ID: 1161208916

View in Genome Browser
Species Human (GRCh38)
Location 19:3056337-3056359
Sequence CAGTACTACGAGATGTCCTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 79}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161208916_1161208925 2 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208925 19:3056362-3056384 TGGGGGAGAGAGAGGGGGAGCGG 0: 1
1: 7
2: 110
3: 1626
4: 9453
1161208916_1161208931 15 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208931 19:3056375-3056397 GGGGGAGCGGGAGATGGGGGTGG 0: 1
1: 1
2: 23
3: 356
4: 4027
1161208916_1161208922 -5 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208922 19:3056355-3056377 TACTGTATGGGGGAGAGAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 286
1161208916_1161208935 25 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208935 19:3056385-3056407 GAGATGGGGGTGGGGAAGGATGG 0: 2
1: 5
2: 54
3: 363
4: 2845
1161208916_1161208926 3 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208926 19:3056363-3056385 GGGGGAGAGAGAGGGGGAGCGGG 0: 1
1: 6
2: 102
3: 1487
4: 8655
1161208916_1161208939 29 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208939 19:3056389-3056411 TGGGGGTGGGGAAGGATGGGGGG 0: 2
1: 2
2: 37
3: 329
4: 3103
1161208916_1161208930 12 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208930 19:3056372-3056394 AGAGGGGGAGCGGGAGATGGGGG 0: 1
1: 1
2: 17
3: 332
4: 3516
1161208916_1161208927 9 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208927 19:3056369-3056391 GAGAGAGGGGGAGCGGGAGATGG 0: 1
1: 9
2: 314
3: 3688
4: 8710
1161208916_1161208933 17 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208933 19:3056377-3056399 GGGAGCGGGAGATGGGGGTGGGG 0: 1
1: 0
2: 14
3: 275
4: 2376
1161208916_1161208929 11 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208929 19:3056371-3056393 GAGAGGGGGAGCGGGAGATGGGG 0: 1
1: 1
2: 27
3: 256
4: 2196
1161208916_1161208936 26 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208936 19:3056386-3056408 AGATGGGGGTGGGGAAGGATGGG 0: 1
1: 1
2: 18
3: 150
4: 1343
1161208916_1161208934 21 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208934 19:3056381-3056403 GCGGGAGATGGGGGTGGGGAAGG 0: 1
1: 0
2: 43
3: 331
4: 2654
1161208916_1161208928 10 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208928 19:3056370-3056392 AGAGAGGGGGAGCGGGAGATGGG 0: 1
1: 0
2: 24
3: 413
4: 2487
1161208916_1161208923 -4 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208923 19:3056356-3056378 ACTGTATGGGGGAGAGAGAGGGG 0: 1
1: 0
2: 3
3: 47
4: 529
1161208916_1161208938 28 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208938 19:3056388-3056410 ATGGGGGTGGGGAAGGATGGGGG 0: 1
1: 1
2: 26
3: 206
4: 2032
1161208916_1161208924 -3 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208924 19:3056357-3056379 CTGTATGGGGGAGAGAGAGGGGG 0: 1
1: 0
2: 5
3: 87
4: 659
1161208916_1161208937 27 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208937 19:3056387-3056409 GATGGGGGTGGGGAAGGATGGGG 0: 1
1: 2
2: 28
3: 251
4: 2019
1161208916_1161208932 16 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208932 19:3056376-3056398 GGGGAGCGGGAGATGGGGGTGGG 0: 1
1: 0
2: 11
3: 205
4: 1685
1161208916_1161208921 -6 Left 1161208916 19:3056337-3056359 CCGTAGGACATCTCGTAGTACTG 0: 1
1: 0
2: 2
3: 18
4: 79
Right 1161208921 19:3056354-3056376 GTACTGTATGGGGGAGAGAGAGG 0: 1
1: 0
2: 1
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161208916 Original CRISPR CAGTACTACGAGATGTCCTA CGG (reversed) Exonic
