGCGGACTTGGGGG - Intronic
1147077766 17:38004151-38004173 TTCCCTCCAGGCGGACTTGGGGG + Intronic
1147087562 17:38068454-38068476 TTCCCTCCAGGCGGACTTGGGGG - Intronic
1147093703 17:38128086-38128108 TTCCCTCCAGGCGGACTTGGGGG + Intergenic
1147103504 17:38192403-38192425 TTCCCTCCAGGCGGACTTGGGGG - Intergenic
1147603148 17:41758345-41758367 TGCCCTTTAAGCAGTGGTGGGGG + Intronic
1148462809 17:47847970-47847992 GGCGCTTCAGGCGGGCTTGGGGG - Exonic
1148676152 17:49446147-49446169 TCCCCTTCAGGAGGTCTTCGTGG + Intronic
1149349555 17:55773312-55773334 TGCCTTGCAGACAGGCTTGGTGG - Intronic
1149870899 17:60180615-60180637 TGCCATTCAGGAATTCTGGGTGG - Exonic
1151281982 17:73083107-73083129 TGGTCTTCAGGCAGACATGGAGG - Intronic
1152569997 17:81117560-81117582 TGCCCCGCAGTCAGTGTTGGGGG - Exonic
1156036038 18:32769662-32769684 TGCCCTTCAGGCAGCACTGCAGG - Exonic
1157776059 18:50397194-50397216 TGCCCAACAGGCAGTCTTCCTGG - Intergenic
1157783390 18:50460040-50460062 TGCAGTTGAGGCAGTCTTGTGGG - Intergenic
1157923031 18:51733331-51733353 TCCTCTACAGGCAGCCTTGGAGG + Intergenic
1158235407 18:55307391-55307413 TGCTCTTCATGCAGGCTTGGAGG - Intronic
1158523420 18:58191073-58191095 TGCCCTTCATTCAGCCTGGGTGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1161206884 19:3046274-3046296 TGCCCTTCAGGCAGTCTTGGGGG - Intronic
1161675228 19:5643300-5643322 TGCTTCTCAAGCAGTCTTGGTGG + Intronic
1163000585 19:14364119-14364141 TAACCTTCAGGCATTCTGGGAGG + Intergenic
1165255503 19:34575399-34575421 TGCCCTGAAGGCATGCTTGGGGG - Intergenic
924961386 2:37730-37752 TTCCCTTCAGGTAAACTTGGGGG - Intergenic
925011001 2:486243-486265 TCCCCTCCAGGCAGGCGTGGAGG + Intergenic
928911926 2:36430545-36430567 TGCCCTCTTGGCAGTCGTGGTGG + Intronic
929203724 2:39266246-39266268 TGCCCTTCTGCCAGTCTTTTGGG + Intronic
929815590 2:45228788-45228810 GGCCCTGCAGGGAGTTTTGGAGG + Intergenic
931395615 2:61886054-61886076 TGCCCTTTTGGCGGTGTTGGCGG - Intronic
935173676 2:100629618-100629640 TGCCCTGCAGGCAAATTTGGGGG - Intergenic
935628087 2:105187568-105187590 TGCCCTTCAGTCGGACTTTGGGG + Intergenic
936091910 2:109507010-109507032 TGCCAGTCCCGCAGTCTTGGGGG + Intergenic
940012409 2:149068862-149068884 TGCTTTTCAGGAAGCCTTGGAGG - Intronic
940714423 2:157203711-157203733 TGACCTTCATGAGGTCTTGGAGG - Intergenic
941640233 2:167979620-167979642 TGCCTATCAGGCATTCTTGCAGG + Intronic
947856163 2:233326048-233326070 TCCCCTCCAGGCAGTGGTGGAGG + Intronic
947998567 2:234548621-234548643 TGCAGCTCAGGCAGACTTGGAGG + Intergenic
1173029066 20:39337888-39337910 TCCCTTTCAGGCAGTCTTTTTGG + Intergenic
1173426062 20:42944477-42944499 TGCTCTTCAGGTAGGCCTGGTGG - Intronic
1175672487 20:60917409-60917431 TGCCCCCCAGGCTGTCTTGGAGG + Intergenic
1175974226 20:62702317-62702339 GGCCCTTCATGCTGTCTTGGAGG + Intergenic
1175974250 20:62702387-62702409 GGCCCTTCGTGCTGTCTTGGAGG + Intergenic