909858670 1:80575219-80575241 TAATACTAAGAGATGCCCTAAGG + Intergenic
913039199 1:115006570-115006592 GAATACTAAGAGATGCCCTAAGG + Intergenic
913104302 1:115597658-115597680 TAATACTAAGAGATATCCTAAGG + Intergenic
918815292 1:189173017-189173039 TAATACTAAGAGATGTCCTAAGG - Intergenic
919318215 1:196001169-196001191 TAATACTAAGAGATGCCCTAAGG - Intergenic
920067422 1:203278727-203278749 CAGTCCTACCAGATTTCCCAGGG + Intergenic
1068856883 10:61806704-61806726 TAATACTAAGAGATGCCCTAAGG - Intergenic
1068908729 10:62356039-62356061 TAGTACTAAGAGATGCCCTAAGG + Intergenic
1071673683 10:87635606-87635628 TAATACTAAGAGATGGCCTAAGG + Intergenic
1073172745 10:101525673-101525695 CAGCACTAGGGGATGTTCTATGG - Intronic
1085201131 11:74702914-74702936 CAGTTCTACCAGGTGTCCCAAGG - Exonic
1088062976 11:105679955-105679977 TAATACTAAGAGATGCCCTAAGG + Intronic
1089846340 11:121461444-121461466 CAGTAATAGGAGATGCCCTCTGG - Intronic
1093981368 12:25478997-25479019 TAATACTAAGAGATGCCCTAAGG + Intronic
1096023414 12:48340870-48340892 CAGTATTAGGAGATGCCCCAGGG - Exonic
1097975919 12:65685807-65685829 CAAGAATACCAGATGTCCTATGG + Intergenic
1099429531 12:82565555-82565577 CAGGACTAGGAGATGTACTGGGG + Intergenic
1107275555 13:38674498-38674520 TAATACTAAGAGATGCCCTAAGG - Intergenic
1108572071 13:51761674-51761696 AAGTACTACAAGCTGTCCTCAGG + Exonic
1113111331 13:106827453-106827475 TAGTACTAAGAGATTTCCTAAGG + Intergenic
1116068332 14:40010956-40010978 TAATACTAAGAGATGCCCTAAGG - Intergenic
1127170110 15:56292429-56292451 GAATACTCAGAGATGTCCTAGGG - Intronic
1128742590 15:70094557-70094579 TAGTACTATGAGATGTCCTATGG - Exonic
1131724260 15:95204598-95204620 TAATACTAAGAGATGCCCTAAGG - Intergenic
1133737008 16:8623448-8623470 CAGGACTTAGAGATGTCCTGGGG - Intronic
1141559284 16:84856238-84856260 TAATACTAAGAGATGCCCTAAGG + Intronic
1148589001 17:48801428-48801450 GAGTACTACAAGATCTCCTCGGG + Intronic
1149628335 17:58096818-58096840 TAGTACTACGAGATGACCTAAGG + Intergenic
1152549521 17:81022597-81022619 CAGTCCCACGAAATGTCCAATGG + Intergenic
1156118672 18:33817498-33817520 TAATAATAAGAGATGTCCTAAGG - Intergenic
1156435098 18:37118476-37118498 TAGAACTAAGAGATGTCCTAAGG + Intronic
1156593905 18:38523809-38523831 TAGAACTAAGAGATGCCCTAAGG - Intergenic
1159293307 18:66450084-66450106 CAGTACTAAGAGATACCCTAAGG + Intergenic
1159492921 18:69161916-69161938 CAGTTCAGCGAGATGTCCAAAGG - Intergenic
1159767834 18:72510995-72511017 TAATACTAGGAGATGTCCTAAGG - Intergenic
1161203245 19:3027854-3027876 CAGTATTATGAGATGTCGTACGG - Exonic
1161208916 19:3056337-3056359 CAGTACTACGAGATGTCCTACGG - Exonic
1164186975 19:22879042-22879064 CAGAAATACCAGGTGTCCTATGG + Intergenic
1166915113 19:46190155-46190177 CAGAATCACGAGATGACCTATGG - Intergenic
927010876 2:18903034-18903056 TAGTACTAGGTGAGGTCCTAAGG + Intergenic
933265458 2:80176671-80176693 TAATACTAAGAGATGCCCTAAGG + Intronic
936480629 2:112881708-112881730 CAGTACTTAGTGATGTCGTAAGG - Intergenic
938218085 2:129539387-129539409 AAGTACTAATAGATGTCCTTAGG + Intergenic
945662522 2:212704084-212704106 GAGTACTACCAGTTGGCCTAGGG - Intergenic
947281775 2:228463213-228463235 TAATACTAAGAGATGTCCTAAGG + Intergenic
1169903857 20:10580646-10580668 AAGTACTATGTGAGGTCCTAGGG - Intronic
1170532367 20:17307521-17307543 CTGTACTAGGAGAGATCCTATGG - Intronic
1177752510 21:25302698-25302720 CAGTCCTAGGAGATATTCTAAGG + Intergenic
1177940913 21:27410602-27410624 TAATACTAAGAGATGCCCTAAGG + Intergenic
952444103 3:33363678-33363700 TAGTACTACAGGATGCCCTAAGG + Intronic
953848728 3:46449339-46449361 CAGTCCCAAGAGATGGCCTAGGG + Intronic
955640722 3:61081084-61081106 AAGTACTAGGAGATTTGCTAGGG - Intronic
957712354 3:83877754-83877776 CAGTACTAAGGGATGCCCCAGGG + Intergenic
961710732 3:128826224-128826246 TAATACTAAGAGATGCCCTAAGG + Intergenic
970371743 4:15414429-15414451 CAGAACTATGAGATGTCATTGGG - Intronic
970629534 4:17925300-17925322 TAATACTAAGAGATGTCTTAAGG - Intronic
974447803 4:62009078-62009100 CACTACTACGAAATCACCTAAGG + Intronic
974478803 4:62419027-62419049 TAATACTAAGAGATGCCCTAAGG + Intergenic
977849227 4:101804406-101804428 CAGTACAAAGAGATGTCTCATGG + Intronic
978986290 4:115016701-115016723 TAATACTACAAGATGCCCTAAGG - Intronic
982787990 4:159558577-159558599 TAATACTGAGAGATGTCCTAAGG + Intergenic
984410369 4:179390467-179390489 TAGTGCTAAGAGATGGCCTAAGG + Intergenic
987466342 5:18276283-18276305 TAATACTAAGAGATGTCCTAAGG - Intergenic
987490632 5:18576639-18576661 TAGTACAAAGAGATGTCCTACGG + Intergenic
993780907 5:92064175-92064197 TAATACTAAGAGATGTCCTAAGG - Intergenic
996018813 5:118569667-118569689 TAATACTAAGAGATGCCCTAAGG - Intergenic
996488479 5:124064885-124064907 TAATACTAAGAGATGCCCTAAGG + Intergenic
1018425495 6:163676663-163676685 TAATACTAAGAGATGCCCTAAGG - Intergenic
1018534788 6:164808616-164808638 TAATACTAAGAGATGCCCTATGG + Intergenic
1018767290 6:166944521-166944543 CAGCTCTCCGAGATGTCCTAGGG + Intronic
1018865370 6:167743202-167743224 TGGTACTATGAGATGCCCTAAGG - Intergenic
1021401145 7:20210670-20210692 CAGTGCTAAGAGATGTACTTGGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027490556 7:78819386-78819408 CAGTACTTGGTGATGTCCTAAGG + Intronic
1030192648 7:106824801-106824823 TAGTACTAAGAGATGCCCTAAGG - Intergenic
1031871019 7:127090390-127090412 CATGACTGCAAGATGTCCTAAGG - Intronic
1032858059 7:135853402-135853424 TAATACTAAGAGATGCCCTAAGG + Intergenic
1037953895 8:23038184-23038206 TAATACTAAGAGATGCCCTAAGG - Intronic
1038673147 8:29598342-29598364 CAGTACAAGGAGATGACCAAAGG + Intergenic
1039626311 8:39058506-39058528 TAATACTAAGAGATGCCCTAAGG + Intronic
1040793894 8:51268596-51268618 TAATACTAAGAGATGCCCTAAGG + Intergenic
1047327232 8:123851535-123851557 TAATACTAAGAGATGCCCTAAGG + Intergenic
1049288541 8:141789709-141789731 CAGTAATTCTAGGTGTCCTATGG + Intergenic
1050053131 9:1623698-1623720 TAATACTAAGAGATGCCCTAAGG - Intergenic
1051971364 9:22891343-22891365 CAATACTAAGAGATATTCTAAGG - Intergenic
1052561332 9:30088205-30088227 TAATACTAAGAGATGTCCTAAGG + Intergenic
1055758086 9:79576130-79576152 CAGTATTATGAAATGTCCTATGG + Exonic
1055944989 9:81685701-81685723 CAGTATTATGAAATGTCATATGG - Exonic
1056090814 9:83203820-83203842 CAGAACTAAGGGAGGTCCTATGG + Intergenic
1056240820 9:84644917-84644939 TAATACTAAGAGATGCCCTAAGG + Intergenic
1056453609 9:86739720-86739742 CAGTGCTAGGCGCTGTCCTAGGG + Intergenic
1056525851 9:87442434-87442456 TAATACTAAGAGATGCCCTAAGG + Intergenic
1186128144 X:6438053-6438075 CAGTATGAAGAGATGTCCAATGG + Intergenic
1190155239 X:47986025-47986047 TAATACTAAGAGATGCCCTAAGG - Intronic
1191631497 X:63326657-63326679 TAGTACTAAGAGATGCCCTAAGG - Intergenic
1192896527 X:75448151-75448173 TAATACTAAGAGATGCCCTAAGG - Intronic
1193914577 X:87350171-87350193 TAATATTAAGAGATGTCCTAAGG + Intergenic
1193979125 X:88159209-88159231 TAATACTAAGAGATGCCCTAAGG - Intergenic
1195465950 X:105179093-105179115 AAATACTAAGAGATGACCTAAGG - Intronic
1201910145 Y:19125519-19125541 CAGTCCTAGGAGATGTTCTAAGG - Intergenic