1179049659 21:37878492-37878514 TGCCCTTCCAGCAGGCTTGCAGG + Intronic
1179390970 21:40990677-40990699 TGGCTTTGAGGCAGGCTTGGAGG + Intergenic
1179728817 21:43355934-43355956 GGCTCTTGAGGCAGTCTTGCTGG - Intergenic
1180099573 21:45578268-45578290 TGCCCTTCAGGGAGCCTGGGAGG + Intergenic
1182039268 22:27223839-27223861 TGGCCTTCTGGCACTCTTTGTGG - Intergenic
1182635228 22:31721129-31721151 TCCCCATCAGGCACTCTTGCTGG - Intronic
1183522457 22:38303359-38303381 TGCCCTTGAGGAGCTCTTGGGGG + Intronic
1184638557 22:45856144-45856166 TGGTATTCAGGCAGCCTTGGTGG + Intergenic
950481696 3:13248126-13248148 TGCCCTTCCTGCAGTCTGGGAGG - Intergenic
950768932 3:15295052-15295074 TGCCCATCAGGAAGGCTTGAGGG - Intronic
951961428 3:28326778-28326800 TGCTCTTCAGGCAGTTTGGCTGG + Intronic
951988737 3:28651495-28651517 TTCCCTTGAGGCAGCCTTGTAGG + Intergenic
953929895 3:47000645-47000667 TGCCCTACAGGCTCTCTTGAGGG - Intronic
955117163 3:56017209-56017231 TGACATTCAGGAAGTGTTGGAGG + Intronic
955239997 3:57169844-57169866 TGACATCCAGGCAGTCTTGTGGG - Intronic
956044557 3:65181543-65181565 TGTCCTTCAGGCAGCATCGGCGG - Intergenic
956431583 3:69191827-69191849 TGAAATCCAGGCAGTCTTGGGGG - Intronic
960635295 3:119779272-119779294 TCCCCATGAGGCAGTCTTGGAGG - Intergenic
961006685 3:123410267-123410289 TGCCCTGGAGGGAGTCTTTGTGG - Intronic
962708823 3:138068723-138068745 TGCACTGCAGGCAGTCCTGCAGG + Intronic
962956561 3:140272237-140272259 GGCCATTCAGCCAGTTTTGGAGG - Intronic
964419536 3:156486681-156486703 TGCCCTTCAGGGCCTCCTGGAGG + Intronic
967101725 3:186221433-186221455 TCCCCTTCAGGCTGATTTGGCGG + Intronic
967828948 3:193902432-193902454 TGCTTTTCAGGCAGCCTTGCAGG - Intergenic
968618749 4:1594092-1594114 TGCCCTGCTGGCAGCCTGGGGGG - Intergenic
968629857 4:1644742-1644764 AGCCCTCCAGGCAGTCTGGGGGG + Intronic
969660330 4:8523601-8523623 TGCCCCACAGGCAGGCCTGGGGG + Intergenic
972145915 4:36025146-36025168 TGCCATTCTGGGAGTCTTTGGGG + Intronic
972863638 4:43203004-43203026 TTTCCTCCAGGCTGTCTTGGGGG + Intergenic
975187248 4:71418618-71418640 TGCCCTTCAGGCTATCTTAAAGG - Intronic
979920372 4:126489679-126489701 CACCCTTCAGGCAGTCATGCTGG + Intergenic
980176822 4:129355919-129355941 TGTCCTTAAGGCATTTTTGGTGG + Intergenic
985436858 4:189939242-189939264 TGACATTGAGGCAGTCTTTGGGG - Intergenic
985515541 5:343122-343144 TGCCCTGCATGCGCTCTTGGGGG + Intronic
985775457 5:1839189-1839211 TGGTCGTCAGGGAGTCTTGGTGG - Intergenic
985854975 5:2417475-2417497 TGCTCCTCAGGCAGGCTGGGAGG + Intergenic
989767068 5:45099964-45099986 TACTCTTTACGCAGTCTTGGAGG - Intergenic
994164900 5:96598323-96598345 TGGCCTTTGGGCAGACTTGGGGG - Intronic
997263161 5:132478973-132478995 TGTCCTCCAGGCAGTCCTGTTGG - Intergenic
998081097 5:139275407-139275429 TGTCCTTCAGGAAGTATTGGAGG + Intronic
1001834522 5:174820339-174820361 TGCACTTCTGGCAGCCCTGGAGG - Intergenic
1003104970 6:3208447-3208469 TCCCCATCAGCCAGTTTTGGCGG - Intergenic
1003679077 6:8234147-8234169 TCCCCTTTAGGCAGTCTGGGTGG - Intergenic
1004175886 6:13339756-13339778 TGCACACCAGCCAGTCTTGGGGG + Intergenic
1007420067 6:41713848-41713870 TGACCTTCAGGGAGTGTGGGTGG - Intronic
1009504651 6:64461101-64461123 TTCCCCTCAGGCAATGTTGGAGG + Intronic
1011010185 6:82694973-82694995 TTCCCTTCAGGACCTCTTGGAGG + Intergenic
1013125494 6:107180293-107180315 TGCCCTTCAGGCTGGCTCTGCGG - Intronic
1017708287 6:157144748-157144770 TTCCCATCACGCAGTCTCGGCGG - Intronic
1017918816 6:158854129-158854151 GGCAGTTCAGACAGTCTTGGGGG + Intergenic
1018169689 6:161134871-161134893 GGCCCTGCAGGCAGGCTTGATGG - Exonic
1025029677 7:55547030-55547052 TGGCCTTCTGCCAGTCTGGGCGG - Intronic
1025248972 7:57338952-57338974 TGCCCTTGAGACAGCTTTGGAGG + Intergenic
1026019694 7:66697580-66697602 TGCCCTTCCAGCAGGCTTCGTGG + Intronic
1026880691 7:73905000-73905022 TGCCCTTCCAGCAGGCTTCGTGG - Intergenic
1027800687 7:82745603-82745625 TGACCTTCAGGGAGTTATGGAGG + Intergenic
1030289721 7:107859909-107859931 TCCCATGCATGCAGTCTTGGTGG - Intergenic
1031087952 7:117322466-117322488 TTACCTTGAGGCAGTTTTGGCGG + Intronic
1032439652 7:131932672-131932694 TGTCCCTCAGGCCCTCTTGGGGG + Intergenic
1034256092 7:149725346-149725368 TGCCCTTCAGACAGGCTTCCAGG - Exonic
1034266775 7:149784963-149784985 TGCCCTGCAGGCAGTACTGATGG + Intergenic
1038981755 8:32767162-32767184 TGCTGTCCAGGCACTCTTGGGGG - Intergenic
1040304100 8:46203123-46203145 TGACCTTCAGGCAGGCAAGGGGG + Intergenic
1040314174 8:46252225-46252247 TGCCCTCAAGGCGGTCGTGGTGG + Intergenic
1042688019 8:71462680-71462702 TGCCCTCCAGGCAGCAGTGGTGG + Intronic
1043000458 8:74753644-74753666 TGGCTTTCAGGTAGTCCTGGGGG - Intronic
1044819584 8:96146416-96146438 TGCCCATCAGGCGGTTTTGGTGG + Intronic
1046510227 8:115193025-115193047 TGCCCTTAATGCATTATTGGTGG + Intergenic
1047368363 8:124233574-124233596 GGTCCTTCAGGCAGGCTTGTTGG - Intergenic
1049590435 8:143458263-143458285 TACTCTTCAGTCAGTTTTGGTGG - Intronic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1050746954 9:8887264-8887286 TGGCCTTAAACCAGTCTTGGGGG - Intronic
1050979661 9:11993871-11993893 TACCCTTCAGGCAAGCATGGTGG + Intergenic
1051227961 9:14922365-14922387 TGCACATCAGGCAGTCGTCGGGG + Intergenic
1052698245 9:31906397-31906419 AGCACTTCAGGAGGTCTTGGTGG - Intergenic
1061179260 9:129014231-129014253 TGCCCTCAAGGGAGCCTTGGTGG - Intronic
1061726269 9:132583550-132583572 TGCCCTTCCAGCAGTGCTGGTGG + Intronic
1062636859 9:137496042-137496064 TGGCCTTCAGGCAGCCTCTGAGG - Intronic
1186178884 X:6953762-6953784 TGGGCTTCAGCCAGGCTTGGAGG - Intergenic
1189199068 X:39176235-39176257 TGCCCATCAGGCAGTTGTGCTGG - Intergenic
1190767658 X:53488809-53488831 TCCCTTTCAGGAAGGCTTGGAGG + Intergenic
1200696282 Y:6363870-6363892 GCACCTTCAGGCAGTCTTTGTGG + Intergenic
1200963836 Y:9018743-9018765 GACCCTTCTGGCTGTCTTGGTGG + Intergenic